Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers

+ Models

MYCMED-665; No. of Pages 8 Journal de Mycologie Médicale (2017) xxx, xxx—xxx

Available online at

ScienceDirect www.sciencedirect.com

ORIGINAL ARTICLE/ARTICLE ORIGINAL

Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers ´ valence conse ´ cutive d’Exophiala dermatitidis, un Une forte pre opportuniste neurotrope, sur les traverses de chemin de fer S.A. Yazdanparast a, S. Mohseni b, G.S. De Hoog c, N. Aslani d, A. Sadeh d, H. Badali e,f,* a

Department of Medical Parasitology and Mycology, School of Allied Medicine, Iran University of Medical Sciences, Tehran, Iran b Department of Microbiology, Sari Branch, Islamic Azad University, Sari, Iran c CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands d Student Research Committee, Mazandaran University of Medical Sciences, Sari, Iran e Invasive Fungi Research Centre (IFRC), School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran f Department of Medical Mycology and Parasitology, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran Received 25 July 2016; received in revised form 30 November 2016; accepted 11 January 2017

KEYWORDS Black yeast and relatives; Monoaromatic compounds; Exophiala species; Railway sleepers

Summary Environmental isolation of black yeasts potentially causing human disorders is essential for understanding ecology and routes of infection. Several Exophiala species show prevalence for man-made environments rich in monoaromatic compounds, such as creosotetreated or petroleum-stained railway sleepers. Ambient climatic conditions play a role in species composition in suitable habitats. Therefore, the aim of the present study was to establish the composition of Exophiala species in railway stations as a potential source of human infections in a subtropical region with evaluation of their antifungal susceptibility profiles. We examined 150 railway samples using cotton swabs moistened with sterile physiological saline. Black yeasts and relatives were selected on theirs colony morphology and identified based on ITS rDNA sequencing. Overall, 36 (24%) of samples were positive for black yeast-like fungi, i.e., Exophiala dermatitidis (n = 20, 55.6%) was predominant, followed by E. phaeomuriformis (n = 9, 25%),

* Corresponding author at: Invasive Fungi Research Center (IFRC), School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran. E-mail address: [email protected] (H. Badali). http://dx.doi.org/10.1016/j.mycmed.2017.01.007 1156-5233/# 2017 Elsevier Masson SAS. All rights reserved.

Please cite this article in press as: Yazdanparast SA, et al. Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers. Journal De Mycologie Médicale (2017), http://dx.doi.org/10.1016/j.mycmed.2017.01.007

+ Models

MYCMED-665; No. of Pages 8

2

S.A. Yazdanparast et al. E. heteromorpha (n = 5, 13.9%), and E. xenobiotica (n = 2, 5.6%). Massive contaminations of E. dermatitidis were seen on railway sleepers on creosoted oak wood at the region close to the sea level, while in cold climates were primarily contaminated with clinically insignificant or rare human opportunists (E. crusticola). It seems that, high temperature and humidity are significant effect on species diversity. Moreover, the MIC results for all E. dermatitidis and E. phaeomuriformis strains revealed the widest range and the highest MICs to caspofungin (range 1—16 mg/L, Geometric mean 4.912 mg/L), and the lowest MIC for posaconazole (0.016— 0.031 mg/L, G mean 0.061 mg/L). However, their clinical effectiveness in the treatment of Exophiala infections remains to be determined. # 2017 Elsevier Masson SAS. All rights reserved.

MOTS CLÉS Levure noire et apparentés ; Composés monoaromatiques ; Espèces d’Exophiala ; Traverses de chemin de fer

Re ´sume ´ L’isolement de l’environnement des levures noires pouvant causer des troubles humains est essentiel pour comprendre l’écologie et les voies d’infection. Plusieurs espèces d’Exophiala présentent une prévalence pour les environnements artificiels riches en composés monoaromatiques, tels que les traverses de chemin de fer traitées à la créosote ou imprégnées de pétrole. Les conditions climatiques ambiantes jouent un rôle dans les composition d’espèces dans des habitats convenables. L’objectif de la présente étude était donc d’établir la composition des espèces d’Exophiala dans les gares ferroviaires en tant que source potentielle d’infections humaines dans une région subtropicale avec évaluation de leurs profils de susceptibilité antifongique. Nous avons examiné 150 échantillons de chemins de fer en utilisant des écouvillons de coton humidifiés avec du sérum physiologique stérile. Les levures noires et les membres de la famille ont été sélectionnés sur leur morphologie coloniale et identifiés sur la base du séquençage de l’ADNr des STI. En général, 36 (24 %) des échantillons étaient positifs pour les champignons de levures noirs, c’est-à-dire Exophiala dermatitidis (n = 20, 55,6 %) était prédominant, suivis de E. phaeomuriformis (n = 9, 25 %), E. heteromorpha (n = 5, 13,9 %) et E. xenobiotica (n = 2, 5,6 %). Des contaminations massives de E. dermatitidis ont été observées sur des traverses de chemins de fer sur du bois de chêne cryosoté dans la région proche du niveau de la mer, tandis que dans les climats froids étaient principalement contaminés par des opportunistes humains cliniquement insignifiants ou rares (E. crusticola). Il semble que la température et l’humidité élevées exercent un effet significatif sur la diversité des espèces. De plus, les résultats de la CMI pour toutes les souches de E. dermatitidis et E. phaeomuriformis ont révélé la plus grande plage et les CMI les plus élevées pour la caspofungine (gamme 1—16 mg/ L, moyenne G 4,912 mg/L) et MIC la plus faible pour le posaconazole (0,016—0,031 mg/L, G signifie 0,061 mg/L). Cependant, leur efficacité clinique dans le traitement des infections à l’exophiala reste à déterminer. # 2017 Elsevier Masson SAS. Tous droits réservés.

