Conserved signaling through vascular endothelial growth (VEGF) receptor family members in murine lymphatic endothelial cells

E XP E RI ME N T AL C E L L R E S EA RC H 31 7 ( 20 1 1) 2 3 9 7– 2 40 7

available at www.sciencedirect.com

www.elsevier.com/locate/yexcr

Research Article

Conserved signaling through vascular endothelial growth (VEGF) receptor family members in murine lymphatic endothelial cells Sanja Coso, Yiping Zeng, Dhanya Sooraj, Elizabeth D. Williams⁎ Centre for Cancer Research, Monash Institute of Medical Research, Monash University, Clayton, Victoria, Australia

A R T I C L E I N F O R M A T I O N

A B S T R A C T

Article Chronology:

Lymphatic vessels guide interstitial fluid, modulate immune responses by regulating leukocyte

Received 26 November 2010

and antigen trafficking to lymph nodes, and in a cancer setting enable tumor cells to track to

Revised version received 17 July 2011

regional lymph nodes. The aim of the study was to determine whether primary murine lymphatic

Accepted 23 July 2011

endothelial cells (mLECs) show conserved vascular endothelial growth factor (VEGF) signaling

Available online 2 August 2011

pathways with human LECs (hLECs). LECs were successfully isolated from murine dermis and prostate. Similar to hLECs, vascular endothelial growth factor (VEGF) family ligands activated

Keywords:

MAPK and pAkt intracellular signaling pathways in mLECs. We describe a robust protocol for

Lymphatic endothelial cell

isolation of mLECs which, by harnessing the power of transgenic and knockout mouse models, will

Vascular endothelial growth factor

be a useful tool to study how LEC phenotype contributes to alterations in lymphatic vessel

Migration

formation and function. Crown Copyright © 2011 Published by Elsevier Inc. All rights reserved.

Introduction Lymphatic endothelial cells (LECs) are indispensable components of the lymphatic system, which in turn plays pivotal roles during development and in the maintenance of health as well as in various disease states [1]. The lymphatic system is a network of vessels for the transportation of fluid, plasma proteins, and leukocytes from the periphery to the lymph nodes and the blood circulatory system. It is an open-ended linear system through which tissue fluid is drained from the interstitial space of most organs and transported via thin capillaries to the larger connecting lymphatics that eventually connect via the thoracic duct to the inferior vena cava for recirculation. Lymphatic capillaries typically have an irregular lumen lined by a single layer of overlapping and attenuated LECs that are directly connected to the surrounding extracellular matrix (ECM), and lack a continuous basement

membrane and pericyte coverage. Major research efforts are currently directed at determining how these cells function within lymphatic vessels, how they regulate tissue fluid, and how they interact with migrating cells, such as dendritic cells, monocytes, T cells, and tumor cells. Despite their importance in homeostasis and disease, the difficulties in enriching and culturing LECs has limited studies of their biology to date. Human LECs have been successfully isolated from various organs, including prostate [2] and dermis [3,4]. They are distinguished by specific molecular markers, such as vascular endothelial growth factor receptor-3 (VEGFR-3) [5], podoplanin [6], Prox-1 [7] and LYVE-1 [8]. Although these markers are not strictly exclusive for lymphatic vessels [9], positivity for at least two of them has been used to identify LECs under physiological and pathological conditions [4,10–15]. Only a few studies to date

⁎ Corresponding author at: Monash Institute of Medical Research, 27-31 Wright St, Clayton, Victoria, 3168, Australia. Fax: + 61 3 9594 7252. E-mail address: [email protected] (E.D. Williams). Abbreviations: BSA, bovine serum albumin; BVEC, blood vascular endothelial cell; EBM, endothelial basal media; EGM, endothelial growth media; ECM, extracellular matrix; FBS, fetal bovine serum; HUVEC, human umbilical vein endothelial cell; LEC, lymphatic endothelial cell; VEGF, vascular endothelial growth factor; VEGFR, vascular endothelial growth factor receptor. 0014-4827/$ – see front matter. Crown Copyright © 2011 Published by Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2011.07.023

2398

E XP E RI ME N T AL C E L L R E SE A RC H 31 7 ( 20 1 1) 2 3 97 – 2 40 7

report isolation of murine LECs. These include isolation of murine LECs from benign lymphangiomas [16], hyperplastic lymphatic vessels [17] and SV40 large T antigen immortalized murine LECs from mesenteric lymphatic tissue [18,19]. There are various challenges in isolating murine LECs, including cell purity (studies to date have used LYVE-1 and podoplanin antibodies to isolate murine LECs), and obtaining a sufficient number of cells to perform in vitro experiments. There are a number of publications describing signaling pathways that are activated in human LECs, mainly concentrating on VEGF ligands and their receptors. By contrast, there are no publications that describe molecular mechanisms regulating biological functions of murine LECs, and thus it is unknown whether murine LECs are a good model for human LECs. Here we report the isolation and characterisation of pure populations of LECs from murine dermal and prostate tissue using a CD34 negative depletion, CD31 positive selection strategy coupled with growth in media designed to support endothelial cells. We characterize, for the first time, the intracellular signaling pathways activated by various VEGF ligands in these cells and demonstrate how these are linked to a migratory response. The significance of the reported data is twofold: it describes a robust technique for isolation of murine LECs, and shows that VEGFR signaling pathways are transduced in a manner reminiscent of that previously reported for human LECs. Thus these cells provide an excellent tool to study human LEC biology and its aberrant regulation in diseases associated with lymphatic vessel dysfunction.

Materials and methods Cell lines Primary neonatal human dermal LECs and HUVECs were purchased from Lonza (Switzerland) and maintained in EGM™-2 MV medium (Lonza). Murine LECs (and blood vascular endothelial cells (BVECs)) were isolated from C57Bl/6 mice (approximate age 5 months). All studies were conducted with the approval of the Monash University Animal Research Ethics Committee and in accordance with Australian National Health and Medical Research Council guidelines.

Antibodies and recombinant proteins Antibodies against phospho-Erk1/2 (p44/42 MAPK, Cat. no. 9101S) and Akt (Ser437, Cat. no. 9271S) and total-Erk1/2 (p44/42 MAPK (137F5), Cat. no. 4695) and Akt (Cat. No. 9272) were obtained from Cell Signaling Technology (Danvers, MA). The other antibodies used were: goat anti-mouse VEGFR-2 (Cat. no. AF357); neutralizing antimouse VEGFR-2 (Cat. no. AF644) and goat anti-mouse VEGFR-3 (Cat. no. AF359) (all from R&D Systems, Minneapolis, MN); mouse antihuman JNK1 (clone: G-7, Cat. no. sc-6254) and goat anti-mouse LYVE-1 (clone: E13, Cat. no. sc-31289) both from Santa Cruz Biotechnology (Santa Cruz, CA); rabbit anti-human Prox1 (Cat. no. 20R-PRO39, Research Diagnostics, Flanders, NJ), mouse anti-human pan-actin (Ab-5, NeoMarkers, Thermo Fisher Scientific, Fremont, CA), mouse anti-human beta tubulin (Cat. no. 32-2600, Zymed, San Francisco, CA), rat anti-mouse CD34 (clone: MEC 14.7, Cat. no. ab8158, Abcam, UK) and rat anti-mouse CD31 (clone: 309, Cat. no. 553708, BD Biosciences, Franklin Lakes, NJ). Alexa Fluor 488- and 568-conjugated (Invitrogen, Carlsbad, CA), and IRDye700DX conju-

gated anti-mouse IgG and IRDye800CW conjugated anti-rabbit IgG (Rockland Immunochemicals, Boyertown, PA) secondary antibodies were used. Recombinant human VEGF-A165 (Cat. no. 293VE), VEGF-C (Cat. no. 2179VC), VEGF-C Cys156Ser (Cat. no. 752VC/CF) and VEGF-D (Cat. no. 622VD) were purchased from R&D Systems. VEGF-E (Orf virus, D1701 variant) was purchased from ProSpec (Israel).

