- Email: [email protected]
Construction and analysis of the immune effect of an Edwardsiella tarda DNA vaccine encoding a D15-like surface antigen
Fish & Shellfish Immunology 30 (2011) 273e279
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Construction and analysis of the immune effect of an Edwardsiella tarda DNA vaccine encoding a D15-like surface antigen Yun Sun a, b, Chun-sheng Liu a, c, Li Sun a, * a
Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate University of the Chinese Academy of Sciences, Beijing 100049, PR China c Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 17 July 2010 Received in revised form 9 October 2010 Accepted 22 October 2010 Available online 6 November 2010
Edwardsiella tarda is a severe aquaculture pathogen with a broad host range that includes both humans and animal. In a previous study, we have identified in E. tarda a D15-like surface antigen, Esa1, which, when used as a recombinant subunit vaccine, is able to induce protective immunity in Japanese flounder (Paralichthys olivaceus) against E. tarda challenge. In this study, we examined further the immunoprotective potential of Esa1 as a DNA vaccine. For this purpose, the DNA vaccine plasmid pCEsa1 was constructed, which expresses esa1 under the cytomegalovirus immediate-early promoter. The vaccine potential of pCEsa1 was analyzed in the Japanese flounder model. The results showed that following vaccination, pCEsa1 and esa1 transcripts were detected in the muscle, liver, spleen, and kidney of the fish at 7, 21, and 49 days post-vaccination (p.v.). Production of Esa1 protein was also detected in the muscle tissue of pCEsa1-vaccinated fish. Compared to control fish, fish vaccinated with pCEsa1 exhibited significantly increased survival rates following E. tarda challenge at one and two months p.v.. Immunological analysis showed that vaccination with pCEsa1 (i) enhanced the respiratory burst activity, acid phosphatase activity, and bactericidal activity of head kidney macrophages; (ii) increased serum bactericidal activity in a Ca2þ-independent manner; (iii) induced the production of specific serum antibodies, which became detectable at 3-week p.v. and afforded 57% protection (in terms of relative percent survival) upon naïve fish as determined by passive immunization; (iv) upregulated the expression of a broad spectrum of genes possibly involved in both innate and adaptive immunity. These results indicate that pCEsa1 is an effective vaccine candidate against E. tarda and also provide insights to the immune mechanism of bacterial DNA vaccine. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: DNA vaccine Edwardsiella tarda Immune genes Macrophage activation Passive immunization
1. Introduction DNA vaccines are genetic vaccines in which the antigenic genes are carried on and expressed from circular DNA plasmids. In addition to the coding sequence of the antigen, the plasmid also contains other elements that are essential to a DNA vaccine: (i) a prokaryotic replication origin and an antibiotic resistance marker that enable the plasmid to be amplified in a bacterial host under selective conditions; (ii) an eukaryotic promoter and a polyadenylation sequence that ensure the expression of the antigen in the target animal. Following vaccination, the plasmid DNA is taken up by the host cells, where the antigenic protein is expressed and induces immune responses [1]. In aquaculture, extensive studies on DNA vaccines have been carried out, most of which, however, are
* Corresponding author. Tel./fax: þ86 532 82898829. E-mail address: [email protected] (L. Sun). 1050-4648/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2010.10.020
directed against viruses [2,3]. Only in recent years have DNA vaccines aimed at fish pathogens of bacterial nature been reported [4e9]. Compared to viral DNA vaccines, bacterial DNA vaccines are much less studied with respect to the immunological mechanisms of protection. Edwardsiella tarda is a Gram-negative bacterium that has been reckoned a serious fish pathogen on the account of its ability to infect many important fish species cultured worldwide, including eel, carp, tilapia, Japanese flounder, turbot, channel catfish, and trout [10e12]. Fish infected by E. tarda develop a systematic disease called edwardsiellosis, which often leads to heavy mortality under stress conditions and thus causes severe economic losses [13,14]. In addition to fish, E. tarda can also infect humans and has been associated with diseases such as gastroenteritis, septicemia, and meningitis [15,16]. With the serious impact of E. tarda on fish cultures, vaccine development against this pathogen has become an urgent need. In recent years, a number of candidate E. tarda vaccines have been
274
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
reported, some of which (a bacterin, an E. tarda ghost, and a bacterium-delivered recombinant subunit vaccine) provide protections to the extents of more than 90% (in terms of relative percent survival) at laboratory trials [17e20]. Since E. tarda is known to be an intracellular pathogen, we have in a previous study examined the immunoprotective potential of an E. tarda DNA vaccine based on a weak immunogen [9]. In the present report, we further explored the potential of DNA vaccine in the control of edwardsiellosis with an emphasis on the immune response elicited by the vaccine. 2. Materials and methods
liver, kidney, and spleen as described previously [21]. Relative percent of survival (RPS) was calculated according to the following formula: RPS ¼ {1 (% mortality in vaccinated fish/% mortality in control fish)} 100 [24]. All vaccination trials were repeated once, and the mean mortality and RPS were given in the results. 2.5. PCR detection of plasmid DNA in vaccinated fish Muscle, kidney, spleen, and liver were taken from the vaccinated fish at different times p.v.. DNA was extracted from the tissues with the TIANamp DNA Kit (Tiangen, Beijing, China) and used for PCR analysis with primers RTF1 (50 - TGCGCAGCTACTATCTGGAT -30 ) and SAR3 (50 - CGGTGATGTTGATGGTGATGT -30 ).
