ST-11 clonal complex

Microbes and Infection 8 (2006) 191–196 www.elsevier.com/locate/micinf

Original article

Conserved virulence of C to B capsule switched Neisseria meningitidis clinical isolates belonging to ET-37/ST-11 clonal complex Marcelo Lancellotti, Annie Guiyoule, Corinne Ruckly, Eva Hong, Jean-Michel Alonso *, Muhamed-Kheir Taha Neisseria Unit, National Reference Center for the Meningococci, Institut Pasteur, 25-28, rue du Dr Roux, 75724 Paris cedex 15, France Received 21 March 2005; received in revised form 14 June 2005; accepted 15 June 2005 Available online 15 August 2005

Abstract Capsule switching in Neisseria meningitidis is thought to occur by horizontal DNA exchange between meningococcal strains. Antigenic variants may be generated by allelic replacement of the siaD gene; the variants may then be selected by specific immunity against the capsular antigen. There were several vaccination campaigns against serogroup C in France in 2002, following an increase in the prevalence of invasive isolates of serogroup C of the phenotype C:2a:P1.5 and C:2a:P1.5,2 belonging to the ET-37/ST-11 clonal complex. We evaluated the emergence of capsule variants by the detection of B:2a:P1.5 and B:2a:P1.5,2 meningococcal isolates of the ET-37/ST-11 clonal complex. These isolates were significantly more frequent after the year 2002. Pulsed field gel electrophoresis profiles of the serogroup B (ET-37/ST-11) isolates differed from that of serogroup C (ET-37/ST-11) isolates by the bands that harbor the siaD genes responsible for the serogroup specificity. However, serogroup B and C, ET37/ST-11 isolates both express similar virulence as assessed from colonization and invasiveness in a mouse model. Our results indicate that capsule switching events within the same clonal complex can arise frequently with no alteration in virulence. This justifies an enhanced system of surveillance by molecular typing of such isolates, particularly after serogroup-specific vaccination. © 2005 Elsevier SAS. All rights reserved. Keywords: Neisseria meningitides; Capsule; Vaccination; Typing; Virulence

1. Introduction Neisseria meningitidis causes septicemia and meningitis. The risks of epidemics of meningococcal infection warrant preventive measures including chemoprophylaxis and vaccination. Vaccines, based on the capsular polysaccharides that define serogroups, are only available against strains of serogroups A, C, Y and W135 but not against serogroup B. A conjugate vaccine against serogroup C was recently introduced in several countries [1–3]. However, the use of monovalent conjugate vaccines with enhanced immunogenicity but narrow specificity has raised concern about a possible increase in meningococcal diseases due to other serogroups not cov-

Abbreviations: ET, electrotype; MLDF, multilocus DNA fingerprinting; MLST, multilocus sequence typing; ST, sequence type. * Corresponding author. Tel.: +33 1 45 68 83 30; fax: +33 1 40 61 30 34. E-mail address: [email protected] (J.-M. Alonso). 1286-4579/$ - see front matter © 2005 Elsevier SAS. All rights reserved. doi:10.1016/j.micinf.2005.06.012

ered by the vaccines [4]. Epidemics are mainly due to the expansion of particular genotypes of N. meningitidis belonging to a small number of defined clonal complexes and expressing the capsular serogroups A, B, C, Y or W135 [5]. Strains belonging to the ET-37/ST-11 clonal complex, mainly of serogroups C, B and W135 have been involved in several outbreaks [6–10]. However, N. meningitidis is highly variable due to frequent horizontal DNA exchange between strains, and new variants are continually generated. Capsule switching (i.e. the ability of a strain to express another antigenic type of the capsule) is the result of allelic replacement of the siaD gene through transformation and recombination. siaD is responsible for the polymerization of sialic acid units in the capsule and thereby determines the immune specificity of serogroups B, C, Y and W135 strains [11]. As a consequence, new capsular variants can escape the immunity of the exposed hosts. Bacterial population replacement can also occur. This is where a genetically distinct population expressing a different serogroup replaces the original population