Primary culture of lymphatic endothelial cells from murine tissue Dermal LEC isolation Skin samples were rinsed with phosphate buffer saline (PBS) supplemented with 100 U/ml penicillin G and 100 μg/ml streptomycin (Gibco, Australia). The skin sample from each mouse was cut into small pieces (4 mm3), placed with dermis facing downwards in a petri dish containing Dulbecco's Modified Eagle's Medium (DMEM) (Gibco) supplemented with 5% fetal bovine serum (FBS; Gibco) (DMEM/5% FBS) and 5 mg/ml Dispase II (Roche, Indianapolis, IN), and incubated at 4 °C overnight on a rocker. The following day, the dermis was separated from the epidermis by peeling back the epidermal layer of all pieces using sterile tweezers, as previously described [20]. Dermal layers were collected into DMEM/5% FBS, the supernatant aspirated and the dermal pieces minced using scalpels. After a 45 minute incubation in PBS containing 0.25% Collagenase II (Worthington, Lakewood, NJ), 0.01% DNaseI (Worthington) and 0.1% bovine serum albumin (BSA) (Sigma-Aldrich, St. Louis, MI) at 37 °C, dermal tissue was gently squeezed in DMEM/5% FBS. The resulting cell suspension was passed through a 100 μm nylon cell strainer (BD Biosciences, Bedford, MA), and rinsed twice with DMEM/5% FBS. Following centrifugation at 469 g for 5 min at room temperature, the cell pellet was resuspended in complete endothelial cell growth medium (EGM™-2 MV, Cambrex, Walkersville, MD), seeded on a 1% gelatin (Sigma-Aldrich) coated T25 flask (BD Biosciences), and placed in a humidified incubator at 37 °C, 5% CO2. After a 24 hour incubation period, non-adherent cells were removed by two gentle PBS washes. The culture medium was changed every 48 h. Cell selection was performed at 90% confluence. Phase-contrast images were captured using Olympus 1×71 inverted microscope (MidAtlantic Diagnostics, Mount Laurel, NJ).

Prostate LEC isolation Similarly to dermal LECs, prostate samples were rinsed with PBS supplemented with 100 U/ml penicillin G and 100 μg/ml streptomycin. Prostate pieces were collected in DMEM/5% FBS, supernatant aspirated and the pieces minced using scalpels into 4 mm3 pieces. The prostate LECs were then processed using collagenase as per the dermal LEC isolation protocol described above.

CD34 depletion followed by CD31 positive selection of murine LECs Pure (>99.9%) dermal and prostate murine lymphatic endothelial cell populations from the sub-confluent primary cultures were achieved using the CD34 and CD31 combined selection method as previously described [21]. Briefly, CD34-positive BVECs were isolated by immunomagnetic purification using Dynabeads (Invitrogen) pre-

2399

E XP E RI ME N T AL C E L L R E S EA RC H 31 7 ( 20 1 1) 2 3 9 7– 2 40 7

coated with anti-mouse CD34 antibody (Abcam, UK). To achieve a maximal depletion, the ratio of Dynabead:target BVECs was 10:1 and the target BVECs were assumed to be 100% of the cells. Cells were incubated with CD34 pre-coated Dynabeads at 4 °C for 30 min with end-over-end rotation. Thereafter, the remaining CD34-negative cells were incubated with immunomagnetic beads pre-coated with anti-mouse CD31 antibody (BD Biosciences) to isolate LECs at 4 °C for 20 min. The ratio of Dynabeads:target LEC was 4:1 and the target LECs were estimated as 5% of primary cells. Isolated dermal murine lymphatic endothelial cells (CD31+/CD34− population) were seeded onto gelatin-coated culture plates and propagated in complete endothelial cell growth medium. Isolated BVECs (CD34+ population) were cultured in the same medium. Murine LECs remained negative for CD34 expression for at least four passages. LECs between passage 1 and passage 4 were used for experiments.

Real-time quantitative RT-PCR Total RNA was isolated using RNeasy Microkits (Qiagen, Germany). One microgram of total RNA was used in each cDNA synthesis reaction and 10 ng of cDNA was used in each PCR reaction. Primers and probes (sequences described in Table 1) were designed using Primer 3 software and were synthesized by Sigma-Aldrich (Australia). The ABI Prism 7000 Sequence Detection System (Applied Biosystems, Carlsbad, CA) was used to perform SYBR-Green based real-time RT-PCR reactions. SYBR-Green PCR Master Mix was used for all SYBR-Green reactions with the addition of reverse transcriptase. Expression data were normalized based on the expression levels of ribosomal gene L32 mRNA. ΔCt values were determined by following formula: ΔCt= Ct (target gene) − Ct (L32), and the ΔΔCt method used to describe fold differences in mRNA levels as previously described [22].

Western blotting and immunoprecipitation analyses Cells were cultured to ~80% confluence in a culture flask for 24 h prior to treatment. In ligand treatment experiments, mLECs were serum starved overnight prior to ligand stimulation with either VEGF-A165 (100 ng/ml), VEGF-C (100 ng/ml), VEGF-D (100 ng/ml), VEGF-C156S (500 ng/ml) or VEGF-E (50 ng/ml) (all from R&D systems) in serumfree media for 0, 10, 30, 60 or 120 min. Cell monolayers were then

treated with lysis buffer (RIPA; 50 mM TRIS–HCl, pH 7.5, 150 mM NaCl, 0.5% NP-40, 5 mM EDTA) containing the protease inhibitors phenylmethane sulfonyl-fluoride (1 mM), aprotinin (10 μg/ml), and leupeptin (10 μg/ml) (all from Sigma-Aldrich). Samples were run on non-reducing 4–12% SDS-polyacrylamide gels (Invitrogen, Carlsbad, CA) and blotted onto Hybond ECL nitrocellulose membranes (Amersham Biosciences, Germany). Detection was performed using an Odyssey (LI-COR Biosciences, Lincoln, NE) and secondary antibodies as described above. Pan-actin and beta-tubulin antibodies were used as loading controls. Densitometry analysis of Western blotting results was performed using Odyssey software. Integrated intensity of phosphorylated molecules was firstly compared to that of the total target protein for each sample, and then expressed as fold increase in integrated density compared to serum-free control samples. For immunoprecipitation, whole cell lysates were incubated with anti-VEGFR-3 or isotype IgG and protein pulled down using Protein A/G Plus-agarose beads (Santa Cruz). Protein samples were separated by SDS-PAGE, transferred to nitrocellulose membranes and immunoblotted with anti-VEGFR-3. Signals were visualized using an Odyssey Infrared Imaging System. The experiments were performed using primary human neonatal LECs and HUVECs as well as isolated mLECs and mBVECs. All experiments were performed using duplicates of three unique mLEC cell lines (each isolated from a different mouse).