2.1. Bacterial strain and growth condition E. tarda TX1 is a fish pathogen that has been reported previously [21]. It was cultured in Luria-Bertani broth (LB) medium [22] at 28 C. 2.2. Plasmid construction and preparation To construct pCEsa1, esa1 was amplified by PCR with SAF7 (50 GATATCACCACCATGGCAGATGGTTTCGTAGT -30 ; underlined, EcoRV site) and SAR10 (50 e GCGCGATATCCCAGGTTTTACCGATATTA -30 ; underlined, EcoRV site). The PCR products were ligated to the TA cloning vector pBS-T (Tiangen, Beijing, China). The recombinant plasmid was digested with EcoRV, and the esa1-containing fragment was retrieved and inserted into pCN3 [9] at the SmaI site, resulting in pCEsa1. Endotoxin-free plasmid DNA was prepared using EndoFree plasmid Kit (Tiangen, Beijing, China). The purity of the purified DNA was analyzed spectrophotometrically by measuring absorbance at A260/280 and A260/230. The integrity of the plasmid DNA was assessed by agarose gel electrophoresis. 2.3. Fish Japanese flounder (Paralichthys olivaceus) were purchased from a local fish farm (Haiyang, Qingdao, China) and acclimatized in the laboratory for two weeks before experimental manipulation. Fish were fed daily with commercial dry pellets and maintained at w22 C in aerated seawater that was changed twice daily. Before experiments, fish were randomly sampled for the examination of bacterial recovery from blood, liver, kidney, and spleen. Fish were used for experiment only when no bacteria could be detected from any of the examined tissues of the sampled fish. Fish were anaesthetized with tricaine methanesulfonate (Sigma, St. Louis, MO, USA) before blood collection. Sacrifice was performed by administration into the fish an overdose of tricaine methanesulfonate as described previously [23]. 2.4. Vaccination pCEsa1 and pCN3 were diluted in PBS to 250 mg/ml. Japanese flounder (w9.3 g) were divided randomly into three groups (120 fish/group) and injected intramuscularly (i.m.) with 100 ml of pCEsa1, pCN3, or PBS. From each group, 40 fish were used for PCR and RT-PCR analysis of the presence of pCEsa1 and the transcription of esa1 in fish tissues (see below sections), 24 fish were used for ELISA analysis, and 56 fish were challenged with E. tarda TX1 at one- and two-month post-vaccination (p.v.). After challenge, three fish from each group were used for qRT-PCR analysis at 24 h postchallenge (see below section), while the remaining fish were monitored for mortality over a period of 20 days, with dying fish randomly selected for the examination of bacterial recovery from
2.6. Reverse transcriptase-PCR (RT-PCR) analysis of the expression of DNA vaccines To examine esa1 expression in the vaccinated fish, tissues were taken from the fish as described above at different times p.v. and used for total RNA extraction with RNAprep Tissue Kit (Tiangen, Beijing, China). One microgram of total RNA was used for cDNA synthesis with Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). RT-PCR was carried out as described previously [9] using b-actin RNA as an internal control. 2.7. Quantitative real time reverse transcriptase-PCR (qRT-PCR) analysis of the expression of immune genes Japanese flounder were vaccinated with pCEsa1 and challenged with TX1 as described above. Spleen was taken from the fish at 24 h post-challenge. Total RNA extraction and cDNA synthesis were as described above. qRT-PCR was carried out in an ABI 7300 Real-time Detection System (Applied Biosystems, Foster City, CA, USA) using SYBR ExScript qRT-PCR Kit (Takara, Dalian, China) as described previously [25]. Each assay was performed in triplicate with b-actin RNA as the control. The primers used for qRT-PCR of b-actin and the immune genes have been reported previously [26]. All data are given in terms of relative mRNA, expressed as means plus or minus standard errors of the means (SE). 2.8. Immunohistochemistry and histopathology Immunohistochemistry and histopathology were performed as described previously [9]. Briefly, muscle tissues were taken from vaccinated fish as described above at 7 days p.v.. The tissue samples were fixed first with glutaraldehyde and then with osmium tetroxide. Fixed tissues were dehydrated in ethanol and embedded in Epon resin. Ultrathin sections (60e80 nm) were generated with a Leica Ultracut E micotome (Reichert, Austria). The sections were labeled first with mouse anti-His monoclonal antibody (Tiangen, Beijing, China) and then with gold-labeled goat anti-mouse IgG (Bios, Beijing, China). After staining with uranyl acetate and lead citrate, the sections were observed with a transmission electron microscope (GEM-1200, GEOL, Japan). 2.9. Effect of pCEsa1 vaccination on macrophage activation 2.9.1. Preparation of head kidney (HK) macrophages Japanese flounder (w27 g) were vaccinated with pCEsa1 (40 mg/fish), pCN3 (40 mg/fish), or PBS as described above with an injection volume of 100 ml/fish. The fish were sacrificed at 48 h p.v.. HK macrophages were prepared based on the method of Chung and Secombes [27]. In brief, HK was removed, washed three times with PBS, and passed through a sterile metal mesh. The cells were resuspended in L-15 medium (Thermo Scientific
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
HyClone, Beijing, China) and placed onto a 34/51% Percoll (Solarbio, Beijing, China) gradient, followed by centrifugation at 400g for 30 min. After centrifugation, the cells at the 34/51% interface were recovered, washed twice and resuspended in L-15 medium -containing 10% calf serum (Thermo Scientific HyClone, Beijing, China), 1% penicillin and streptomycin (Sangon, Shanghai, China), and 20 U/ml heparin (Sigma, St. Louis, MO, USA). The cells were added to 96-well microplates (w2 105 cells/well) and incubated at 25 C for 2 h. Non-adherent cells were washed off after the incubation. 2.9.2. Respiratory burst activity Respiratory burst activity was determined as reported previously [28]. In brief, 100 ml of 1 mg/ml nitroblue tetrazolium (Sangon, Shanghai, China) in L-15 was added to 2 105 of macrophages in a 96-well microplate. After incubation at 25 C for 2 h, the reaction was stopped by adding 100% methanol. The plate was washed with 70% methanol, and the reduced formazan was solubilized in 100 ml of 2 M KOH and 120 ml of DMSO. The plate was read at 630 nm with a microplate reader. 2.9.3. Acid phosphatase (AP) assay AP assay was performed as reported previously [28]. Briefly, HK macrophages prepared above in a microplate plate were washed three times with PBS. The cells were lysed by adding 50 ml of 0.1% Triton X-100 to each well and incubated first at 4 C for 30 min and then at 37 C for 30 min. After incubation, 150 ml of 12 mM p-nitrophenyl phosphate (Sigma, St. Louis, MO, USA) in 0.2 M acetate (pH 5.0) was added to each well, and the plate was incubated at 27 C for 3 h. After incubation, 50 ml of ice-cold 0.01 M EDTA prepared in 0.1 M NaOH was added to each well, and the plate was read immediately at 410 nm. 2.9.4. Bactericidal activity Bactericidal activity was determined based on the method of Graham et al. [29]. Briefly, TX1 was cultured in LB medium to midlogarithmic phase, washed, and resuspended in PBS to 104 CFU/ml. HK macrophages prepared above in a microplate (105 cells/well) were washed with PBS and mixed with TX1 (100 ml/well). The plate was incubated at 25 C for 0 h (control) or 5 h, and the cells were lysed by adding 50 ml of 0.2% Tween 20 to each well. LB was added to the plate (100 ml/well), and the plate was incubated at 25 C for overnight. Ten microliters of 5 mg/ml MTT {3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di- phenytetrazoliumromide} (Sangon, Shanghai, China) was added to the plate. The plate was incubated at 25 C for 20 min, and absorbance at 570 nm was determined. Bactericidal activity was defined as follows: 100 {1 (A570 of 5 h incubation/ A570 of 0 h incubation)}. 2.10. Serum bactericidal activity Serum survival analysis was performed as described previously [23]. Briefly, TX1 was cultured in LB medium to mid-logarithmic phase and resuspended in Hank’s balanced salt solution (Gibco, Invitrogen Corp., Carlsbad, CA, USA). Japanese flounder serum was treated with or without heating at 56 C for 30 min. Approximately 105 bacterial cells were mixed with 50 ml of treated and untreated flounder serum in the presence or absence of 0.05 M EGTA [ethyleneglycol-bis(3-aminoethyl ether)-N,N-tetraacetic acid]. After incubation with mild agitation at 30 C for 60 min, the mixture was serially diluted and plated in triplicate on LB agar plates. The plates were incubated at 28 C for 48 h. The colonies that appeared on the plates were enumerated. Survival rate in the untreated serum was expressed as a percentage of the survival rate in the heat-treated serum.