192

M. Lancellotti et al. / Microbes and Infection 8 (2006) 191–196

[12,13]. Capsule switching in N. meningitidis serogroup C to B has been reported in outbreaks in several countries [6,8,9] and recently in Spain after vaccination campaigns using conjugate vaccine against N. meningitidis serogroup C [7]. Capsule switching may occur rapidly within the contact of an index case and provoke a secondary case [14]. The meningococcal capsule is a major virulence factor. However, the effects of capsule switching on meningococcal virulence have not been studied. Characterization of meningococcal isolates upon vaccination campaigns is crucial to detect the emergence and the expansion of escape variants. The proportion of cases due to serogroup C isolates showed periodic fluctuations in France. The incidence was high during the period 1991–1993, and again since 2000 when it peaked at 38% of culture-confirmed cases in 2002. This increase mostly involved isolates of the phenotypes C:2a:P1.5 and C:2a P1.5,2, both belonging to the ET-37/ST-11 clonal complex [15]. There have been two outbreaks that led to mass vaccination campaigns against serogroup C for populations aged 2 months to 20 years. The first outbreak was between March 2001 and January 2002 in the Département (French territorial area, or county) of Puy de Dôme in the center of France. Of 13 confirmed cases, 11 were identified as serogroup C, the two other cases being PCRpositive for N. meningitidis but of undetermined genogroup. This gave a local incidence of 1.7/100,000 inhabitants, compared to the national incidence of 0.3/100,000 for serogroup C during the same period. Five of the serogroup C isolates clustered in the ET-37/S-T11 clonal complex [16]. The second outbreak lasted from January to August 2002 in three departments of the southwest of France [17], where 25 of the 30 cases were due to serogroup C isolates (local incidence 2.2/100,000 compared to the national incidence of 0.26/100,000), the five others being of serogroup B with diverse phenotypes. From the 25 serogroup C cases, 17 isolates were obtained (the eight other culture-negative cases being diagnosed by PCR), of which 15 belong to the ET37/ST-11 clonal complex. To evaluate the impact of mass anti-serogroup C vaccination on the risk of the emergence of escape variants within the ET-37/ST-11 clonal complex, we analyzed the genotypes and virulence properties of B:2a:P1.5 and B:2a:P1.5,2 meningococcal isolates, and compared these properties between the pre- and post vaccination periods in France.

2.2. Molecular typing of meningococcal isolates Genogrouping was performed by using PCR-based prediction of serogroup, as previously described [20]. Meningococcal isolates were characterized by three molecular typing techniques: multilocus DNA fingerprinting (MLDF) that is a rapid PCR-restriction fragment length polymorphism technique for the characterization of five virulence-associated genes (pilA, pilD, crgA, regF, and iga), multilocus sequence typing (MLST) and standard pulsed field gel electrophoresis (PFGE) using the restriction enzyme SpeI [21,22]. Southern blot analysis protocols were from Sambrook et al. [23]. The porA gene was amplified using two oligonucleotides with adaptors corresponding to universal forward and reverse oligonucleotides that were added to the 5′ end of upstream and downstream oligonucleotides, respectively. After amplification, universal forward and reverse oligonucleotides were used for sequencing. Oligonucleotides used for MLST and genogrouping were described previously [20]. Other oligonucleotides used in this study are listed in Table 1. 2.3. Comparatively testing virulence in mice The virulence properties of a C:2a:P1.5,2 outbreak isolate (LNP19008) and of a B:2a:P1.5 post outbreak isolate (LNP20342) were tested comparatively in the mouse model we recently developed: sequential influenza A virus (IAV)-N. meningitidis infection in BALB/c mice [24]. Briefly, 5-weekold female BALB/c mice (Janvier, France) were kept in a biosafety containment facility, in cages with sterile litter, water and food, according to institutional guidelines. They were challenged at the age of 6 weeks. The experimental design was approved by the Institut Pasteur Review Board. Mice were slightly anesthetized with sodium pentobarbital (Sanofi, Santé Animale, Libourne, France) and IAV mild infection was induced by intranasal administration of 250 plaque-forming units of IAV suspended in 50 µl. Seven days later, the mice were infected by intranasal challenge with standardized N. meningitidis bacterial suspensions of 108 CFU of each isolate. CFU counts on GCB medium were performed with samples of blood and lungs from these mice, for time point (3, 24 and 48 h after challenge). 2.4. Statistical analysis

2. Materials and methods

Data were analyzed using the chi-square test. A P value of < 0.05 was considered statistically significant.