Immunofluorescence microscopy For PROX-1 and CD34 immunofluorescent staining of cultured LECs, cells were rinsed twice in PBS (pH 7.5) and then fixed in methanol/ acetone for 5 min at −20 °C. After rinsing the cells in PBS, blocking reagent (DAKO, Australia) was applied for 1 h at room temperature. Primary antibodies were applied in antibody diluent (DAKO). AntiCD34 and anti-PROX1 were used at 1 μg/ml concentration alongside concentration matched isotype controls, and incubated at 4 °C overnight. For VEGFR-3, anti-CD31 and anti-LYVE-1 staining, cells were rinsed with PBS, then fixed in 2% paraformaldehyde for 10 min at room temperature. Samples were then blocked with blocking reagent (DAKO, Australia) for 30 min at room temperature and primary antibodies: anti-VEGFR-3, anti-CD31 and anti-LYVE-1 and their isotype matched controls were applied in antibody diluent (DAKO) at 4 °C overnight. Cells were washed briefly with PBS before incubation

Table 1 – Primers used in this project. Gene transcript name

Forward sequence

Reverse sequence

Murine L32 LYVE-1 PROX-1 Podoplanin VEGFR-2 VEGFR-3

TACTGTGCCGAGATGCTCG CACAACTCATCCGACACCTG GCAGCTCATCAAGTGGTTCA GCCAGTGTTGTTCTGGGTTT GGCGGTGGTGACAGTATCTT CAGCTGCCAGCACCTATGTGTTT

AAAACGTGCACATGAGCTGC TGCTTCGTTCTTGAATGCTG GGCATTGAAAAACTCCCGTA AGAGGTGCCTTGCCAGTAGA GTCACTGACAGAGGCGATGA GACCAGGAGCGTGTCAGGTTT

Human L32 LYVE-1 PROX-1 Podoplanin VEGFR-2 VEGFR-3

CAGGGTGCGGAGAAGGTTCAAGGG AGCTATGGCTGGGTTGGAGA CTGAAGAGCTGTCTATAACCAG CGAGGATCTGCCAACTTCAGAAA GTCAAGGGAAAGACTACGTTGG CACTCCCGCCATACGCCACATCAT

CTTAGAGGACACGTTGTGAGCAATC CCCCATTTTTCCCACACTTG GGATCAACATCTTTGCCTGCG CAACCAGGGTCACTGTTGACAAA AGCAGTACCAGCATGGTCTG CTGCTCTCTATCTGCTCAAACTCC

2400

Phase contrast

A. Murine LECs

B.

VEGFR-3 / DAPI

Phase contrast Human LECs

CD31 / DAPI

LYVE-1 / DAPI

PROX-1/ DAPI

PROX-1/ DAPI

C. Tube formation ***

Tube length (mm)

250

*** 200

***

150 100 50 0 0

1.5

3

4.5

6

Time (hours)

Fig. 1 – Characterisation of murine dermal LECs and BVECs. A. Phase-contrast image of dermal mLECs (passage 4); CD31 (green), VEGFR-3 (green), LYVE-1 (green), PROX-1 (green) and CD34 (green) immunocytochemistry. Nuclei stained with 4,6-diamidino-2-phenylindole (DAPI); blue. B. Phase contrast image of human dermal LECs; CD31 (green), VEGFR-3 (green) and PROX-1 (green) immunocytochemistry. C. Phase-contrast morphology of three-dimensional Matrigel culture (6 h) of isolated LECs; tube length quantified over time (right panel). Columns: mean; bars: SEM; n = 3. P < 0.001 (***). Data are representative of three separate experiments. Scale bar 50 μm.

E XP E RI ME N T AL C E L L R E SE A RC H 31 7 ( 20 1 1) 2 3 97 – 2 40 7

CD34 / DAPI

CD31 / DAPI

2401

E XP E RI ME N T AL C E L L R E S EA RC H 31 7 ( 20 1 1) 2 3 9 7– 2 40 7

Human

A.

Murine

HUVEC Neonatal Lung LEC LEC

hLEC mLEC HUVEC mBVEC

B.

LEC BVEC

[kDa]

[kDa] 230

VEGFR-2 35 (human); 34 (mouse)

LYVE-1

42 pan-actin

IP: VEGFR-3 + IP: IgG -

HUVEC

+ -

+

+ -

+ -

hLEC mLEC mLEC HUVEC mBVEC [kDa]

IB: VEGFR-3

Fold change relative to BVEC

C. 40

mBVEC mLEC

30

***

D.

20

VEGFR-2 / VEGFR-3 PLA

VEGFR-2 / VEGFR-3 PLA

*** 10

Growth media

Growth media IgG control

0 LYVE-1

VEGFR-2

VEGFR-3

Podoplanin

Human LECs Fold change relative to HUVEC

195

Murine LECs

40

Prox1

***

HUVEC LEC

E.

30

VEGFR-2 / VEGFR-3 PLA Basal media

20

10

VEGFR-2 / VEGFR-3 PLA VEGF-C

***

*** 0 LYVE-1

VEGFR-2

VEGFR-3

Podoplanin

Prox1

Fig. 2 – Protein and gene expression profiling of murine dermal LECs and BVECs. A. Western blotting showed murine LECs (mLECs) and BVECs (mBVECs) expressed LYVE-1 protein (34 kDa), as do human LECs (hLECs) and HUVECs (35 kDa); B. Both murine and human LECs, as well as murine BVECs, expressed VEGFR-2 (~230 kDa). Immunoprecipitation analysis showed expression of VEGFR-3 (195 kDa) in mLECs and hLECs, as well as in mBVECs and HUVECs. Immunoprecipitation of mLECs with IgG isotype control served as a negative control. C. qRT-PCR analysis of dermal mLECs (top panel) showed high expression of podoplanin and VEGFR-3 gene expression compared to mBVEC (data normalized to mBVECs), similar to human LECs (bottom panel) (data normalized to HUVECs). Expression of each gene was initially normalized to the house-keeping gene L32. P value calculated using one-way ANOVA, each column compared to time-point zero. Columns: mean; bars: SEM. n = 3. P < 0.001 (***) D. Detection of endogenous VEGFR-2/VEGFR-3 complexes (red spots) using the in situ proximity ligation assay (PLA) in mLECs grown in full growth media (D, left panel); PLA isotype IgG control (D, right panel); in serum-free media under basal conditions (E, left panel) or in the presence of VEGF-C (200 ng/ml) (E, right panel). DAPI shows nuclear stain (blue). Scale bar 50 μm.

with Alexa Fluor secondary antibodies at 10 μg/ml in antibody diluent (DAKO). 4′,6-diamidino-2-phenylindole (DAPI) (1 μg/ml) was used as a nuclear stain. Images were captured on a Nikon C1 inverted Confocal microscope (Japan) using the 400× objective. Number of cells positive for lymphatic endothelial markers (PROX1 and LYVE1) were quantified using ImageJ and at least 5 randomly selected fields. All experiments were performed using duplicates of three unique mLEC cell lines.