Introduction Since the late 19th century, black yeasts and relatives have been known as fungi sharing similar features such as melanized cell walls and daughter cells formed through budding [1]. Significant attention has been drawn to the genus Exophiala from the ascomycete order Chaetothyriales, given its potential role in the induction of life-threatening infections in otherwise healthy individuals [2]. Moreover, immunocompromised hosts, intravenous drug abusers, patients with prolonged use of intravenous catheters or antibiotics, and solid organ or hematopoietic stem cell transplant recipients are at risk of infection [3,4]. Thermophilic Exophiala species, particularly E. dermatitidis, are commonly isolated from clinical specimens like sputum, bronchoalveolar lavage (BAL), stool, skin, sinus, and deep organs [5—11]. The natural habitat of E. dermatitidis remains unknown, although it is primarily isolated from man-made environments, i.e., bathing facilities, dishwashers, creosote-treated wood, and gasoline stations [12—14]. However, for the recovery of Exophiala species, selective isolation methods, specific

media, and particular temperatures are required. For instance, extraction via mineral oil and enrichment with volatile aromatic hydrocarbons (e.g., benzene, toluene, and xylene) as the sole sources of carbon and energy have been suggested [15]. Since these techniques are applied on a global scale, E. dermatitidis appears to be highly common in artificial habitats. Also, less pathogenic species, including E. phaeomuriformis and E. xenobiotica, have the distinctive ability to thrive in man-made environments, enriched with toxic aromatic hydrocarbons, such as creosote-treated wooden railway sleepers [1,14,16—19]. Remarkably, prevalence of black yeast-like fungi and relatives in man-made environments has been shown to be influenced by climatic conditions [14]. Therefore, the main objective of the present study was to establish the composition of Exophiala species in railway stations as a potential source of human infections in a subtropical region. Despite worrying clinical manifestations related to E. dermatitidis, little information is available on the antifungal susceptibility profiles of environmental strains against currently available antifungal agents, and so far, only a small number of Iranian strains have

Please cite this article in press as: Yazdanparast SA, et al. Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers. Journal De Mycologie Médicale (2017), http://dx.doi.org/10.1016/j.mycmed.2017.01.007

+ Models

MYCMED-665; No. of Pages 8

Exophiala on railway sleepers been evaluated [20]. Therefore, the second goal of this investigation was the evaluation of in vitro susceptibility of E. dermatitidis and E. phaeomuriformis to five conventional and new generations of antifungal drugs to improve antifungal therapy.

Materials and methods Study setting The samples were collected from creosote-treated oak railways and the soil surrounding the railway sleepers in different compartments of central train stations, Sari, northeastern of Iran, with a subtropical climate. The average temperature, humidity, and altitude of the sampling area were 24 8C, 83.3%, and 132 m, respectively.

Sampling A total of 150 railway samples, including oak wood treated with arsenic creosote (n = 75) and the soil surrounding the railway sleepers (n = 75), were collected. Concrete sleepers, which were stained black by oily compounds leaking from the trains, were not sampled in this study. It should be mentioned that most trains running on these lines have open toilets. However, since the toilets were closed during stops at the stations, fecal contamination was not observed in any of the railway samples. The samples were obtained by sterile cotton swabs and moistened with normal saline. Then, the samples were transferred to sterile tubes and inoculated on malt extract agar (MEA; Difco, Leeuwarden, The Netherlands), supplemented with 0.05 mg/mL of chloramphenicol (Sigma, Germany), as well as on erythritol chloramphenicol agar (ECA; Difco, Leeuwarden, Netherlands) as the selective medium for the isolation of Exophiala species. The plates were incubated at 30 8C in darkness. The soil samples (10 g) were added to 20 mL of sterile mineral oil in 100 mL of sterile saline. Afterwards, antibiotics were added (gentamicin and chloramphenicol; Sigma, Germany), and incubation was performed via vigorous shaking for 20 min at room temperature. The oil/saline interface was seeded on MEA and ECA plates and incubated at 30 8C in darkness [21]. The cultures were monitored daily for up to three weeks to observe fungal growth. The colonies of melanized fungi were selected and transferred to a new MEA medium for purification. The obtained isolates were deposited in the reference culture collection of Invasive Fungi Research Center (IFRC; Sari, Iran), and stock cultures for transient working collections were grown on MEA at 30 8C for a period of five days. Provisional identification at the generic level was based on macroscopic and microscopic characteristics and subsequently, their identity was reconfirmed by molecular analysis.