2.1. Bacterial isolates and media All invasive meningococcal isolates in France (meningitis, septicemia and other invasive forms) should be sent to the National Reference Laboratory for Meningococci for full determination and typing. Bacteria were grown at 37 °C in a 5% CO2 atmosphere on GCB medium with Kellogg supplements [18]. The phenotype (serogroup:serotype:serosubtype) was determined by standard methods [19].

3. Results 3.1. Characterization of meningococcal isolates To identify possible C to B capsule switching, we selected all the invasive isolates of the phenotypes B:2a:P1.5 or B:2a:P1.5,2 obtained since 1999. A total of 11 such invasive

M. Lancellotti et al. / Microbes and Infection 8 (2006) 191–196

193

Table 1 Oligonucleotides used in this study Oligonucleotide 98-19 98-20 Cps-1 Cps-2 A412 B127 pilD3 pilD4 98-4 98-11 iga-1 iga-4 regF-1 regF-2 porA0Fa porA100Ra

Sequence 5′–3′ GGATCATTTCAGTGTTTTCCACCA GCATGCTGGAGGAATAAGCATTAA CCGCATGGATCGCCCAGGTCCGG GAATTCACTCAGACCCAGTACTTC CAATCCAGCAGTCGGTCCACA GTTGTCGGTAACGACGGGCAG TGCCGCACAGATCCGGCGCGGAT TCTCACCGGATGGGTCAGCCA GCTTCAGCCGTGCGGCGGAGCAGTTGGCGATGG AGAATTATCCACGAGAGATTGTTTCCC GCAGGTAACGTAACCGGTATAGTCCGAGCGCACGCA ATCCGAATGGCGACAGATTGGCAAAATCGG ATGATGACCCTCTATTCCGGCATTACC GCGCATGGCTTTTTCGGCGGGTGTC GttttcccagtcacgacgttgtaGATGTCAGCCTATACGGCGAAATCAAAG TtgtgagcggataacaatttcGAATTTGTGGCGCAAACCGACGGAGGC

Corresponding gene/position/accession number siaD/4206-4229/M95053 siaD/3775-3798/M95053 siaC/2714-2736/ M95053 siaD/4885-4908/M95053 pilA/1591-1611/ X13965 pilB/601-621/ X13966 pilD /3754-3776/U32588 pilD/2848-2868/U32588 crgA/234-266/AF190471 crgA/1057-1082/AF190471 iga/2429-2464/ X04835 iga/1380-1410/ X04835 regF/211-237/X99693 regF/786-810/X99693 porA/58-85/ AF226344 porA/1150-1176/ AF226344

a

Universal forward and reverse oligonucleotides were added as adaptors in front of each oligonucleotide (in lower case italics). Universal forward and reverse oligonucleotides were used for sequencing.

isolates (all were from cases of meningitis and/or septicaemia) were sent to our National Reference Laboratory during this period (Table 2). Four isolates were from the period 1999 to 2002 and seven isolates from the period 2003 to 2004. However, the difference between the numbers of these isolates in the two periods as a proportion of all invasive B isolates was not significant (P < 0.1). porA sequencing indicated that B:2a isolates and C:2a isolates contained sequences of the family 5 of VR1 (mostly 5 and 5-1) and the sequence 2 of the family 2 or the sequence 10-8 of the VR2 (Table 2). We genotyped the 11 serogroup B isolates by both MLDF and MLST. Seven isolates (one for the period 1999–2002 and six for the period 2003–2004) belonged to ST-11 of the ET-37/ST-11 clonal complex. The increase during the period 2003–2004 was significant (P < 0.01). One invasive isolate was isolated in January 2003 from the CSF of a 2-year-old boy in a Département that was involved in the vaccination campaigns in 2002; the other isolates were from other Départements not involved in the vaccination campaigns. We studied the seven serogroup B isolates by PFGE analysis with SpeI digestion. There is a SpeI site in the siaD gene in strains of serogroup B [25], but not in that of serogroup C strains. The PFGE profiles of serogroup B isolates were com-