Monolayer wound healing Murine LECs (2 × 104) were seeded in 96-well plates, and grown in EGM-2 MV medium overnight. A wound was made by scraping the confluent monolayer with a sterile P200 pipette tip, and the cells were grown in EGM growth medium supplemented with 5% FBS. To assess the effect of VEGF ligand treatment, cells were serum starved for 24 h, wounded and then treated EBM-SF/0.1% BSA as

2402

E XP E RI ME N T AL C E L L R E SE A RC H 31 7 ( 20 1 1) 2 3 97 – 2 40 7

control, or with recombinant VEGF-A165 (100 ng/ml), VEGF-C (200 ng/ml) or VEGF-D (100 ng/ml) diluted in serum free endothelial basal media (EBM-SF)/0.1%BSA. The migration of the cells was digitally recorded using an Olympus microscope every 8 h after wounding. The experiment was terminated when the LEC wound was closed. The area of the uncovered wound gap was measured using ImageJ software, and the percentage of wound closure was calculated at each time point. All experiments were performed using duplicates of three unique mLEC cell lines.

Bonferroni post-test for multiple comparisons. Results are presented as mean ± S.E. P < 0.05 was considered statistically significant. All calculations were performed using GraphPad Prism 4.0 (GraphPad Software, San Diego, CA). All experiments had at least three technical and three biological replicates.

Results Murine LECs maintain their lineage-specific phenotype in vitro

Tube formation assay To assess the tube-forming ability of isolated LECs, Matrigel™ (BD Biosciences, NJ) was allowed to polymerize in a 96-well plate and mLECs were seeded on top of the gel at a density of 3 × 104 per well in EGM-2 MV medium. All tube formation experiments were observed using inverted microscopy (Olympus), and images were digitally captured at 0, 1.5, 3, 4.5 and 6 h after plating. All experiments were done using three unique murine cell lines.

Proximity ligation assay Cells were plated into 16-well chamber slides (Lab-Tek II, Nalge Nunc International, Australia) at a density of 5000 cells/well. After a 24 hour incubation, LECs were serum starved for 16 h prior to treatment with VEGF-C (200 ng/ml) for 15 min. LECs were then fixed in 10% formalin and subjected to the in situ proximity ligation assay (PLA). Briefly, after protein block (Olink Bioscience, Sweden), permeabilization and overnight incubation with primary antibodies (goat anti-human VEGFR-3 and mouse anti-human VEGFR-2), PLA was performed as per the manufacturer's protocol [23] using the PLA PLUS and MINUS probes for goat and mouse and the Duolink detection kit 613 (Olink Bioscience). DAPI was included to stain nuclei. Duolink mounting medium (Olink Bioscience) was used to coverslip each well and staining evaluated using a Nikon C1 confocal microscope.

Statistical analyses Data obtained in densitometry analyses of Western blotting were analyzed using one-way repeated measures ANOVA followed by

In situ PLA reveals VEGFR-2/-3 heterodimerization in murine LECs We next examined the pattern of VEGFR-2 and VEGFR-3 heterodimerization in mLECs. Murine LECs cultured in full growth media demonstrated heterodimerisation between VEGFR-2/3 (Fig. 2D, left panel) as detected by proximity ligation assay. This is consistent with the previous demonstration of these complexes in human LECs [25]. VEGF-C treatment significantly increased VEGFR-2/VEGFR-3 interactions in mLECs (Fig. 2D and E). mLECs+

*** *** *** *** ***

100

% wound closure

Isolated mLECs maintained a typical cobblestone-like endothelial morphology in monolayer culture (Fig. 1A), comparable to human LECs (Fig. 1B). Immunofluorescent staining with an antibody to CD31, revealed positive staining for CD31 in both murine (Fig. 1A) and human (Fig. 1B) cell lineages. Lymphatic cells specific staining with PROX1 was localized to the nucleus in murine (99%; Fig. 1A) and human LECs (Fig. 1B) with some membrane staining observed in the murine LECs (consistent with a previous report [24]). All isolated murine LECs were positive for LYVE-1 staining (Fig. 1A). The staining for all markers was consistent for all four cell passages. Isolated mLECs were able to form tubes 6 h after plating on Matrigel™ (Fig. 1C). mLECs expressed 34 kDa LYVE-1 protein (Fig. 2A), 230 kDa VEGFR-2 protein, as well as 195, 175 and 145 kDa protein forms of VEGFR-3 (Fig. 2B and Fig. S1). The selective expression of Prox-1 and podoplanin in LECs was confirmed at the level of mRNA (Fig. 2C).

Growth media Basal media/0.1% BSA

80

*** + VEGF-C (200 ng/ml) + VEGF-D (100 ng/ml)

60

+ VEGF-C156S (500 ng/ml) + VEGF-E (50 ng/ml) + anti-VEGFR-2 + VEGF-C

40 20 0 0

5

10

15

20

25

Time (h) Fig. 3 – VEGF family ligands stimulate migration of mLECs in a monolayer wound healing assay. Time course analysis showed that migration of murine LECs was significantly increased (P < 0.001) in growth media (EGM-2+ 5% FCS), and in basal media following stimulation with VEGF-C (200 ng/ml), VEGF-D (100 ng/ml), VEGF-E (50 ng/ml) and VEGF-C156S (500 ng/ml) P < 0.001 in all VEGF family ligand treated groups compared to basal media/0.1% BSA control. Neutralizing antibody to VEGFR-2 (100 ng/ml) reversed the effects of VEGF-C (200 ng/ml) on migration. Columns: mean; bars: SEM. Data are representative of three separate experiments.

2403

E XP E RI ME N T AL C E L L R E S EA RC H 31 7 ( 20 1 1) 2 3 9 7– 2 40 7

A.

mLEC -

0

10

30

60 (min)

VEGF-A

B.