Molecular identification Genomic DNA was extracted from one week old cultures with Ultraclean Microbial DNA isolation kit (Mo Bio Solana Beach, CA, USA) according to manufacturer’s protocol and stored at 20 8C prior to use [22]. Ribosomal DNA internal transcribed spacers (ITS rDNA) were amplified using universal primers,

3 i.e., V9G (50 TTACGTCCCTGCCCTTTGTA30 ) and LS266 (50 GCATTCCCAAACAACTCGACTC30 ) and sequenced with the internal primers ITS1 (50 -TCCGTAGGTGAACCTGCGG-30 ) and ITS4 (50 -TCCTCCGCTTATTGATATGC-30 ). Briefly, amplification were performed on a Gene Amp PCR System 9700 (Applied Biosystems, Foster City, CA) in 25 mL volumes containing 25 ng of template DNA, 2.5 mL reaction buffer (0.1 M Tris-HCl, pH 8.0, 0.5 M KCl, 15 mM MgCl2, 0.1% gelatine, 1% Triton X-100), 0.2 mM of each dNTP and 2.0 UTaq DNA polymerase (ITK Diagnostics, Leiden, The Netherlands) with cycles of 2 min at 94 8C for primary denaturation, followed by 30 cycles at 94 8C (45 s), 52 8C (30 s) and 72 8C (60 s), with a final 10 min extension step at 72 8C. Amplicons were cleaned with GFX PCR DNA and gel band purification kit (GE Healthcare, UK) [6]. Sequencing was performed on an ABI 3730 xl automatic sequencer (Applied Biosystems, Foster City, CA, USA). Sequence data were aligned manually using the molecular evolutionary genetics analysis (MEGA; http:// www.megasoftware.net/) v. 5.05 and Bio Edit version 7.0.9 software packages and compared with the GenBank and ISHAM ITS rDNA databases (http://its.mycologylab.org/) for species identification.

Genotyping ITS rDNA genotypes of E. dermatitidis were defined according to Matos et al. [23] and of E. phaeomuriformis according to Zalar et al. [24]. Genotyping were performed within the E. dermatitidis based on polymorphisms in rDNA Internal Transcribed Spacer 1. Briefly, nuclear rDNA ITS sequencing of numerous reference strains confirmed the existence of two major genotypes differing in three positions in ITS1, i.e., (162, 184, and 196).

In vitro antifungal susceptibility testing Minimum inhibitory concentrations (MICs) and minimum effective concentrations (MECs) were determined according to the recommendations stated in the Clinical and Laboratory Standards Institute (CLSI) M38-A2 document, as previously described [25]. Amphotericin B (AmB; Bristol-MyersSquib, Woerden, The Netherlands), itraconazole (ITC; Janssen Research Foundation, Beerse, Belgium), voriconazole (VRC; Pfizer), posaconazole (POS; Schering-Plough, Kenilworth, USA) and caspofungin (CAS; Merck Sharp & Dohme, Haarlem, The Netherlands) were obtained as reagent-grade powders from the respective manufacturers for preparation of the CLSI microdilution trays. Briefly, all isolates were grown on PDA plates at 35 8C for up to one week to induce adequate sporulation, with the inoculum suspensions being prepared under by slightly scraping the surface of mature colonies with a loop and the resulting material suspended in sterile saline solution with Tween 40 (0.05%). If large aggregates existed, they were allowed to settle for several minutes, then the homogeneous conidial suspensions were transferred to sterile tubes and the supernatants were adjusted spectrophotometrically at 530 nm wavelengths to an optical density (OD) that ranged from 0.09—0.13 (80—82% transmissions). The final size of the stock inoculum suspensions of the isolates tested ranged from 0.4  104—3.1  104 colony forming units (CFU/mL) as determined by quantitative colony counts on Sabouraud glucose agar (SGA, Difco).

Please cite this article in press as: Yazdanparast SA, et al. Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers. Journal De Mycologie Médicale (2017), http://dx.doi.org/10.1016/j.mycmed.2017.01.007

+ Models

MYCMED-665; No. of Pages 8

4

S.A. Yazdanparast et al.

Candida parapsilosis (ATCC 22019) and Candida krusei (ATCC 6258) were selected as quality controls to be used with every new series of MICs plates. Rates of frequency and MIC data in different genotypes were checked for significance at a = 5% using Chi2 test of homogeneity.