275
2.11. Enzyme-linked immunosorbent assay (ELISA) Sera were collected from vaccinated fish (four at each time point) at different times p.v. and diluted 20-fold in PBS. ELISA was performed as described previously [9]. Briefly, 96-well ELISA plates (Sangon, Shanghai, China) were coated with 0.05% (w/v) poly-Llysine in coating buffer (0.159% Na2CO3, 0.293% NaHCO3, pH 9.6) for 1 h, followed by washing the plates 3 with coating buffer. The plates were then coated with 100 ml/well purified recombinant Esa1 and incubated at 4 C for overnight. The plates were washed 3 with coating buffer and coated with 1% bovine serum album (BSA) at 22 C for 2 h, followed by washing 3 with PBST (0.1% Tween-20 in PBS). Diluted sera were added in triplicate to the wells of the plates. After incubation at 37 C for 2 h and washing with PBST, mouse anti-turbot IgM monoclonal antibody (Aquatic Diagnostic Ltd, Stirling, Scotland, UK) was added to the plates. The plates were incubated and washed as above. Horse-radish peroxidaseconjugated goat anti-mouse IgG (Bios, Beijing, China) was added to the plates. Color development was performed with the TMB Kit (Bios, Beijing, China). The plates were read at 450 nm with a Precision microplate reader (Molecular Devices, Toronto, Canada). 2.12. Passive immunization Passive immunization assay was performed according to the method of Pasnik et al. [30]. Briefly, two groups (10 fish/group) of Japanese flounder (w4.7 g) were administered i.p. with 100 ml of serum from pCEsa1- or pCN3-vaccinated fish. At 20 h post-immunization, fish were challenged with TX1 and monitored for mortality as described above. 2.13. Statistical analysis All statistical analyses were performed using SPSS 15.0 package (SPSS Inc., Chicago, IL, USA). Differences in antibody and transcription levels were analyzed with one-way analysis of variance (ANOVA). In all cases, the significance level was defined as P < 0.05. 3. Results 3.1. Immunoprotective effect of pCEsa1 3.1.1. Expression of Esa1 in fish tissues following vaccination In a previous study, we have identified from a pathogenic E. tarda strain a D15-like surface antigen, Esa1, and found that purified recombinant Esa1 induces protective immunity in Japanese flounder [31]. To examine the potential of Esa1 as a DNA vaccine, we in this study constructed an esa1based DNA vaccine plasmid, pCEsa1, which expresses esa1 from the human cytomegalovirus immediate-early promoter. Japanese flounder were vaccinated with pCEsa1, pCN3 (the control vector), and PBS, respectively. PCR and RT-PCR analyses showed that both plasmid DNA and esa1 transcripts were detected in muscle, liver, spleen, and kidney of pCEsa1-vaccinated fish at 7, 21, and 49 days p.v.. In contrast, no esa1 transcription was detected in pCN3- or PBS-vaccinated fish (Fig. 1 and data not shown). To examine whether Esa1 protein was synthesized in the vaccinated fish, immunohistochemistry analysis was performed, which showed that production of Esa1 protein was detected in the muscle tissue of pCEsa1-vaccinated fish, but not in that of pCN3-vaccinated fish (Fig. 2). 3.1.2. Protection by pCEsa1 against E. tarda challenge At one-month p.v., the vaccinated fish were challenged with E. tarda TX1 and monitored for cumulative mortality. The results showed that the accumulated mortalities of pCEsa1-, pCN3-, and
276
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
Furthermore, the presence of EGTA, a Ca2þ chelator, had no apparent effect on the serum bactericidal activity of pCEsa1vaccinated fish.
Fig. 1. PCR detection of pCEsa1 (A) and RT-PCR detection of esa1 transcription (B and C) in vaccinated fish. Japanese flounder were vaccinated with pCEsa1 (lanes 3, 5, 7, and 9) or pCN3 (lanes 2, 4, 6, and 8). At 7 days post-vaccination, DNA and RNA were extracted from muscle (lanes 2 and 3), liver (lanes 4 and 5), spleen (lanes 6 and 7), and kidney (lanes 8 and 9) and used for PCR and RT-PCR analysis, respectively. PCR was performed using primers specific to pCEsa1. RT-PCR was performed using primers specific to Esa1 (B) or b-actin (C) (as an internal control). Lane 1, DNA markers.
PBS-vaccinated fish were 20%, 76%, and 80%, respectively (Supplemental data Fig. 1). Hence, compared to PBS-vaccinated fish, pCEsa1-vaccinated fish were significantly (P < 0.05) protected, with a RPS of 75%. To examine the duration of protection, the vaccinated fish were challenged with TX1 at two-month p.v., and the results showed that the accumulated mortality of pCEsa1-vaccinated fish (24%) was significantly (P < 0.05) lower than those of pCN3- and PBS-vaccinated fish (88%, and 84%, respectively) (Supplemental data Fig. 1). The RPS of pCEsa1-vaccinated fish was 71% compared to PBS-vaccinated fish. Bacteriological analysis showed that TX1 was the only type of bacterial strain that was re-isolated from moribund fish. Histopathological examination revealed granuloma-like structures in the spleen of all the survival fish that that had been vaccinated with pCN3 or PBS but in none of the survival fish that had been vaccinated with pCEsa1. 3.2. Immune response induced by pCEsa1 3.2.1. Macrophage activation Macrophage activation analysis showed that, compared to macrophages from control fish, macrophages from pCEsa1-vaccinated fish exhibited significantly enhanced respiratory burst activity (P < 0.01), AP activity (P < 0.01), and bactericidal activity (P < 0.05) (Fig. 3). 3.2.2. Serum bactericidal activity Serum bactericidal activity analysis showed that the serum of pCEsa1-vaccinated fish exhibited significantly (P < 0.05) stronger bactericidal activity than the serum of the control fish (Fig. 4).