P-Erk1 (44kDa) P-Erk2 (42kDa)

mLECs

Erk1 (44kDa) Erk2 (42kDa)

Erk1 (44kDa) Erk2 (42kDa)

Integrated intensity normalised to SF

P-Erk1 (44kDa) P-Erk2 (42kDa)

VEGF-C

P-Erk1 (44kDa) P-Erk2 (42kDa)

VEGF-D

pErk1 to total Erk1

3

***

*** 2

***

*** ***

** **

** **

1

0 0 10 30 60 10 30 60 10 30 60 10 30 60 10 30 60 (min) VEGF-A165 VEGF-C

VEGF-D

VEGF-E

VEGF-C156S

Erk1 (44kDa) Erk2 (42kDa) pErk2 to total Erk2

Erk1 (44kDa) Erk2 (42kDa)

VEGF-A

mBVEC -

0

10

30

60

(min) P-Erk1 (44kDa) P-Erk2 (42kDa) Erk1 (44kDa) Erk2 (42kDa)

VEGF-C

1

0 0

P-Erk1 (44kDa) P-Erk2 (42kDa) Erk1 (44kDa) Erk2 (42kDa)

10 30 60 10 30 VEGF-A165

D.

60 10

VEGF-C

30 60 10 30 60 (min)

30 60 10

VEGF-D

VEGF-E

VEGF-C156S

mBVECs 3

pErk1 to total Erk1 ***

***

2

***

*** ***

*** 1

0 0

P-Erk1 (44kDa) P-Erk2 (42kDa) Erk1 (44kDa) Erk2 (42kDa)

VEGF-D

Integrated intensity normalised to SF

P-Erk1 (44kDa) P-Erk2 (42kDa)

10

30

60

10

30

60

VEGF-A165 VEGF-C

Integrated intensity normalised to SF

VEGF-E

2

Integrated intensity normalised to SF

Erk1 (44kDa) Erk2 (42kDa)

.

C.

3

P-Erk1 (44kDa) P-Erk2 (42kDa)

C156S

10

30

60

(min)

VEGF-D

pErk2 to total Erk2

3

***

***

2

** **

**

*** **

1

0 0

10

30

60

VEGF-A165

10

30

60

VEGF-C

10

30

60 (min)

VEGF-D

Fig. 4 – VEGF-C and VEGF-D activated MAPK signaling pathway in murine LECs (mLECs) and BVECs (mBVECs). A. Western blotting showed elevated phospho-Erk1/2 levels in mLECs upon treatment with either VEGF-A165 (100 ng/ml), VEGF-C (100 ng/ml), VEGF-D (500 ng/ml), VEGF-E (50 ng/ml) or VEGF-C156S (500 ng/ml). Control untreated LEC (in growth media) whole lysate is indicated by (−). Serum-free untreated LEC (following overnight serum starvation) is indicated by (0). B. Densitometry analysis of Erk1/2 (A) shows strong phosphorylation of Erk1/2 upon stimulation with VEGF-A165: Erk1 (10 and 30 min) (B, top panel) and Erk2 (60 min) (B, bottom panel); VEGF-C (10 min, 30 min Erk1 and Erk2) and VEGF-D (10 min Erk1, 10 and 30 min Erk2); VEGF-E (50 ng/ml) and VEGF-C156S (500 ng/ml) phosphorylated both Erk1 and Erk2 at 10 and 30 min after treatment. C. Western blotting shows phosphorylation of Erk1/2 over a 60 minute time course in mBVECs. D. In BVECs, VEGF-A165 induced significant phosphorylation of Erk1/2 (P < 0.001 at 10, 30 and 60 min). VEGF-C and VEGF-D induced Erk1/2 phosphorylation at 10 min following after treatment, and levels remained elevated at 30 min (except VEGF-C, Erk1). P value calculated using one-way ANOVA, each column compared to time-point zero. Columns: mean; bars: SEM. P < 0.05 (*), P < 0.01 (**), P < 0.001 (***). Western blots are representative of three separate experiments.

VEGF-C and VEGF-D potently stimulate mLEC migration in vitro Both VEGF-C and VEGF-D induced mLEC migration (Fig. 3), consistent with observations using human LECs in vitro[26] and suggesting that lymphangiogenic receptors VEGFR-2 and VEGFR-3 play a role in migration of murine LECs. Indeed, treatment with a VEGFR-2 neutralizing antibody blocked the VEGF-C response. Stimulation with either a VEGFR-2 or a VEGFR-3 selective ligand,

VEGF-E [27] and VEGF-C156S [4] respectively, also increased the migration of cells above the baseline, suggesting that both of these receptors play a role in regulating the migration of mLECs.

VEGF-A165, VEGF-C and VEGF-D stimulation activates pErk1/2 in mLECs Activation of the p42/p44 MAPK (Erk1/Erk2) cascade has been linked in human LECs to a proliferation response and is an

2404

E XP E RI ME N T AL C E L L R E SE A RC H 31 7 ( 20 1 1) 2 3 97 – 2 40 7

A.

B.

mLECs -

0

10

30

VEGF-A

60 (min) pS473 Akt (60kDa) Total Akt

Total Akt pS473 Akt (60kDa)

VEGF-C

10

Integrated intensity normalised to SF

pS473 Akt (60kDa)

VEGF-D

Total Akt

***

5

***

***

0 0

C156S

pAkt to total Akt

mLECs

10

30

60

10

30

60

VEGF-A165 VEGF-C

pS473 Akt (60kDa)

10

30

60

VEGF-D

10

30

60 (min)

VEGF-C156S

Total Akt

VEGF-A

D.

mBVECs 0

10

30

60 (min) pS473 Akt (60kDa) Total Akt

VEGF-C

pS473 Akt (60kDa) Total Akt

10

Integrated intensity normalised to SF

C.

mBVECs

***

5

*** ***

pS473 Akt (60kDa)

***

***

0 0

VEGF-D

pAkt to total Akt

10

30

60

VEGF-A165

10

30

60

VEGF-C

10

30

60 (min)

VEGF-D

Total Akt

Fig. 5 – VEGF-C, but not VEGF-D, activates pAkt in murine LECs. Western blotting showed detectable phosphorylated Akt (pS473 Akt, 60 kDa) and total Akt in mLECs (A) and mBVECs (C). Control untreated LEC (in growth media) whole cell lysate is indicated by (−). Serum-free untreated LEC (following overnight serum starvation) is indicated by (0). Densitometry analysis of pAkt to total Akt in mLECs showed strong phosphorylation of pAkt upon treatment with VEGF-C (B), whereas VEGF-C156S (500 ng/ml), VEGF-D and VEGF-A165 did not have any effect on pAkt levels. VEGF-A165, VEGF-C and VEGF-D activated Akt (pS473) in mBVECs (D). Integrated intensity of each sample expressed as fold increase over serum-free treated control. P value calculated using one-way ANOVA, each column compared to time-point zero. Columns: mean; bars: SEM; P<0.001 (***). Western blots are representative of three separate experiments.

important survival pathway [4]. Furthermore, activation of the MAPK pathway by both VEGF-A and VEGF-C has been implicated in transgenic mLECs constitutively expressing SV40 tsA58T antigen [19]. Consistent with this, in isolated mLECs (and mBVECs) p44/p42 targets Erk1 and Erk2 were activated upon stimulation with either VEGF-A165, VEGF-C, VEGF-D or VEGF-E. The Erk1 response to each ligand peaked at 10 min, whereas the peak of the Erk2 response was more variable (10–60 min; Figs. 4A and B). A similar profile of responses was observed in BVECs (Figs. 4C and D).

mLEC pAkt activation is mediated by VEGF-C/VEGFR-2 Akt Ser473 was strongly phosphorylated in mLECs following a 10 minute stimulation with VEGF-C (Figs. 5A and B). By contrast, stimulation with VEGF-C156S did not phosphorylate Akt, demonstrating that the VEGFR-3 pathway is not involved in pAkt activation in mLECs. In contrast in mBVECs, VEGF-A165, VEGF-C and VEGF-D each induced Akt phosphorylation, with maximal effects observed at 10 min (Figs. 5C and D). Interestingly, in mLECs

neither VEGF-A165 nor VEGF-D induced Akt phosphorylation, despite these ligands weakly inducing phosphorylation in mBVECs.