pared to those of two C:2a:P1.5 ST-11 isolates from a Département involved in the vaccination campaigns. PFGE patterns suggested that the serogroup B isolates were related to the serogroup C isolates, although a few bands differed (Fig. 1A). We tested whether these differences were due to the presence of a serogroup-specific allele of siaD. Southern blot analyses were performed using a probe for the siaCsiaD genes (oligonucleotides Cps1/Cps2). This probe recognizes all siaD alleles of sialic acid-containing capsules regardless of the serogroup [26]. As expected, the probe hybridized with DNA fragments from all the isolates: one fragment of 240 kb in the serogroup C isolates; two fragments of 95 and 145 kb or 90 and 150 kb in the seven serogroup B isolates consistent with the presence of a SpeI site within the siaD gene (serogroup B) (Fig. 1B). This result was confirmed using a probe specific for the serogroup B allele of the siaD gene (oligonucleotides 98-19/98-20). It only hybridized with DNA from the serogroup B isolates. However, two different fragments, one of 145 kb (isolates LNP18608, LNP 20342, LNP21652 and LNP21662) and one of 90 kb (isolates LNP20418, LNP21479 and LNP21996) were revealed by the probe. To elucidate the organization of the siaD gene on the chromosome, we used a probe for the pilA gene that is on in

Table 2 Characteristics of meningococcal isolates in this study Isolate LNP18608 LNP19008 LNP19590 LNP19865 LNP20342 LNP20418 LNP21479 LNP21652 LNP21662 LNP21996

ST 11 11 11 11 11 11 11 11 11 11

Year 2001 2001 2002 2002 2003 2003 2004 2004 2004 2004

Age 71y 17y 9y 17y 2y 16y 4m 8y 33y 3y

Sex F F M F M F F F F M

Disease meningitis and septicemia septicemia meningitis meningitis meningitis septicemia meningitis septicemia meningitis and septicemia septicemia

Site CSF blood CSF CSF CSF blood CSF blood CSF blood

Serogroup B C C C B B B B B B

Serotype 2a 2a 2a 2a 2a 2a 2a 2a 2a 2a

Serosubtype P1.5 P1.5,2 P1.5 P1.5 P1.5 P1.5 P1.5 P1.5,2 P1.5 P1.5

PorA-VR1 5-1 5 5-1 5-1 5-1 5-1 5 5 5-1 5-1

PorA-VR2 10-8 2 10-8 10-8 10-8 10-8 2 2 10-8 10-8

194

M. Lancellotti et al. / Microbes and Infection 8 (2006) 191–196

Fig. 1. In A, PFGE profiles generated by cleavage of chromosomal DNA by SpeI observed for nine isolates. Size markers in kb (from Biorad) are shown on the left. The isolates tested are: 1 (LNP18608), 2 (LNP19590), 3 (LNP19865), 4 (LNP20342), 5 (LNP20418), 6 (LNP21479), 7 (LNP21652), 8 (LNP21662) and 9 (LNP21996). The DNA was transferred onto a N hybond membrane (Amersham) and hybridized with the probes indicated in B above each panel. C, A schematic representation of the SpeI fragment harboring the siaD gene (thick arrow) and pilA gene (hatched box). The organization of this fragment in the nine studied isolates is shown. The black bars represent the probes used: the siaC-siaD probe (a) that hybridizes with the sia locus regardless of the capsule (cps) specificity, the siaD serogroup B-specific probe (b) and the pilA probe (c).

the same 240 kb SpeI fragment as siaD in isolates of serogroup C (Fig. 1). The pilA probe also hybridized to one fragment of 240 kb in the serogroup C isolates (Fig. 1B). However, for the serogroup B isolates, two fragments, one of 95 kb (isolates LNP18608, LNP 20342, LNP21652 and LNP21662) and the other of 90 kb (isolates LNP20418, LNP21479 and LNP21996), were observed (Fig. 1B). Thus, the serogroup B and C isolates studied are closely related. Differences in PFGE profiles were due to the presence of a SpeI site in the serogroup B-specific allele of siaD gene in serogroup B isolates. Our data also suggest that serogroup B isolates classified into two categories according to the orientation of sia operon with respect to the pilA gene as indicated in Fig. 1B.

lent load for 48 h in the two groups of mice. Equivalent lethality was observed after 48 h (3/3 in each group). Similar results were also obtained using other C:2a:P1.5 isolates (data not shown).