Results Among 150 samples, 24% were positive for black yeast-like fungi. Table 1 summarizes the data related to 36 black yeastlike strains. Overall, 50% of these strains were obtained from creosote-treated oak railway sleepers and 50% from the soil surrounding the sleepers. Macroscopic and microscopic observations showed that all 36 colonies were waxy, smooth, and olivaceous black, containing annellidic conidiogenesis with ellipsoidal conidia; these colonies were provisionally identified as Exophiala species. Based on the sequencing the internal transcribed spacer (ITS rDNA) region, E. dermatitidis

was found to be the dominant species (n = 20, 55.6%), followed by E. phaeomuriformis (n = 9, 25%), E. heteromorpha (n = 5, 13.9%), and E. xenobiotica (n = 2, 5.6%) (Fig. 1). No filamentous black fungi, such as Cladosporium, Curvularia or Alternaria species, which are known to be prevalent in indoor environments, were encountered in our analysis. The genotype distribution of Exophiala species per sample type is presented in Table 1. The genotypes are characterized by three consistent mutations in ITS-1 region. Genotype A2 was predominant with 18 strains, while genotype B was only reported twice. Cardinal growth temperatures of the selected strains from each species showed optimal development at 27—37 8C and growth at 9—42 8C. Table 2 summarizes the MIC range, geometric mean (GM) MIC, MIC50, and MIC90. Based on the evaluation of MICs and MECs, caspofungin showed the highest G mean MIC (4.912 mg/L) and the widest MIC range (1—16 mg/L). However, the lowest MICs for posaconazole ranged between 0.016 and 0.031 mg/L. All tested

Table 1 Isolation data of examined strains. ´ es. ´ es d’isolement des tensions examine Donne Name

E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E.

dermatitidis (IFRC 683) dermatitidis (IFRC 688) dermatitidis (IFRC 753) dermatitidis (IFRC 754) dermatitidis (IFRC 755) dermatitidis (IFRC 756) dermatitidis (IFRC 760) dermatitidis (IFRC766) dermatitidis (IFRC770) dermatitidis (IFRC772) dermatitidis (IFRC774) dermatitidis (IFRC814) dermatitidis (IFRC803) dermatitidis (IFRC805) dermatitidis (IFRC806) dermatitidis (IFRC811) dermatitidis (IFRC779) dermatitidis (IFRC801) dermatitidis (IFRC 689) dermatitidis (IFRC812) phaeomuriformis (IFRC815) phaeomuriformis (IFRC776) phaeomuriformis (IFRC763) phaeomuriformis (IFRC764) phaeomuriformis (IFRC765) phaeomuriformis (IFRC773) phaeomuriformis (IFRC767) phaeomuriformis (IFRC769) phaeomuriformis (IFRC802) heteromorpha (IFRC 686) heteromorpha (IFRC771) heteromorpha (IFRC761) heteromorpha (IFRC762) heteromorpha (IFRC813) xenobiotica (IFRC775) xenobiotica (IFRC768)

Railway source Wood

Soil

+ + +    + +  +       +  +  +    +  + +  + + + +  + +

   + + +   +  + + + + + +  +  +  + + +  +   +     +  

GenBank accession No. ITS rDNA

KP959231 KP959232 KP959234 KP959235 KP959236 KP959237 KP959238 KP959239 KP959240 KP959241 KP959242 KP959250 KP959245 KP959246 KP959247 KP959248 KP959243 KP959244 KP959233 KP959249 KP959263 KP959261 KP959256 KR091913 KP959257 KP959260 KP959258 KP959259 KP959262 KP959252 KP959254 KP959251 KP959253 KP959255 KP959265 KP959264

Genotype

A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 B B                

Growth temp 30

> 40

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

+ + + + + + + + + + + + + + + + + + + +               + +

Please cite this article in press as: Yazdanparast SA, et al. Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers. Journal De Mycologie Médicale (2017), http://dx.doi.org/10.1016/j.mycmed.2017.01.007

+ Models

MYCMED-665; No. of Pages 8

Exophiala on railway sleepers

5

Figure 1 A. Creosote-treated oak railway ties found to harbor Exophiala species. B. Exophiala dermatitidis. Colonies on malt extract agar (MEA) grew slowly after 10 days at 27 8C, having an entire, sharp margin; the mycelium was velvety, slightly elevated in the centre, with an olivaceous-grey to greyish-brown surface and an olivaceous-black. C. Long, erect straight or flexuose, unbranched conidiophores, sometimes geniculate, smooth-walled, and pale to olivaceous brown. Conidiogenous cells were terminal. D. Solitary, smooth-walled, cylindrical to pyriform conidia. Scale bar 10 mm. ˆ ne traite ´ es `a la cre ´ osote pour abriter des espe ` ces d’Exophiala dans la ville de Sari. B. Exophiala A. Des liaisons de chemin de fer en che ´ lentement apre ` s 10 jours `a 27 8C, ayant une marge entie ` re dermatitidis. Les colonies sur l’agar d’extrait de malt (MEA) ont augmente ´ lium ´etait veloute ´ , le ´ ge ` rement sure ´ leve ´ au centre, avec une surface gris-olivace `a brun grisa ˆ tre et un noir et nette ; le myce ´ s, parfois geniculate, `a parois lisses, et pa ˆ le `a brun olivace. Les olivaceux. C. Long, erect droit ou flexuose, conidiophores non ramifie ` nes ´etaient terminales. D. Conidies solitaires, `a parois lisses, cylindriques `a pyriformes. Barre d’e ´ chelle 10 mm. cellules conidioge