3.2.3. Serum antibody response and its significance to immunoprotection ELISA analysis showed that in fish vaccinated with pCEsa1, Esa1specific serum antibodies became detectable at 3-week p.v., reached maximum at 4-week p.v., and lasted until at least 7-week p.v. (Fig. 5). No specific serum antibody production was detected in fish vaccinated with pCN3. The potential contribution of serum antibodies to the protection elicited by pCEsa1 was determined by passive immunization, which showed that the cumulative mortalities of the fish immunized with sera from pCEsa1- and pCN3-vaccinated fish were 30% and 70%, respectively. Hence, the immunoprotective efficacy, in terms of RPS, of the serum from pCEsa1-vaccinated fish was 57%. 3.2.4. Expression of immune-related genes To examine the effect of pCEsa1 on the expression of immunerelated genes, qRT-PCR was carried out to determine the transcription of the genes encoding immunoglobulin M (IgM) and D (IgD), major histocompatibility complex (MHC) class Ia and class IIa, CD8a, CD40, complement C3, interleukin 1b(IL-1b), interleukin 6 (IL-6), IFN-g, tumor necrosis factor-alpha (TNF-a), interferon (IFN), interferon-induced Mx protein (Mx), and NK cell enhancing factor (NKEF). The results showed that compared to vaccination with pCN3, vaccination with pCEsa1 significantly (P < 0.01 or P < 0.05) upregulated the expression of all the examined genes except that encoding IgD (Fig. 6). 4. Discussion In this report, we described the construction and analysis of the immune effect of an E. tarda DNA vaccine, pCEsa1, based on the D15-like surface antigen Esa1 derived from a pathogenic E. tarda strain. Previous studies of virus DNA vaccines in rainbow trout, Atlantic salmon, and Atlantic cod models have indicated that, following i.m. injection, DNA vaccine plasmids were detected at the injection site as well as in kidney, spleen, and gills long after administration [32e34]. Similarly, in our study, we found that pCEsa1 and esa1 transcription were detected in muscle, liver, spleen, and kidney of the vaccinated fish until at least 49 days p.v., suggesting that upon vaccination, some pCEsa1 entered myocytes while others were transported away from muscle to other tissues where the plasmid DNA was taken up by the respective tissue cells, in which, as in myocytes, esa1 expression took place. We do not
Fig. 2. Production of Esa1 in the muscle tissue of pCEsa1-vaccinated fish. Muscle tissues were taken from Japanese flounder vaccinated with pCN3 (A) and pCEsa1 (B) at 7 days postvaccination and used for immunohistochemistry with gold-labeled antibodies. Arrows indicate gold particles. Bar ¼ 100 nm.
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
277
Fig. 3. Effect of pCEsa1 vaccination on macrophage activation. Japanese flounder were vaccinated with pCEsa1 or pCN3 (control), and head kidney macrophages were collected and used for the analysis of respiratory burst activity (A), acid phosphatase activity (B), and bactericidal activity (C). Data are presented as means SE (N ¼ 3). *P < 0.05; **P < 0.01.
know whether injection volume has any effect on the dissemination of the vaccine plasmid; it would be interesting to examine whether the same amount of vaccine administered at different volumes would have different dissemination results. Taken together, the wide distribution and persistence of pCEsa1 in the vaccinated fish observed in our study are likely to account at least in part for the relatively high level and lasting protection of pCEsa1. Of the few studies concerning DNA vaccines against bacterial pathogens, it is known that in fish vaccinated with an Aeromonas veronii DNA vaccine, specific serum antibodies were detected at 4and 6-week p.v., while in fish vaccinated with DNA vaccines against Mycobacterium marinum and Vibrio anguillarum, serum antibodies were detected at as early as 2-week p.v. and lasted until 5-week p.v. [4,5,7,8]. In the case of pCEsa1, we found that specific serum antibodies began to occur at 3-week p.v., reached maximum at 4-week p.v., and lasted until 7-week p.v.. Since passive immunization showed that naïve Japanese flounder immunized with the serum from pCEsa1-vaccinated fish exhibited a RPS of 57%, it is likely that antibody-mediated immune response plays an important part in pCEsa1-induced protective immunity. On the other hand, since the RPS of passive immunization is much lower than that of pCEsa1,
pCEsa1 must have elicited immune responses other than that mediated by antibodies. DNA vaccines are known to elicit both innate and adaptive immunity. Byon et al. [35] have reported that Japanese flounder vaccinated with a DNA vaccine expressing the glycoprotein gene of viral hemorrhagic septicemia virus exhibited increased expression of the immune factors involved in nonspecific and specific responses. Similar observations have been made by other research groups in the studies of DNA vaccines against fish viruses [36e38]. However, no kindred studies have been documented for bacterial DNA vaccines against fish pathogens except our previous report on the study of the E. tarda DNA vaccine pCE6, which was found to induce humoral and cellular immunity, due in part to the immunopotentiating effect of a molecular adjuvant [9]. In this study, we observed that vaccination with pCEsa1 enhanced macrophage respiratory burst activity and bactericidal activity and increased serum bactericidal activity in a Ca2þ-independent manner, suggesting that pCEsa1 activated macrophages and the complement system, the latter probably via the alternative complement activation pathway. Although the macrophage activation study was conducted with fish of larger size (for the convenience of macrophage collection), similar immunological response may be expected in the smaller fish used in the vaccination trials. In line with the observation that pCEsa1-vaccinated fish produced specific serum
Fig. 4. Effect of pCEsa1 vaccination on serum bactericidal activity. Japanese flounder were vaccinated with pCEsa1 and pCN3 (control), respectively. Sera were collected from the fish and used to determine bactericidal activity in the absence or presence of EGTA. Data are presented as means SE (N ¼ 3). *P < 0.05.
Fig. 5. Serum antibody production in pCEsa1-vaccinated fish. Japanese flounder were vaccinated with pCEsa1 and PBS (control), respectively. Sera were collected from the fish at 2e7 weeks post-vaccination, and serum antibodies against Esa1 were determined by ELISA. Data are presented as means SE (N ¼ 4). *P < 0.05; **P < 0.01.