3.2. Comparative virulence of C and B isolates To evaluate the effects of capsule switching on virulence, we comparatively tested serogroup C (LNP19008) and serogroup B (LNP20342) isolates (Table 2) in the adult BALB/c mouse model of sequential IAV-meningococcal invasive respiratory infection [24]. The bacterial loads in the lungs and in the blood were scored at 3, 24 and 48 h after meningococcal challenge, in groups of three mice per time point, in two independent experiments. As shown in Fig. 2, bacterial inocula, ranging from 6.5 to 8 × 107 CFU per mouse, effectively colonized the lungs of mice of both groups, at equivalent levels. Bacteremia was detected from 3 h and remained at equiva-

Fig. 2. Comparative virulence for mice of serogroup B (LNP20342) and C (LNP19008) isolates of the ET-37/ST-11 clonal complex. Results are the geometric mean ± S.E.M. (bars) of CFU counts in lungs and blood from three mice per time point.

M. Lancellotti et al. / Microbes and Infection 8 (2006) 191–196

4. Discussion N. meningitidis is a commensal bacterium of the human nasopharynx. It is genetically variable due to frequent horizontal DNA exchange between strains. One major aspect of this variability is the capsule switching [6]. This phenomenon is the mechanism by which the bacterium is able to escape an immune response against a particular serogroup. Twelve serogroups [27,28] are described, but vaccines are only available against serogroups A, C, Y and W135. The recent introduction of a monovalent C conjugate vaccine raises the question of the risk of the emergence and expansion of escape variants of other serogroups. Strains of the phenotype C:2a:P1.5,2 (or related phenotypes) belonging to the ET37/ST-11 clonal complex are most frequently involved in outbreaks that justify large vaccination campaigns [29,30]. Identification of meningococcal isolates of the phenotypes B:2a:P1.5.2, B:2a:P1.5 or B:2a:P1.2 is a first approach to detect possible capsule switching from C to B within this clonal complex. Genotyping can then determine the relatedness of these serogroup B strains to serogroup C ET-37/ST11 strains. In France, such invasive B isolates were rarely isolated before 2003 and most differ substantially from those of the ET-37/ST-11 clonal complex (our unpublished data). There was a vaccination campaign against serogroup C in 2001–2002 in several Départements in France where the incidence of this serogroup had increased [16,17]. Almost all B:2a:P1.5 strains isolated in France in 2003–2004 belonged to the ET-37/ST-11 clonal complex. PFGE indicated that these isolates are closely related to the serogroup C isolates of the ET-37/ST-11 clonal complex. The differences in their macrorestriction profiles are most likely due to the replacement of the siaD locus as the SpeI site seems to be conserved in the siaD of serogroup B isolates and absent from the siaD of serogroup C isolates. Alternatively, other C isolates of the ET-37/ST-11 clonal complex might be the ancestor for B: 2a isolates. These isolates may have been generated through DNA transformation of a serogroup C (ET-37/ST-11) and the replacement of the siaD locus (capsule switching). However, the different orientation of the siaD gene (and the sia operon) in the serogroup B isolates suggests that they were generated by two independent transformation and recombination events. Accordingly, no epidemiological (historical) link between the cases corresponding to the two types of isolates has been established. The fact that the serogroup B isolates harbored two variants of VR1 (variant 5 and 5-1) and two distinct VR2 (2 and 10-8) is also in accord with this hypothesis. Alternatively, the reversion of the orientation of the siaD-harboring fragment may have happened by transformation within the same isolate after the acquisition of this fragment. We used our mouse model of dual IAV-N. meningitidis infection to compare the virulence of the serogroup C and serogroup B isolates. This model has been used to demonstrate the role of some major bacterial virulence factors involved in the synthesis of the capsule and or the pili [24]: a capsule-defective mutant was cleared from the lungs, whereas

195

a mutant inactivated for the gene crgA, regulating negatively the pili and the capsule, upon contact with the host cells, retained invasiveness [24]. Therefore, this model of meningococcal disease in adult mice reproduces the pathogenesis of human meningococcemia with fatal sepsis, and is useful for analyzing known genes and genes identified by genomic studies. There was no difference in the virulence for mice of the B and C isolates tested. This suggests that virulence is not determined by the nature of the capsule (serogroup) but rather by the genotype of the isolate. Indeed, the fatality rates of meningococcal disease cases due to C:2a and B:2a strains are indistinguishable [31]. No clonal expansion has been observed for strains of serogroup B (ET-37/ST-11). The low number of cases did not enable us to explore any direct geographical link with vaccination campaigns. However, the independent and rapid emergence of the two types of isolates in France as well as similar observations by others [7,14] warrant the establishment of a wide system of surveillance based on accurate typing of such genotypes to score their expansion, particularly after vaccination campaigns or vaccination strategies.