Table 2 In vitro susceptibilities of all Exophiala isolates including to five antifungal agents, MIC range, geometric mean (GM), MIC50 and MIC90 values expressed in mg/L. ´ ome ´ trique ´ s in vivo de tous les isolats Exophiala comprenant 5 agents antifongiques, la gamme Mic, la moyenne ge Susceptibilite ´ es en mg/L. (GM) les valeurs MIC50 et MIC90 sont exprime Exophiala species

All E. dermatitidis strains (n = 20)

All E. phaeomuriformis strains (n = 9)

Antifungal Drugs

MIC range

MIC50

MIC90

G mean

AmB ITC VRC

0.016—0.5 0.031—0.5 0.063—1

0.25 0.125 0.25

0.5 0.25 0.5

0.1901 0.1012 0.2546

POS CAS AmB ITC VRC

0.016—0.125 1—16 0.031—0.25 0.031—0.5 0.063—1

0.063 4 0.125 0.125 0.25

0.125 8 ND ND ND

0.0613 4.9125 0.1012 0.1012 0.2546

POS CAS

0.016—0.031 2—16

0.063 4

ND ND

0.0313 4.9125

AmB: amphotericin B; ITC: itraconazole; VRC: voriconazole; POS: posaconazole; CAS: caspofungin; ND: not determined.

Please cite this article in press as: Yazdanparast SA, et al. Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers. Journal De Mycologie Médicale (2017), http://dx.doi.org/10.1016/j.mycmed.2017.01.007

+ Models

MYCMED-665; No. of Pages 8

6

S.A. Yazdanparast et al.

strains had low MICs of amphotericin B, itraconazole, voriconazole and posaconazole. Less active drug was caspofungin. The GM MICs against all strains of E. dermatitidis were as follows in decreasing order: caspofungin (4.9 mg/L); voriconazole (0.25 mg/L); amphotericin B (0.19 mg/L); itraconazole (0.1 mg/L) and posaconazole (0.06 mg/L). There were no significant differences in the activities of the tested drugs against specific species of Exophiala strains. Low MIC ranges in all tested E. dermatitidis strains were rather uniform for triazoles including posaconazole (0.016—0.125 mg/L), voriconazole (0.063—1 mg/L), and itraconazole (0.031— 0.5 mg/L). Posaconazole showed potent activity against E. dermatitidis isolates. In terms of MIC90 (0.125 mg/L), voriconazole was 2-log2-dilution steps less active than posaconazole (0.5 mg/L). Based on the findings, there was no significant difference in the patterns of antifungal susceptibility between genotypes A2 and B of E. dermatitidis (P > 0.05).

Discussion In general, black yeast-like fungi, which belong to the ascomycete order Chaetothyriales, are not easily isolated from the environment through standard protocols [26]. Several Exophiala species have the distinctive ability to thrive in environments rich in mono aromatic compounds or toxic hydrocarbons (e.g., benzene, toluene, and xylene), resulting in their competitive advantage in selecting the habitat. In low-stress environments, selective isolation conditions, e.g., high temperature, a mouse vector, extraction via mineral oils, and enrichment in atmospheres of volatile aromatic hydrocarbons, are required [15,19,27,28]. Dogen et al. simply used incubation at 37 8C as a selective method, since the source of isolation was already rich in toxic monoaromatic hydrocarbons [29]. In the present study, we employed flotation in mineral oil as a selective method for soil samples, since it enables the isolation of chaetothyrialean black yeasts, which could not be isolated via direct plating in previous research [30]. Creosoted railway sleepers constitute an antimicrobial environment, which is hostile to fungi other than black yeasts; consequently, in the present study, isolation was possible, using simple cotton swabs. On certain occasions, adaptation to extreme tolerance may incidentally predispose black fungi to human opportunistic hosts [15,24]. In the current study, all isolated strains of Exophiala species grew at a temperature above 9 8C; however the optimal temperature was 30 8C. Interestingly, E. phaeomuriformis and E. heteromorpha were unable to grow at 40 8C, while E. dermatitidis grew up to 40 8C. Our isolation method resulted in the formation of waxy, moist, olivaceous black colonies within one week. According to a study by Sudhadham et al., black yeast-like fungi and their relatives could not be found in outdoor environments with temperate climates, while they were encountered in low abundance in comparable tropical habitats and feces of birds and bats [14]. Remarkably, in human-made environments, railway ties, contaminated by human feces and oily debris in the tropics, black yeast-like fungi and relatives were abundantly found, while the known abundance of the fungus in steam baths was confirmed [31]. In addition, Exophiala-like fungi have been isolated from feces of humans with and