278
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
Fig. 6. qRT-PCR analysis of the expression of immune genes in pCEsa1-vaccinated fish. Japanese flounder were vaccinated with pCEsa1 or pCN3 and challenged with TX1. Total RNA was extracted from spleen at 24 h post-challenge and used for qRT-PCR. For each gene, the mRNA level of the fish vaccinated with pCN3 was set as 1. Data are presented as means SE (N ¼ 3). *P < 0.05; **P < 0.01.
antibodies, expression of the IgM gene was significantly induced by pCEsa1 vaccination. In contrast, IgD expression was unaffected by pCEsa1. The function of IgD in fish is essentially unknown; in humans and mouse, IgD is an antigen receptor found on the surface of B cells and is down-regulated upon antigen encounter, however, the signaling mechanism of IgD is unclear [39]. The observation that IgD expression levels were comparable in pCEsa1-vaccinated fish and control fish suggests that IgD is not a key factor in pCEsa1induced immunity. In addition to IgM, the expressions of a number of other immune relevant genes, particularly those encoding C3, Mx, IFN, MHC IIa, MHC Ia, TNF-a, IL-1b, NKEF, CD40, and CD8a, were also upregulated by pCEsa1 to significant extents. These results suggest that pCEsa1 is likely to induce B cell immunity, innate humoral and cellular response, and possibly specific cellular immune response. In summary, the results of this study demonstrate that pCEsa1 is an effective DNA vaccine that can protect Japanese flounder against lethal E. tarda challenge. The immunoprotective effect of pCEsa1 is probably the result of its ability to activate macrophages and the complement system and to induce the expression of a wide spectrum of genes that are possibly associated with specific and nonspecific immunity. Acknowledgements This work was supported by the grants from the Ministry of Science and Technology (2008AA092501) and the National Natural Science Foundation of China grant 31025030. Appendix. Supplementary data Supplementary data associated with this article can be found in the online version, at doi:10.1016/j.fsi.2010.10.020. References [1] Tonheim TC, Bogwald J, Dalmo RA. What happens to the DNA vaccine in fish? A review of current knowledge. Fish Shellfish Immunol 2008;25:1e18. [2] Heppell J, Davis HL. Application of DNA vaccine technology to aquaculture. Adv Drug Deliv Rev 2000;43:29e43. [3] Lorenzen N, Lorenzen E, Einer-Jensen K, LaPatra SE. DNA vaccines as a tool for analysing the protective immune response against rhabdoviruses in rainbow trout. Fish Shellfish Immunol 2002;12:439e53. [4] Kumar SR, Parameswaran V, Ahmed VP, Musthaq SS, Hameed AS. Protective efficiency of DNA vaccination in Asian seabass (Lates calcarifer) against Vibrio anguillarum. Fish Shellfish Immunol 2007;23:316e26.
[5] Pasnik DJ, Smith SA. Immunogenic and protective effects of a DNA vaccine for Mycobacterium marinum in fish. Vet Immunol Immunopathol 2005;103: 195e206. [6] Pasnik DJ, Smith SA. Immune and histopathologic responses of DNA-vaccinated hybrid striped bass Morone saxatilis M. chrysops after acute Mycobacterium marinum infection. Dis Aquat Org 2006;73:33e41. [7] Vazquez-Juarez RC, Gomez-Chiarri M, Barrera-Saldana H, HernandezSaavedra N, Dumas S, Ascencio F. Evaluation of DNA vaccination of spotted sand bass (Paralabrax maculatofasciatus) with two major outer-membrane protein-encoding genes from Aeromonas veronii. Fish Shellfish Immunol 2005;19:153e63. [8] Yang H, Chen J, Yang G, Zhang XH, Liu R, Xue X. Protection of Japanese flounder (Paralichthys olivaceus) against Vibrio anguillarum with a DNA vaccine containing the mutated zinc-metalloprotease gene. Vaccine 2009;27: 2150e5. [9] Jiao XD, Zhang M, Hu YH, Sun L. Construction and evaluation of DNA vaccines encoding Edwardsiella tarda antigens. Vaccine 2009;27:5195e202. [10] Matsuyama T, Kamaishi T, Ooseko N, Kurohara K, Iida T. Pathogenicity of motile and non-motile Edwardsiella tarda to some marine fish. Fish Pathol 2005;40:133e5. [11] Swain P, Behura A, Dash S, Nayak SK. Serum antibody response of Indian major carp, Labeo rohita to three species of pathogenic bacteria. Aeromonas hydrophila, Edwardsiella tarda and Pseudomonas fluorescens. Vet Immunol Immunopathol 2007;117:137e41. [12] Thune RL, Stanley LA, Cooper RK. Pathogenesis of gram negative bacterial infections in warm water fish. Annu Rev Fish Dis 1991;3:37e68. [13] Castro N, Toranzo AE, Barja JL, Nunez S, Magarinos B. Characterization of Edwardsiella tarda strains isolated from turbot, Psetta maxima (L). J Fish Dis 2006;29:541e7. [14] Yang CZ, Wang XH, Huang J. Identification and phylogenetic analysis of pathogen- Edwardsiella tarda from cultured turbot (Scophthalmus maximus). J Shanghai Fish Univ 2008;17:280e4. [15] Nelson JJ, Nelson CA, Carter JE. Extraintestinal manifestations of Edwardsiella tarda infection: a 10-year retrospective review. J La State Med Soc 2009;161:103e6. [16] Slaven EM, Lopez FA, Hart SM, Sanders CV. Myonecrosis caused by Edwardsiella tarda: a case report and case series of extraintestinal E. tarda infections. Clin Infect Dis 2001;32:1430e3. [17] Castro N, Toranzo AE, Nunez S, Magarinos B. Development of an effective Edwardsiella tarda vaccine for cultured turbot (Scophthalmus maximus). Fish Shellfish Immunol 2008;25:208e12. [18] Kwon SR, Nam YK, Kim SK, Kim KH. Protection of tilapia (Oreochromis mosambicus) from edwardsiellosis by vaccination with Edwardsiella tarda ghosts. Fish Shellfish Immunol 2006;20:621e6. [19] Lee DJ, Kwon SR, Zenke K, Lee EH, Nam YK, Kim SK, et al. Generation of safety enhanced Edwardsiella tarda ghost vaccine. Dis Aquat Org 2008;81:249e54. [20] Jiao X, Dang W, Hu Y, Sun L. Identification and immunoprotective analysis of an in vivo-induced Edwardsiella tarda antigen. Fish Shellfish Immunol 2009; 27:633e8. [21] Zhang M, Sun K, Sun L. Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain. Microbiology 2008;154: 2060e9. [22] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press; 1989. [23] Wang H, Hu Y, Zhang W, Sun L. Construction of an attenuated Pseudomonas fluorescens strain and evaluation of its potential as a cross-protective vaccine. Vaccine 2009;27:4047e55. [24] Amend DF. Potency testing of fish vaccinesInternational symposium on fish biologics: serodiagnostics and vaccines. Dev Biol Stand 1981;49:447e54. [25] Zhang W, Sun K, Cheng S, Sun L. Characterization of DegQVh, a Serine Protease and a protective immunogen from a pathogenic Vibrio harveyi strain. Appl Environ Microbiol 2008;74:6254e62. [26] Jiao X, Cheng S, Hu Y, Sun L. Comparative study of the effects of aluminum adjuvants and Freund’s incomplete adjuvant on the immune response to an Edwardsiella tarda major antigen. Vaccine 2010;28:1832e7. [27] Chung S, Secombes CJ. Activation of rainbow trout macrophages. J Fish Biol 1987;31:51e6. [28] Chung S, Secombes CJ. Analysis of events occurring with teleost macrophages during the respiratory burst. Comp Biochem Physiol 1988;89B:539e44. [29] Graham S, Jeffries AH, Secombes CJ. A novel assay to detect macrophage bactericidal activity in fish: factors influencing the killing of Aeromonas salmonicida. J Fish Dis 1988;11:389e96. [30] Pasnik DJ, Evans JJ, Klesius PH. Passive immunization of Nile tilapia (Oreochromis niloticus) provides significant protection against Streptococcus agalactiae. Fish Shellfish Immunol 2006;21:365e71. [31] Sun Y, Liu C, Sun L. Identification of an Edwardsiella tarda surface antigen and analysis of its immunoprotective potential as a purified recombinant subunit vaccine and a surface-anchored subunit vaccine expressed by a fish commensal strain. Vaccine, in press. [32] Boudinot P, Blanco M, de Kinkelin P, Benmansour A. Combined DNA immunization with the glycoprotein gene of viral hemorrhagic septicemia virus and infectious hematopoietic necrosis virus induces double-specific protective immunity and nonspecific response in rainbow trout. Virology 1998;249: 297e306. [33] Tonheim TC, Dalmo RA, Bogwald J, Seternes T. Specific uptake of plasmid DNA without reporter gene expression in Atlantic salmon (Salmo salar L.)
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279 kidney after intramuscular administration. Fish Shellfish Immunol 2008;24: 90e101. [34] Seternes T, Tonheim TC, Løvoll M, Bøgwald J, Dalmo RA. Specific endocytosis and degradation of naked DNA in the endocardial cells of cod (Gadus morhua L.). J Exp Biol 2007;210:2091e103. [35] Byon JY, Ohira T, Hirono I, Aoki T. Use of a cDNA microarray to study immunity against viral hemorrhagic septicemia (VHS) in Japanese flounder (Paralichthys olivaceus) following DNA vaccination. Fish Shellfish Immunol 2005;18:135e47. [36] Cuesta A, Tafalla C. Transcription of immune genes upon challenge with viral hemorrhagic septicemia virus (VHSV) in DNA vaccinated rainbow trout (Oncorhynchus mykiss). Vaccine 2009;27:280e9.
279
[37] Purcell MK, Nichols KM, Winton JR, Kurath G, Thorgaard GH, Wheeler P, et al. Comprehensive gene expression profiling following DNA vaccination of rainbow trout against infectious hematopoietic necrosis virus. Mol Immunol 2006;43:2089e106. [38] Utke K, Kock H, Schuetze H, Bergmann SM, Lorenzen N, Einer-Jensen K, et al. Combined DNA immunization with the glycoprotein gene of viral hemorrhagic septicemia virus and infectious hematopoietic necrosis virus induces double-specific protective immunity and nonspecific response in rainbow trout. Dev Comp Immunol 2008;32:239e52. [39] Chen K, Cerutti A. New insights into the enigma of immunoglobulin D. Immunol Rev 2010;237:160e79.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Construction and analysis of the immune effect of an Edwardsiella tarda DNA vaccine encoding a D15-like surface antigen Yun Sun a, b, Chun-sheng Liu a, c, Li Sun a, * a
Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate University of the Chinese Academy of Sciences, Beijing 100049, PR China c Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 17 July 2010 Received in revised form 9 October 2010 Accepted 22 October 2010 Available online 6 November 2010
Edwardsiella tarda is a severe aquaculture pathogen with a broad host range that includes both humans and animal. In a previous study, we have identified in E. tarda a D15-like surface antigen, Esa1, which, when used as a recombinant subunit vaccine, is able to induce protective immunity in Japanese flounder (Paralichthys olivaceus) against E. tarda challenge. In this study, we examined further the immunoprotective potential of Esa1 as a DNA vaccine. For this purpose, the DNA vaccine plasmid pCEsa1 was constructed, which expresses esa1 under the cytomegalovirus immediate-early promoter. The vaccine potential of pCEsa1 was analyzed in the Japanese flounder model. The results showed that following vaccination, pCEsa1 and esa1 transcripts were detected in the muscle, liver, spleen, and kidney of the fish at 7, 21, and 49 days post-vaccination (p.v.). Production of Esa1 protein was also detected in the muscle tissue of pCEsa1-vaccinated fish. Compared to control fish, fish vaccinated with pCEsa1 exhibited significantly increased survival rates following E. tarda challenge at one and two months p.v.. Immunological analysis showed that vaccination with pCEsa1 (i) enhanced the respiratory burst activity, acid phosphatase activity, and bactericidal activity of head kidney macrophages; (ii) increased serum bactericidal activity in a Ca2þ-independent manner; (iii) induced the production of specific serum antibodies, which became detectable at 3-week p.v. and afforded 57% protection (in terms of relative percent survival) upon naïve fish as determined by passive immunization; (iv) upregulated the expression of a broad spectrum of genes possibly involved in both innate and adaptive immunity. These results indicate that pCEsa1 is an effective vaccine candidate against E. tarda and also provide insights to the immune mechanism of bacterial DNA vaccine. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: DNA vaccine Edwardsiella tarda Immune genes Macrophage activation Passive immunization
1. Introduction DNA vaccines are genetic vaccines in which the antigenic genes are carried on and expressed from circular DNA plasmids. In addition to the coding sequence of the antigen, the plasmid also contains other elements that are essential to a DNA vaccine: (i) a prokaryotic replication origin and an antibiotic resistance marker that enable the plasmid to be amplified in a bacterial host under selective conditions; (ii) an eukaryotic promoter and a polyadenylation sequence that ensure the expression of the antigen in the target animal. Following vaccination, the plasmid DNA is taken up by the host cells, where the antigenic protein is expressed and induces immune responses [1]. In aquaculture, extensive studies on DNA vaccines have been carried out, most of which, however, are
* Corresponding author. Tel./fax: þ86 532 82898829. E-mail address: [email protected] (L. Sun). 1050-4648/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2010.10.020