VEGF-C activates JNK1 in mLECs and mBVECs A previous study has shown that activation of c-Jun N-terminal kinase (JNK1/2) was required for VEGFR-3-dependent survival in HUVECs [27]. In human sentinel LECs, JNK is phosphorylated via VEGFR-3 [28]. For the first time we show that JNK1 (46 kDa) is activated in mLECs (Figs. 6A and B) and mBVECs (Figs. 6C and D) by VEGF-C.

Discussion Herein we report a robust method for the isolation of murine LECs. Isolated murine LECs retain gene expression of lymphatic markers: podoplanin, PROX-1, LYVE-1 and VEGFR-3 for at least 4 passages.

2405

E XP E RI ME N T AL C E L L R E S EA RC H 31 7 ( 20 1 1) 2 3 9 7– 2 40 7

A.

B.

mLECs pJNK1 to Pan actin

mLECs -

0

10

30

60

120 (min) pJNK46 (46 kDa)

VEGF-C

pan-actin (42 kDa)

Integrated intensity normalised to SF

1.5

*** **

1.0

0.5

0.0 0

10

30

60

120

(min)

VEGF-C

C.

D.

mBVECs pJNK1 to Pan actin

VEGF-C

0

10

30

60

120 (min) pJNK46 (46 kDa) pan-actin (42 kDa)

Integrated intensity normalised to SF

1.5

mBVECs

**

***

10

30

1.0

0.5

0.0 0

60

120

(min)

VEGF-C

Fig. 6 – VEGF-C activates JNK1 in murine LECs (mLECs) and BVECs (mBVECs). Western blotting showed pJNK46 activation peaked at 30 min following stimulation with VEGF-C (100 ng/ml) in murine LECs (A) and BVECs (C). Control untreated LEC whole cell lysate from cells in growth media is indicated by (−). Integrated intensity of each sample was expressed as fold increase over serum-free treated control for each sample in LECs (B) and BVECs (D). P value calculated using one-way ANOVA, each column compared to time-point zero Columns: mean; bars: SEM; P < 0.01 (**); P < 0.001 (***). Western blots are representative of three separate experiments.

VEGFR-3 is an important lymphatic endothelial marker, which regulates the development of the fetal capillary system. In the adult, VEGFR-3 regulates the growth and maintenance of lymphatic vessels. Animals genetically deficient in VEGFR-3 are embryonically lethal because of lymphatic vascular defects resulting in abnormal interstitial fluid drainage and achylous ascites. In human disease, at least one form of primary (hereditary) lymphoedema can be attributed to a single VEGFR-3 amino acid substitution [28]. The defect in VEGFR-3 receptor kinase activity interferes with development of a normal lymphatic system and results in defective interstitial fluid collection. Studies in transgenic mice with skin-specific overexpression of a VEGFR-3-specific mutant of VEGF-C (VEGF-C156S) reveal that activation of VEGFR-3 signal transduction is sufficient to promote lymphangiogenesis [29]. It is well established that human LEC proliferation, maturation, and survival depends on VEGF-C and -D binding to VEGFR-3 [2,30]. The expression of VEGF-C and VEGF receptor-3 has also been found to be associated with regional lymph node metastasis in human prostate cancer [31,32]. VEGFR-3 is a highly glycosylated protein and migrates as bands with different molecular weights; 195 kDa (mature), 175 kDa (precursor), 140 kDa (non-glycosylated backbone), and a form that appears to be a partially proteolyzed 125 kDa band [12,33,34]. All of these protein forms of VEGFR-3 were detected in both murine LECs and BVECs by conventional Western blotting analysis, and the 195 kDa band by immunoprecipitation, contrary to studies reporting expression of only 195 kDa and 125 kDa protein forms in an immortalized murine LEC line derived from mesenteric adventitial tissue (SV-LEC) [18]. In addition to VEGFR-3, VEGFR-2 was detected in murine LECs. This receptor has been shown to be indispensible in lymphangio-

genesis in human LECs. The exact roles of these two receptors in lymphangiogenesis are still under investigation as complementary in vivo and in vitro studies demonstrated that signaling through receptors VEGFR-2 and VEGFR-3 concurrently is required for LEC migration [2] and proliferation [4,35,36]. Goldman et al. [26] has shown cooperative signaling of VEGFR-2 and VEGFR-3 is necessary for lymphatic migration and proliferation, but VEGFR-3 is redundant with VEGFR-2 for LEC organization into functional capillaries. Our data suggests that both of these receptors are involved in the migration of murine LECs, as stimulation with either VEGFR-2 or VEGFR-3 specific ligands induced migration. Furthermore, blocking VEGFR-2 activity in presence of VEGF-C stimulus reduced migration of murine LECs to baseline level. It would be interesting to observe if addition of an anti-VEGFR-3 neutralizing antibody would have synergistic effects in decreasing the migration of mLECs. MAPK activation was found to be regulated via both VEGFR-2 [26] and VEGFR-3 [4] receptors in human LECs. Consistent with this, VEGFR-2 and VEGFR-3 ligands induced Erk1/2 phosphorylation in mLECs. Blocking this pathway inhibits migration and subsequent lymphangiogenesis of human LECs [4,36] indicating that this pathway might be important in regulation of murine LEC migration. Indeed, Ichise et al. recently demonstrated a role for the Ras/MAPK pathway in migration of immortalized mLECs [37]. Murine VEGF-D only activates VEGFR-3, and not VEGFR-2 [38]. As VEGF-C, but not recombinant VEGF-D or VEGF-C156S increased Akt signaling in murine LECs, Akt signaling is regulated either via VEGFR-2 alone or heterodimerisation of VEGFR-2/VEGFR-3. In contrast, VEGFA165, VEGF-C and VEGF-D stimulated Erk1/2 demonstrating that this pathway is regulated by both VEGFR-2 and VEGFR-3. JNK1 has been shown to be important in VEGFR-3 mediated prosurvival signaling [35] and migration [39] of human LECs. It has

2406

E XP E RI ME N T AL C E L L R E SE A RC H 31 7 ( 20 1 1) 2 3 97 – 2 40 7

VEGF-C VEGF-D

VEGF-C

Authorship and conflict of interest statements VEGFR-3

VEGFR-2/3

P

Supplementary materials related to this article can be found online at doi:10.1016/j.yexcr.2011.07.023.