without underlying diseases in Europe (5.2%) and Africa (3.5%) [8,11]. The majority of positive samples were obtained from African individuals, who had diarrhea during the isolation process. Our results were in parallel with an earlier study in Thailand [14], where railway ties, contaminated by either human feces or oily debris in the tropics, were massively positive for E. dermatitidis [14]. In the present study, at an average temperature of 24 8C (in spring and summer), humidity of 83.3%, and altitude of 132 m, we isolated actively growing E. dermatitidis strains and E. phaeomuriformis, which making upaccounted for 80.6% of all strains from creosote-treated oak railway sleepers and the surrounding soil. However, we did not isolate E. crusticola or E. bergeri strains, which have been obtained from creosote-treated oak railway sleepers in the Netherlands and Turkey [19,31]. In a study by Zhao et al., instead of E. dermatitidis, E. xenobiotica and E. bergeri were isolated from the railways in the temperate climate of the Netherlands (Table 3) [19]. They speculated that the absence of E. dermatitidis in temperate climates can be attributed to the tropical origin of this fungus. E. dermatitidis seems to be consistently preponderant in subtropical climates, suggesting the influence of weather conditions on the species composition on creosoted wood [31]. In a study by Dogen et al. in colder climates at high altitudes, railways were primarily contaminated with clinically insignificant human opportunists (i.e., E. crusticola and E. xenobiotica), whereas in regions close to the sea level with warmer climates, E. dermatitidis was preponderant on railways [32]. In consistence, as presented in Table 3, black yeasts have been obtained from concrete and creosoted oak sleepers in both subtropical and colder regions (Table 3). Our study revealed the consistent presence of black yeasts in 24% of subtropical samples, with E. dermatitidis being the most prevalent species. Many Exophiala species seem to be associated with aromatic hydrocarbons. For instance, E. sideris has been isolated from wild berries, guano-rich soil, and oak railway sleepers treated with arsenic creosote by enriching the samples in a toluene-rich atmosphere. However, these species are normally found in temperate climates; therefore, they were not isolated in our study. Overall, understanding factors, which contribute to infections in various local climatic conditions, may help identify the sources of infections and their epidemiology. Humid, tropical, and subtropical climates with high temperatures seem to contribute to the growing prevalence of infections; however, the impact of these factors is unknown elsewhere. Owing to the scarcity of data on airborne spore concentrations and distribution of chaetothyrialean black yeast species in eastern countries of the Middle East (including Iran), the impact of seasonal weather conditions on the prevalence of black yeasts is unknown. However, Rhinocladiella mackenziei is a genus of black yeast-like extreme neurotropic fungus isolated from a 54-year-old immunocompetent male in Iran where R. mackenziei has not been reported previously [33].

Conclusion Climate has a significant influence on microbial diversity. Interesting to conclude that, railways might be an ecological

Please cite this article in press as: Yazdanparast SA, et al. Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers. Journal De Mycologie Médicale (2017), http://dx.doi.org/10.1016/j.mycmed.2017.01.007

+ Models

MYCMED-665; No. of Pages 8

Exophiala on railway sleepers

7

Table 3 Overview of reported Exophiala species from different continent. ´ ne ´ ral des espe ` ces d’Exophiala rapporte ´ es provenant de diffe ´ rent continent. Aperc¸u ge Authors

Country

Climatic zone

Source

Obtained isolates

Sudhadham et al., 2008 [13]

Thailand

Tropical

Creosote-treated oak railways from six stations ties (n = 6)

E. dermatitidis

Genotype A (n = 376) Genotype B (n = 34) Genotype C (n = 3) Zhao et al., 2010 [18]

Netherlands

Temperate

Creosote-treated railway ties (n = 53)

E. xenobiotica (n = 32) E. bergeri (n = 9) E. dermatitidis

Dogen et al., 2013 [28]

Turkey

Subtropical

Railway: (n = 570: 320 from oak and 250 from concrete)

E. dermatitidis (n = 56)

E. phaeomuriformis (n = 41) Dogen et al., 2013 [32]

Turkey

Cold

Oak and concrete railway ties (n = 658)

E. crusticola (n = 13)

E. phaeomuriformis (n = 7) E. heteromorpha (n = 4) Gümral et al., 2014 [31]

Turkey

Tropical, subtropical, and temperate

Railway sleeper (n = 845); 17% in subtropical regions and 3.6% in cold and arid areas