Acknowledgments We thank Magaly Ducos-Galand and Dario Giorgini for their help with MLST analysis. This Work was supported by the Institut Pasteur. M.L. is supported by a fellowship from CAPES, BEX1407/01-5.

References [1]

[2]

[3]

[4] [5] [6]

[7]

[8]

[9]

A.M. van Furth, H.L. Zaaijer, Meningococcal disease in the Netherlands: media hype, but not an epidemic, Ned. Tijdschr. Geneeskd. 145 (2001) 1716–1718. C.L. Trotter, M.E. Ramsay, E.B. Kaczmarski, Meningococcal serogroup C conjugate vaccination in England and Wales: coverage and initial impact of the campaign, Commun. Dis. Public Health 5 (2002) 220–225. L. Salleras, A. Dominguez, N. Cardenosa, Dramatic decline of serogroup C meningococcal disease in Catalonia (Spain) after a mass vaccination campaign with meningococcal C conjugated vaccine, Vaccine 21 (2003) 729–733. M. Lipsitch, Vaccination against colonizing bacteria with multiple serotypes, Proc. Natl. Acad. Sci. USA 94 (1997) 6571–6576. D.A. Caugant, Population genetics and molecular epidemiology of Neisseria meningitidis, APMIS 106 (1998) 505–525. J.S. Swartley, A.A. Marfin, S. Edupuganti, L.J. Liu, P. Cieslak, B. Perkins, J.D. Wenger, D.S. Stephens, Capsule switching of Neisseria meningitidis, Proc. Natl. Acad. Sci. USA 94 (1997) 271–276. E. Perez-Trallero, D. Vicente, M. Montes, R. Cisterna, Positive effect of meningococcal C vaccination on serogroup replacement in Neisseria meningitidis, Lancet 360 (2002) 953. P. Kriz, D. Giorgini, M. Musilek, M. Larribe, M.K. Taha, Microevolution through DNA exchange among strains of Neisseria meningitidis isolated during an outbreak in the Czech Republic, Res. Microbiol. 150 (1999) 273–280. D.A. Kertesz, M.B. Coulthart, J.A. Ryan, W.M. Johnson, F.E. Ashton, B. Serogroup, electrophoretic type 15 Neisseria meningitidis in Canada, J. Infect. Dis. 177 (1998) 1754–1757.

196

M. Lancellotti et al. / Microbes and Infection 8 (2006) 191–196

[10] M.K. Taha, M. Achtman, J.M. Alonso, B. Greenwood, M. Ramsay, A. Fox, S. Gray, E. Kaczmarski, Serogroup W135 meningococcal disease in Hajj pilgrims, Lancet 356 (2000) 2159. [11] H. Claus, U. Vogel, M. Muhlenhoff, R. Gerardy-Schahn, M. Frosch, Molecular divergence of the sia locus in different serogroups of Neisseria meningitidis expressing polysialic acid capsules, Mol. Gen. Genet. 257 (1997) 28–34. [12] J. Nikoskelainen, A. Leino, E. Lahtonen, J.L. Kalliomaki, A. Toivanen, Is group-specific meningococcal vaccination resulting in epidemics caused by groups of virulent meningococci? Lancet 2 (1978) 403–405. [13] L.I. Shlush, D.M. Behar, A. Zelazny, N. Keller, J.R. Lupski, A.L. Beaudet, D. Bercovich, Molecular epidemiological analysis of the changing nature of a meningococcal outbreak following a vaccination campaign, J. Clin. Microbiol. 40 (2002) 3565–3571. [14] U. Vogel, H. Claus, M. Frosch, Rapid serogroup switching in Neisseria meningitidis, N. Engl. J. Med. 342 (2000) 219–220. [15] A. Antignac, M. Ducos-Galand, A. Guiyoule, R. Pires, J.M. Alonso, M.K. Taha, Neisseria meningitidis strains isolated from invasive infections in France (1999–2002): phenotypes and antibiotic susceptibility patterns, Clin. Infect. Dis. 37 (2003) 912–920. [16] D. Levy-Bruhl, A. Perrocheau, M. Mora, M.K. Taha, S. DromellChabrier, J. Beytout, I. Quatresous, Vaccination campaign following an increase in incidence of serogroup C meningococcal diseases in the department of Puy-de-Dome (France), Euro Surveill. 7 (2002) 74–76. [17] I. Bonmarin, D. Levy-Bruhl, Group C meningococcus vaccination in the southwest region of France, Eurosurveillance Weekly 6 (2002) 5–7. [18] D.S. Kellogg Jr., W.L. Peacock Jr., W.E. Deacon, L. Brown, D.I. Pirkle, Neisseria gonorrhoeae. I. Virulence genetically linked to clonal variation, J. Bacteriol. 85 (1963) 1274–1279. [19] J.T. Poolman, H. Abdillahi, Outer membrane protein serosubtyping of Neisseria meningitidis, Eur. J. Clin. Microbiol. Infect. Dis. 7 (1988) 291–292. [20] M.K. Taha, Simultaneous approach for nonculture pcr-based identification and serogroup prediction of Neisseria meningitidis, J. Clin. Microbiol. 38 (2000) 855–857. [21] M.K. Taha, D. Giorgini, M. Ducos-Galand, J.M. Alonso, Continuing diversification of Neisseria meningitidis W135 as a primary cause of meningococcal disease after its emergence in 2000, J. Clin. Microbiol. 42 (2004) 4158–4163.