directed against viruses [2,3]. Only in recent years have DNA vaccines aimed at fish pathogens of bacterial nature been reported [4e9]. Compared to viral DNA vaccines, bacterial DNA vaccines are much less studied with respect to the immunological mechanisms of protection. Edwardsiella tarda is a Gram-negative bacterium that has been reckoned a serious fish pathogen on the account of its ability to infect many important fish species cultured worldwide, including eel, carp, tilapia, Japanese flounder, turbot, channel catfish, and trout [10e12]. Fish infected by E. tarda develop a systematic disease called edwardsiellosis, which often leads to heavy mortality under stress conditions and thus causes severe economic losses [13,14]. In addition to fish, E. tarda can also infect humans and has been associated with diseases such as gastroenteritis, septicemia, and meningitis [15,16]. With the serious impact of E. tarda on fish cultures, vaccine development against this pathogen has become an urgent need. In recent years, a number of candidate E. tarda vaccines have been
274
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
reported, some of which (a bacterin, an E. tarda ghost, and a bacterium-delivered recombinant subunit vaccine) provide protections to the extents of more than 90% (in terms of relative percent survival) at laboratory trials [17e20]. Since E. tarda is known to be an intracellular pathogen, we have in a previous study examined the immunoprotective potential of an E. tarda DNA vaccine based on a weak immunogen [9]. In the present report, we further explored the potential of DNA vaccine in the control of edwardsiellosis with an emphasis on the immune response elicited by the vaccine. 2. Materials and methods
liver, kidney, and spleen as described previously [21]. Relative percent of survival (RPS) was calculated according to the following formula: RPS ¼ {1 (% mortality in vaccinated fish/% mortality in control fish)} 100 [24]. All vaccination trials were repeated once, and the mean mortality and RPS were given in the results. 2.5. PCR detection of plasmid DNA in vaccinated fish Muscle, kidney, spleen, and liver were taken from the vaccinated fish at different times p.v.. DNA was extracted from the tissues with the TIANamp DNA Kit (Tiangen, Beijing, China) and used for PCR analysis with primers RTF1 (50 - TGCGCAGCTACTATCTGGAT -30 ) and SAR3 (50 - CGGTGATGTTGATGGTGATGT -30 ).
2.1. Bacterial strain and growth condition E. tarda TX1 is a fish pathogen that has been reported previously [21]. It was cultured in Luria-Bertani broth (LB) medium [22] at 28 C. 2.2. Plasmid construction and preparation To construct pCEsa1, esa1 was amplified by PCR with SAF7 (50 GATATCACCACCATGGCAGATGGTTTCGTAGT -30 ; underlined, EcoRV site) and SAR10 (50 e GCGCGATATCCCAGGTTTTACCGATATTA -30 ; underlined, EcoRV site). The PCR products were ligated to the TA cloning vector pBS-T (Tiangen, Beijing, China). The recombinant plasmid was digested with EcoRV, and the esa1-containing fragment was retrieved and inserted into pCN3 [9] at the SmaI site, resulting in pCEsa1. Endotoxin-free plasmid DNA was prepared using EndoFree plasmid Kit (Tiangen, Beijing, China). The purity of the purified DNA was analyzed spectrophotometrically by measuring absorbance at A260/280 and A260/230. The integrity of the plasmid DNA was assessed by agarose gel electrophoresis. 2.3. Fish Japanese flounder (Paralichthys olivaceus) were purchased from a local fish farm (Haiyang, Qingdao, China) and acclimatized in the laboratory for two weeks before experimental manipulation. Fish were fed daily with commercial dry pellets and maintained at w22 C in aerated seawater that was changed twice daily. Before experiments, fish were randomly sampled for the examination of bacterial recovery from blood, liver, kidney, and spleen. Fish were used for experiment only when no bacteria could be detected from any of the examined tissues of the sampled fish. Fish were anaesthetized with tricaine methanesulfonate (Sigma, St. Louis, MO, USA) before blood collection. Sacrifice was performed by administration into the fish an overdose of tricaine methanesulfonate as described previously [23]. 2.4. Vaccination pCEsa1 and pCN3 were diluted in PBS to 250 mg/ml. Japanese flounder (w9.3 g) were divided randomly into three groups (120 fish/group) and injected intramuscularly (i.m.) with 100 ml of pCEsa1, pCN3, or PBS. From each group, 40 fish were used for PCR and RT-PCR analysis of the presence of pCEsa1 and the transcription of esa1 in fish tissues (see below sections), 24 fish were used for ELISA analysis, and 56 fish were challenged with E. tarda TX1 at one- and two-month post-vaccination (p.v.). After challenge, three fish from each group were used for qRT-PCR analysis at 24 h postchallenge (see below section), while the remaining fish were monitored for mortality over a period of 20 days, with dying fish randomly selected for the examination of bacterial recovery from
2.6. Reverse transcriptase-PCR (RT-PCR) analysis of the expression of DNA vaccines To examine esa1 expression in the vaccinated fish, tissues were taken from the fish as described above at different times p.v. and used for total RNA extraction with RNAprep Tissue Kit (Tiangen, Beijing, China). One microgram of total RNA was used for cDNA synthesis with Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). RT-PCR was carried out as described previously [9] using b-actin RNA as an internal control. 2.7. Quantitative real time reverse transcriptase-PCR (qRT-PCR) analysis of the expression of immune genes Japanese flounder were vaccinated with pCEsa1 and challenged with TX1 as described above. Spleen was taken from the fish at 24 h post-challenge. Total RNA extraction and cDNA synthesis were as described above. qRT-PCR was carried out in an ABI 7300 Real-time Detection System (Applied Biosystems, Foster City, CA, USA) using SYBR ExScript qRT-PCR Kit (Takara, Dalian, China) as described previously [25]. Each assay was performed in triplicate with b-actin RNA as the control. The primers used for qRT-PCR of b-actin and the immune genes have been reported previously [26]. All data are given in terms of relative mRNA, expressed as means plus or minus standard errors of the means (SE). 2.8. Immunohistochemistry and histopathology Immunohistochemistry and histopathology were performed as described previously [9]. Briefly, muscle tissues were taken from vaccinated fish as described above at 7 days p.v.. The tissue samples were fixed first with glutaraldehyde and then with osmium tetroxide. Fixed tissues were dehydrated in ethanol and embedded in Epon resin. Ultrathin sections (60e80 nm) were generated with a Leica Ultracut E micotome (Reichert, Austria). The sections were labeled first with mouse anti-His monoclonal antibody (Tiangen, Beijing, China) and then with gold-labeled goat anti-mouse IgG (Bios, Beijing, China). After staining with uranyl acetate and lead citrate, the sections were observed with a transmission electron microscope (GEM-1200, GEOL, Japan). 2.9. Effect of pCEsa1 vaccination on macrophage activation 2.9.1. Preparation of head kidney (HK) macrophages Japanese flounder (w27 g) were vaccinated with pCEsa1 (40 mg/fish), pCN3 (40 mg/fish), or PBS as described above with an injection volume of 100 ml/fish. The fish were sacrificed at 48 h p.v.. HK macrophages were prepared based on the method of Chung and Secombes [27]. In brief, HK was removed, washed three times with PBS, and passed through a sterile metal mesh. The cells were resuspended in L-15 medium (Thermo Scientific