E. phaeomuriformis (n = 48)

Genotype 1 and Genotype 2 respectively 30:18 E. dermatitidis (n = 24) genotype A and B respectively 23:1 E. heteromorpha (n = 16) E. xenobiotica (n = 5) E. crusticola (n = 1) Yazdanparast et al. 2017 [present paper]

Iran

Subtropical

Soil and creosoted oak wood railway (n = 150)

E. dermatitidis (n = 20) genotypes A2 and B (18:2) E. phaeomuriformis (n = 9) E. heteromorpha (n = 5) E. xenobiotica (n = 2)

niche for E. dermatitidis in regions close to the sea level, with humid and temperate climates, while other opportunistic species have been isolated in cold and dry climates. In addition, sever clinical cases due to E. dermatitidis are difficult to treat despite the application of surgery and antifungal therapy. Although, E. dermatitidis is susceptible to the widely used antifungal drugs such as voriconazole, itraconazole and posaconazole in vitro, treatment remains difficult because of frequent relapses. In the current study amphotericin B and itraconazole had low MICs against E. dermatitidis, but the outcome of most patients treated with these drugs is poor [20]. The explanation of treatment failures might be less than optimal penetration into the central nervous system. In contrast, voriconazole and posaconazole have a good cerebral penetration and thus may

expand the therapeutic options for disseminated mycoses by E. dermatitidis.

Disclosure of interest The authors declare that they have no competing interest.

Acknowledgments This study was financially supported by a grant (92/189) from the School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran, which we gratefully acknowledge. We are grateful to Ywwali Li for excellent technical assistance and help with genotyping.

Please cite this article in press as: Yazdanparast SA, et al. Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers. Journal De Mycologie Médicale (2017), http://dx.doi.org/10.1016/j.mycmed.2017.01.007

+ Models

MYCMED-665; No. of Pages 8

8

S.A. Yazdanparast et al.

References [1] De Hoog GS, Queiroz-Telles F, Haase G, Fernandez-Zeppenfeldt G, Attili-Angelis D, Gerrits Van Den Ende AH, et al. Black fungi: clinical and pathogenic approaches. Med Mycol 2000;38: 243—50. [2] Zeng JS, Sutton DA, Fothergill AW, Rinaldi MG, Harrak MJ, de Hoog GS. Spectrum of clinically relevant Exophiala species in the United States. J Clin Microbiol 2007;45:3713—20. [3] Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, van den Ende AH, de Hoog GS. Biodiversity of the genus Cladophialophora. Stud Mycol 2008;175—91. [4] De Hoog GS, Vicente V, Caligiorne RB, Kantarcioglu S, Tintelnot K, Gerrits van den Ende AH, et al. Species diversity and polymorphism in the Exophiala spinifera clade containing opportunistic black yeast-like fungi. J Clin Microbiol 2003;61:4767—78. [5] Badali H, Chander J, Bayat M, Seyedmousavi S, Sidhu S, Rani H, et al. Multiple subcutaneous cysts due to Exophiala spinifera in an immunocompetent patient. Med Mycol 2012;50:207—13. [6] Badali H, Najafzadeh MJ, van Esbroeck M, van den Enden E, Tarazooie B, Meis JF, et al. The clinical spectrum of Exophiala jeanselmei, with a case report and in vitro antifungal susceptibility of the species. Med Mycol 2010;48:318—27. [7] Chang CL, Kim DS, Park DJ, Kim HJ, Lee CH, Shin JH. Acute cerebral phaeohyphomycosis due to Wangiella dermatitidis accompanied by cerebrospinal fluid eosinophilia. J Clin Microbiol 2000;38:1965—6. [8] de Hoog GS, Matos T, Sudhadham M, Luijsterburg KF, Haase G. Intestinal prevalence of the neurotropic black yeast Exophiala (Wangiella) dermatitidis in healthy and impaired individuals. Mycoses 2005;48:142—5. [9] Haase G, Skopnik H, Groten T, Kusenbach G, Posselt HG. Longterm fungal cultures from sputum of patients with cystic fibrosis. Mycoses 1991;34:373—6. [10] Li DM, de Hoog GS. Cerebral phaeohyphomycosis — a cure at what lengths? Lancet Infect Dis 2009;9:376—83. [11] Nweze EI, Ezute S. Isolation and antifungal susceptibility of Exophiala dermatitidis isolates from human stool samples in Nigeria. Mycopathologia 2010;169:201—6. [12] Dogen A, Kaplan E, Oksuz Z, Serin MS, Ilkit M, de Hoog GS. Dishwashers are a major source of human opportunistic yeastlike fungi in indoor environments in Mersin, Turkey. Med Mycol 2013;51:493—8. [13] Matos T, de Hoog GS, de Boer AG, de Crom I, Haase G. High prevalence of the neurotrope Exophiala dermatitidis and related oligotrophic black yeasts in sauna facilities. Mycoses 2002;45:373—7. [14] Sudhadham M, Prakitsin S, Sivichai S, Chaiyarat R, Dorrestein GM, Menken SB, et al. The neurotropic black yeast Exophiala dermatitidis has a possible origin in the tropical rain forest. Stud Mycol 2008;61:145—55. [15] Seyedmousavi S, Badali H, Chlebicki A, Zhao J, Prenafeta-Boldu FX, De Hoog GS. Exophiala sideris, a novel black yeast isolated from environments polluted with toxic alkyl benzenes and arsenic. Fungal Biol 2011;115:1030—7. [16] Isola D, Selbmann L, de Hoog GS, Fenice M, Onofri S, PrenafetaBoldu FX, et al. Isolation and screening of black fungi as degraders of volatile aromatic hydrocarbons. Mycopathologia 2013;175:369—79. [17] Lian X, de Hoog GS. Indoor wet cells harbour melanized agents of cutaneous infection. Med Mycol 2010;48:622—8.