[22] M.C. Maiden, J.A. Bygraves, E. Feil, G. Morelli, J.E. Russell, R. Urwin, Q. Zhang, J. Zhou, K. Zurth, D.A. Caugant, I.M. Feavers, M. Achtman, B.G. Spratt, Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms, Proc. Natl. Acad. Sci. USA 95 (1998) 3140– 3145. [23] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [24] J.M. Alonso, A. Guiyoule, M.L. Zarantonelli, F. Ramisse, R. Pires, A. Antignac, A.E. Deghmane, M. Huerre, S. van der Werf, M.K. Taha, A model of meningococcal bacteremia after respiratory superinfection in influenza A virus-infected mice, FEMS Microbiol. Lett. 222 (2003) 99–106. [25] H. Tettelin, N.J. Saunders, J. Heidelberg, A.C. Jeffries, K.E. Nelson, J.A. Eisen, K.A. Ketchum, D.W. Hood, J.F. Peden, R.J. Dodson, W.C. Nelson, M.L. Gwinn, R. DeBoy, J.D. Peterson, E.K. Hickey, D.H. Haft, S.L. Salzberg, O. White, R.D. Fleischmann, B.A. Dougherty, T. Mason, A. Ciecko, D.S. Parksey, E. Blair, H. Cittone, E.B. Clark, M.D. Cotton, T.R. Utterback, H. Khouri, H. Qin, et al., Complete genome sequence of Neisseria meningitidis serogroup B strain MC58, Science 287 (2000) 1809–1815. [26] M. Frosch, C. Weisgerber, T.F. Meyer, Molecular characterization and expression in Escherichia coli of the gene complex encoding the polysaccharide capsule of Neisseria meningitidis group B, Proc. Natl. Acad. Sci. USA 86 (1989) 1669–1673. [27] T.Y. Liu, E.C. Gotschlich, F.T. Dunne, E.K. Jonssen, Studies on the meningococcal polysaccharides. II. Composition and chemical properties of the group B and group C polysaccharide, J. Biol. Chem. 246 (1971) 4703–4712. [28] T.Y. Liu, E.C. Gotschlich, E.K. Jonssen, J.R. Wysocki, Studies on the meningococcal polysaccharides. I. Composition and chemical properties of the group A polysaccharide, J. Biol. Chem. 246 (1971) 2849–2858. [29] K.L. Davison, M.E. Ramsay, N.S. Crowcroft, A. Lieftucht, E.B. Kaczmarski, C.L. Trotter, U. Gungabissoon, N.T. Begg, Estimating the burden of serogroup C meningococcal disease in England and Wales, Commun. Dis. Public Health 5 (2002) 213–219. [30] P. Krizova, M. Musilek, Changing epidemiology of meningococcal invasive disease in the Czech Republic caused by new clone Neisseria meningitidis C:2a:P1.2(P1.5), ET-15/37, Cent. Eur. J. Public Health 3 (1995) 189–194. [31] C.L. Trotter, A.J. Fox, M.E. Ramsay, F. Sadler, S.J. Gray, R. Mallard, E.B. Kaczmarski, Fatal outcome from meningococcal disease—an association with meningococcal phenotype but not with reduced susceptibility to benzylpenicillin, J. Med. Microbiol. 51 (2002) 855–860.