PI3K PIP2 PIP3

P MEK1/2

P ERK1/2

P

Contribution: SC designed and performed all experiments, analyzed the data, and drafted the manuscript; YZ contributed to interpretation of results; DS contributed to interpretation of results and manuscript preparation; and EDW contributed to design and interpretation of experiments and supervised the project and manuscript preparation. Conflict-of-interest disclosure: EDW received research support from Vegenics Ltd. The other authors declare no competing financial interests.

Acknowledgments This project was supported in part by funding from the Cancer Council Victoria (EDW) and the Victorian Government's Operational Infrastructure Support Program. EDW is supported by an Australian NHMRC Career Development Award (#519539). The authors thank Dr. Camden Lo (Monash Micro Imaging) for assistance with confocal microscopy imaging.

Akt

Tube formation ? Migration Proliferation Fig. 7 – Signaling pathways in murine LECs. VEGF-C stimulates VEGFR-2/VEGFR-3 to activate pAkt and pErk1/2. Stimulation with VEGF-D activates Erk1/2 pathway. The respective role of these molecules in LEC tube formation and migration remains to be further explored.

been reported that in human microvascular endothelial cells VEGF activates JNK1 and Erk2 to regulate angiogenesis [39]. Similarly, we observed that in murine LECs, Erk2 and JNK1 are both phosphorylated upon treatment with VEGF-C suggesting a role of these molecules in lymphangiogenesis. The respective roles of each of these intracellular signaling molecules in tube formation, migration, proliferation and survival need to be further investigated (Fig. 7). Our results indicate that murine LECs are governed by the same VEGF family signaling pathways as has been demonstrated in human LECs. Thus primary murine LECs will be a very useful tool to study LEC biology and lymphatic associated disorders.

Conclusions This study describes a protocol for the successful isolation of murine LECs and demonstrates that these cells are good models for human LECs. Thus, murine LECs derived from transgenic and knock-out murine models of lymphangiogenesis and mice showing disorders of the lymphatic system will be useful to identify genes associated with lymphangiogenesis, and to study how LEC phenotypes contribute to altered lymphatic vessel architecture or function, and immune or tumor cell–LEC interactions.

REFERENCES

[1] L.N. Cueni, M. Detmar, The lymphatic system in health and disease, Lymphat. Res. Biol. 6 (2008) 109–122. [2] Y. Zeng, K. Opeskin, J. Goad, E.D. Williams, Tumor-induced activation of lymphatic endothelial cells via vascular endothelial growth factor receptor-2 is critical for prostate cancer lymphatic metastasis, Cancer Res. 66 (2006) 9566–9575. [3] E. Kriehuber, S. Breiteneder-Geleff, M. Groeger, A. Soleiman, S.F. Schoppmann, G. Stingl, D. Kerjaschki, D. Maurer, Isolation and characterization of dermal lymphatic and blood endothelial cells reveal stable and functionally specialized cell lineages, J. Exp. Med. 194 (2001) 797–808. [4] T. Makinen, T. Veikkola, S. Mustjoki, T. Karpanen, B. Catimel, E.C. Nice, L. Wise, A. Mercer, H. Kowalski, D. Kerjaschki, S.A. Stacker, M.G. Achen, K. Alitalo, Isolated lymphatic endothelial cells transduce growth, survival and migratory signals via the VEGF-C/D receptor VEGFR-3, EMBO J. 20 (2001) 4762–4773. [5] V. Joukov, K. Pajusola, A. Kaipainen, D. Chilov, I. Lahtinen, E. Kukk, O. Saksela, N. Kalkkinen, K. Alitalo, A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases, EMBO J. 15 (1996) 1751. [6] S. Breiteneder-Geleff, A. Soleiman, H. Kowalski, R. Horvat, G. Amann, E. Kriehuber, K. Diem, W. Weninger, E. Tschachler, K. Aliatalo, D. Kerjaschki, Angiosarcomas express mixed endothelial phenotypes of blood and lymphatic capillaries: podoplanin as a specific marker for lymphatic endothelium, Am. J. Pathol. 154 (1999) 385–394. [7] J. Wigle, G. Oliver, Prox1 function is required for the development of the murine lymphatic system, Cell 98 (1999) 769–778. [8] S. Banerji, J. Ni, S.X. Wang, S. Casper, J. Su, R. Tammi, M. Jones, D.G. Jackson, LYVE-1, a new homoloque of the CD44 glycoprotein, is a lymph-specific receptor for hyaluron, J. Cell Biol. 144 (1999) 789–801. [9] E. Gordon, N.W. Gale, N.L. Harvey, Expression of the hyaluronan receptor LYVE-1 is not restricted to the lymphatic vasculature; LYVE-1 is also expressed on embryonic blood vessels, Dev. Dyn. 237 (2008) 1901–1909.