[18] Woo PC, Ngan AH, Tsang CC, Ling IW, Chan JF, Leung SY, et al. Clinical spectrum of exophiala infections and a novel Exophiala species, Exophiala hongkongensis. J Clin Microbiol 2013;51:260—7. [19] Zhao J, Zeng J, de Hoog GS, Attili-Angelis D, Prenafeta-Boldu FX. Isolation and identification of black yeasts by enrichment on atmospheres of monoaromatic hydrocarbons. Microb Ecol 2010;60:149—56. [20] Badali H, de Hoog GS, Sudhadham M, Meis JF. Microdilution in vitro antifungal susceptibility of Exophiala dermatitidis, a systemic opportunist. Med Mycol 2011;49:819—24. [21] De Hoog GS, Gene J, Figueras MJ. Atlas of clinical fungi. CBSKNAW fungal, . 2nd ed., Utrecht, The Netherlands/Spain: Biodiversity Centre/Universitat Rovira i Virgili Reus; 2000. [22] Badali H, Carvalho VO, Vicente V, Attili-Angelis D, Kwiatkowski IB, Gerrits Van Den Ende AH, et al. Cladophialophora saturnica sp. nov., a new opportunistic species of Chaetothyriales revealed using molecular data. Med Mycol 2009;47:51—62. [23] Matos T, Haase G, Gerrits van den Ende AH, de Hoog GS. Molecular diversity of oligotrophic and neurotropic members of the black yeast genus Exophiala, with accent on E. dermatitidis. Antonie van Leeuwenhoek 2003;83:293—303. [24] Zalar P, Novak M, de Hoog GS, Gunde-Cimerman N. Dishwashers — a man-made ecological niche accommodating human opportunistic fungal pathogens. Fungal Biol 2011;115:997—1007. [25] CLSI. CaLSI reference method for broth dilution antifungal susceptibility testing of filamentous fungi. Approved standard M38-A2, . 2nd ed., Wayne, PA: Clinical and Laboratory Standards Institute; 2008. [26] Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, et al. Environmental isolation of black yeastlike fungi involved in human infection. Stud Mycol 2008;61:137—44. [27] De Hoog GS, Zeng JS, Harrak MJ, Sutton DA. Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons. Antonie van Leeuwenhoek 2006;93:257—68. [28] Prenafeta-Boldu FX, Ballerstedt H, Gerritse J, Grotenhuis JT. Bioremediation of BTEX hydrocarbons: effect of soil inoculation with the toluene-growing fungus Cladophialophora sp. strain T1. Biodegradation 2004;15:59—65. [29] Dogen A, Kaplan E, Ilkit M, de Hoog GS. Massive contamination of Exophiala dermatitidis and E. phaeomuriformis in railway stations in subtropical Turkey. Mycopathologia 2013;175:381— 6. [30] Badali H, Prenafeta-Boldu FX, Guarro J, Klaassen CH, Meis JF, de Hoog GS. Cladophialophora psammophila, a novel species of Chaetothyriales with a potential use in the bioremediation of volatile aromatic hydrocarbons. Fungal Biol 2011;115:1019—29. [31] Gumral R, Tumgor A, Saracli MA, Yildiran ST, Ilkit M, de Hoog GS. Black yeast diversity on creosoted railway sleepers changes with ambient climatic conditions. Microb Ecol 2014;60:699— 707. [32] Dogen A, Ilkit M, de Hoog GS. Black yeast habitat choices and species spectrum on high altitude creosote-treated railway ties. Fungal Biol 2013;117:692—6. [33] Didehdar M, Gokanian A, Sofian M, Mohammadi S, Mohammadi R, Aslani N, et al. First fatal cerebral phaeohyphomycosis due to Rhinocladiella mackenziei in Iran, based on ITS rDNA. J Mycol Med 2015;25:81—6.

Please cite this article in press as: Yazdanparast SA, et al. Consistent high prevalence of Exophiala dermatitidis, a neurotropic opportunist, on railway sleepers. Journal De Mycologie Médicale (2017), http://dx.doi.org/10.1016/j.mycmed.2017.01.007