E XP E RI ME N T AL C E L L R E S EA RC H 31 7 ( 20 1 1) 2 3 9 7– 2 40 7

[10] H. Huang, C. Ho, P. Huang, S. Hsu, Co-expression of VEGF-C and its receptors, VEGFR-2 and VEGFR-3, in endothelial cells of lymphangiomas. Implication in autocrine or paracrine regulation of lymphangioma, Lab. Investig. 81 (2001) 1729–1734. [11] A. Kaipainen, J. Korhonen, T. Mustonen, V.W. van Hinsbergh, G.H. Fang, D. Dumont, M. Breitman, K. Alitalo, Expression of the fms-like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development, Proc. Natl Acad. Sci. USA 92 (1995) 3566–3570. [12] E. Kukk, A. Lymboussaki, S. Taira, A. Kaipainen, M. Jeltsch, V. Joukov, K. Alitalo, VEGF-C receptor binding and pattern of expression with VEGFR-3 suggests a role in lymphatic vascular development, Development 122 (1996) 3829–3837. [13] D. Sahni, A. Robson, G. Orchard, R. Szydlo, A.V. Evans, R. Russell-Jones, The use of LYVE-1 antibody for detecting lymphatic involvement in patients with malignant melanoma of known sentinel node status, J. Clin. Pathol. 58 (2005) 715–721. [14] R.C. Ji, Y. Eshita, S. Kato, Investigation of intratumoural and peritumoural lymphatics expressed by podoplanin and LYVE-1 in the hybridoma-induced tumours, Int. J. Exp. Pathol. 88 (2007) 257–270. [15] C.M. Carreira, LYVE-1 is not restricted to the lymph vessels: expression in normal liver blood sinusoids and down-regulation in human liver cancer and cirrhosis, Cancer Res. 61 (2001) 8079–8084. [16] M. Sironi, A. Conti, S. Bernasconi, A. Fra, F. Pasqualini, M. Nebuloni, E. Lauri, M. De Bortoli, A. Mantovani, E. Dejana, A. Vecchi, Generation and characterization of a mouse lymphatic endothelial cell line, Cell Tissue Res. 325 (2006) 91–100. [17] F. Zhou, Z. Chang, L. Zhang, Y.-K. Hong, B. Shen, B. Wang, F. Zhang, G. Lu, D. Tvorogov, K. Alitalo, B.A. Hemmings, Z. Yang, Y. He, Akt/ protein kinase B is required for lymphatic network formation, remodeling, and valve development, Am. J. Pathol. 177 (2010) 2124–2133. [18] T. Ando, P. Jordan, T. Joh, Y. Wang, M.H. Jennings, J. Houghton, J.S. Alexander, Isolation and characterization of a novel mouse lymphatic endothelial cell line: SV-LEC, Lymphat. Res. Biol. 3 (2005) 105–115. [19] T. Yamaguchi, T. Ichise, O. Iwata, A. Hori, T. Adachi, M. Nakamura, N. Yoshida, H. Ichise, Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse, FEBS J. 275 (2008) 1988–1998. [20] S. Clasper, D. Royston, D. Baban, Y. Cao, S. Ewers, S. Butz, D. Vestweber, D.G. Jackson, A novel gene expression profile in lymphatics associated with tumor growth and nodal metastasis, Cancer Res. 68 (2008) 7293–7303. [21] S. Hirakawa, Y.-K. Hong, N. Harvey, V. Schacht, K. Matsuda, T. Libermann, M. Detmar, Identification of vascular lineage-specific genes by transcriptional profiling of isolated blood vascular and lymphatic endothelial cells, Am. J. Pathol. 162 (2003) 575–586. [22] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2-[Delta][Delta]CT method, Methods 25 (2001) 402–408. [23] O. Soderberg, M. Gullberg, M. Jarvius, K. Ridderstrale, K.-J. Leuchowius, J. Jarvius, K. Wester, P. Hydbring, F. Bahram, L.-G. Larsson, U. Landegren, Direct observation of individual endogenous protein complexes in situ by proximity ligation, Nat. Meth. 3 (2006) 995–1000. [24] J. Kazenwadel, M.Z. Michael, N.L. Harvey, Prox1 expression is negatively regulated by miR-181 in endothelial cells, Blood 116 (2010) 2395–2401. [25] I. Nilsson, F. Bahram, X. Li, L. Gualandi, S. Koch, M. Jarvius, O. Soderberg, A. Anisimov, I. Kholova, B. Pytowski, M. Baldwin, S.

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

2407

Yla-Herttuala, K. Alitalo, J. Kreuger, L. Claesson-Welsh, VEGF receptor 2/-3 heterodimers detected in situ by proximity ligation on angiogenic sprouts, EMBO J. 29 (2010) 1377–1388. J. Goldman, J.M. Rutkowski, J.D. Shields, M.C. Pasquier, Y. Cui, H.G. Schmokel, S. Willey, D.J. Hicklin, B. Pytowski, M.A. Swartz, Cooperative and redundant roles of VEGFR-2 and VEGFR-3 signaling in adult lymphangiogenesis, FASEB J. 21 (2007) 1003–1012. M. Shibuya, Vascular endothelial growth factor receptor-2: its unique signaling and specific ligand, VEGF-E, Cancer Sci. 94 (2003) 751–756. M.J. Karkkainen, R.E. Ferrel, E.C. Lawrence, M.A. Kimak, K.L. Levinson, M.A. McTigue, K. Alitalo, D.N. Finegold, Missense mutations interfere with VEGFR-3 signalling in primary lymphoedema, Nat. Genet. 25 (2000) 153–159. T. Veikkola, L. Jussila, T. Makinen, T. Karpanen, M. Jeltsch, T.V. Petrova, H. Kubo, G. Thurston, D.M. McDonald, M.G. Achen, S.A. Stacker, K. Alitalo, Signalling via vascular endothelial growth factor receptor-3 is sufficient for lymphangiogenesis in transgenic mice, EMBO J. 20 (2001) 1223–1231. M.G. Achen, M. Jeltsch, E. Kukk, T. Makinen, A. Vitali, A.F. Wilks, K. Alitalo, S.A. Stacker, Vascular endothelial growth factor D (VEGF-D) is a ligand for the tyrosine kinases VEGF receptor 2 (Flk1) and VEGF receptor 3 (Flt4), Proc. Natl Acad. Sci. USA 95 (1998) 548–553. K. Jennbacken, C. Vallbo, W. Wang, J.E. Damber, Expression of vascular endothelial growth factor C (VEGF-C) and VEGF receptor-3 in human prostate cancer is associated with regional lymph node metastasis, Prostate 65 (2005) 110–116. Y. Zeng, K. Opeskin, M.E. Baldwin, L.G. Horvath, M.G. Achen, S.A. Stacker, R.L. Sutherland, E.D. Williams, Expression of vascular endothelial growth factor receptor-3 by lymphatic endothelial cells is associated with lymph node metastasis in prostate cancer, Clin. Cancer Res. 10 (2004) 5137–5144. K. Hamada, Y. Oike, N. Takakura, Y. Ito, L. Jussila, D.J. Dumont, K. Alitalo, T. Suda, VEGF-C signaling pathways through VEGFR-2 and VEGFR-3 in vasculoangiogenesis and hematopoiesis, Blood 96 (2000) 3793–3800. H. Kubo, T. Fujiwara, L. Jussila, H. Hashi, M. Ogawa, K. Shimizu, M. Awane, Y. Sakai, A. Takabayashi, K. Alitalo, Y. Yamaoka, S.I. Nishikawa, Involvement of vascular endothelial growth factor receptor-3 in maintenance of integrity of endothelial cell lining during tumor angiogenesis, Blood 96 (2000) 546–553. A. Salameh, F. Galvagni, M. Bardelli, F. Bussolino, S. Oliviero, Direct recruitment of CRK and GRB2 to VEGFR-3 induces proliferation, migration, and survival of endothelial cells through the activation of ERK, AKT, and JNK pathways, Blood 106 (2005) 3423–3431. A. Yilmaz, S. Kliche, U. Mayr-Beyrle, G. Fellbrich, J. Waltenberger, p38 MAPK inhibition is critically involved in VEGFR-2-mediated endothelial cell survival, Biochem. Biophys. Res. Commun. 306 (2003) 730–736. T. Ichise, N. Yoshida, H. Ichise, H-, N- and Kras cooperatively regulate lymphatic vessel growth by modulating VEGFR3 expression in lymphatic endothelial cells in mice, Development 137 (2010) 1003–1013. M.E. Baldwin, S. Roufail, M.M. Halford, K. Alitalo, S.A. Stacker, M.G. Achen, Multiple forms of mouse vascular endothelial growth factor-D are generated by RNA splicing and proteolysis, J. Biol. Chem. 276 (2001) 44307–44314. C. Uchida, E. Gee, E. Ispanovic, T.L. Haas, JNK as a positive regulator of angiogenic potential in endothelial cells, Cell Biol. Int. 32 (2008) 769–776.