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
HyClone, Beijing, China) and placed onto a 34/51% Percoll (Solarbio, Beijing, China) gradient, followed by centrifugation at 400g for 30 min. After centrifugation, the cells at the 34/51% interface were recovered, washed twice and resuspended in L-15 medium -containing 10% calf serum (Thermo Scientific HyClone, Beijing, China), 1% penicillin and streptomycin (Sangon, Shanghai, China), and 20 U/ml heparin (Sigma, St. Louis, MO, USA). The cells were added to 96-well microplates (w2 105 cells/well) and incubated at 25 C for 2 h. Non-adherent cells were washed off after the incubation. 2.9.2. Respiratory burst activity Respiratory burst activity was determined as reported previously [28]. In brief, 100 ml of 1 mg/ml nitroblue tetrazolium (Sangon, Shanghai, China) in L-15 was added to 2 105 of macrophages in a 96-well microplate. After incubation at 25 C for 2 h, the reaction was stopped by adding 100% methanol. The plate was washed with 70% methanol, and the reduced formazan was solubilized in 100 ml of 2 M KOH and 120 ml of DMSO. The plate was read at 630 nm with a microplate reader. 2.9.3. Acid phosphatase (AP) assay AP assay was performed as reported previously [28]. Briefly, HK macrophages prepared above in a microplate plate were washed three times with PBS. The cells were lysed by adding 50 ml of 0.1% Triton X-100 to each well and incubated first at 4 C for 30 min and then at 37 C for 30 min. After incubation, 150 ml of 12 mM p-nitrophenyl phosphate (Sigma, St. Louis, MO, USA) in 0.2 M acetate (pH 5.0) was added to each well, and the plate was incubated at 27 C for 3 h. After incubation, 50 ml of ice-cold 0.01 M EDTA prepared in 0.1 M NaOH was added to each well, and the plate was read immediately at 410 nm. 2.9.4. Bactericidal activity Bactericidal activity was determined based on the method of Graham et al. [29]. Briefly, TX1 was cultured in LB medium to midlogarithmic phase, washed, and resuspended in PBS to 104 CFU/ml. HK macrophages prepared above in a microplate (105 cells/well) were washed with PBS and mixed with TX1 (100 ml/well). The plate was incubated at 25 C for 0 h (control) or 5 h, and the cells were lysed by adding 50 ml of 0.2% Tween 20 to each well. LB was added to the plate (100 ml/well), and the plate was incubated at 25 C for overnight. Ten microliters of 5 mg/ml MTT {3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di- phenytetrazoliumromide} (Sangon, Shanghai, China) was added to the plate. The plate was incubated at 25 C for 20 min, and absorbance at 570 nm was determined. Bactericidal activity was defined as follows: 100 {1 (A570 of 5 h incubation/ A570 of 0 h incubation)}. 2.10. Serum bactericidal activity Serum survival analysis was performed as described previously [23]. Briefly, TX1 was cultured in LB medium to mid-logarithmic phase and resuspended in Hank’s balanced salt solution (Gibco, Invitrogen Corp., Carlsbad, CA, USA). Japanese flounder serum was treated with or without heating at 56 C for 30 min. Approximately 105 bacterial cells were mixed with 50 ml of treated and untreated flounder serum in the presence or absence of 0.05 M EGTA [ethyleneglycol-bis(3-aminoethyl ether)-N,N-tetraacetic acid]. After incubation with mild agitation at 30 C for 60 min, the mixture was serially diluted and plated in triplicate on LB agar plates. The plates were incubated at 28 C for 48 h. The colonies that appeared on the plates were enumerated. Survival rate in the untreated serum was expressed as a percentage of the survival rate in the heat-treated serum.
275
2.11. Enzyme-linked immunosorbent assay (ELISA) Sera were collected from vaccinated fish (four at each time point) at different times p.v. and diluted 20-fold in PBS. ELISA was performed as described previously [9]. Briefly, 96-well ELISA plates (Sangon, Shanghai, China) were coated with 0.05% (w/v) poly-Llysine in coating buffer (0.159% Na2CO3, 0.293% NaHCO3, pH 9.6) for 1 h, followed by washing the plates 3 with coating buffer. The plates were then coated with 100 ml/well purified recombinant Esa1 and incubated at 4 C for overnight. The plates were washed 3 with coating buffer and coated with 1% bovine serum album (BSA) at 22 C for 2 h, followed by washing 3 with PBST (0.1% Tween-20 in PBS). Diluted sera were added in triplicate to the wells of the plates. After incubation at 37 C for 2 h and washing with PBST, mouse anti-turbot IgM monoclonal antibody (Aquatic Diagnostic Ltd, Stirling, Scotland, UK) was added to the plates. The plates were incubated and washed as above. Horse-radish peroxidaseconjugated goat anti-mouse IgG (Bios, Beijing, China) was added to the plates. Color development was performed with the TMB Kit (Bios, Beijing, China). The plates were read at 450 nm with a Precision microplate reader (Molecular Devices, Toronto, Canada). 2.12. Passive immunization Passive immunization assay was performed according to the method of Pasnik et al. [30]. Briefly, two groups (10 fish/group) of Japanese flounder (w4.7 g) were administered i.p. with 100 ml of serum from pCEsa1- or pCN3-vaccinated fish. At 20 h post-immunization, fish were challenged with TX1 and monitored for mortality as described above. 2.13. Statistical analysis All statistical analyses were performed using SPSS 15.0 package (SPSS Inc., Chicago, IL, USA). Differences in antibody and transcription levels were analyzed with one-way analysis of variance (ANOVA). In all cases, the significance level was defined as P < 0.05. 3. Results 3.1. Immunoprotective effect of pCEsa1 3.1.1. Expression of Esa1 in fish tissues following vaccination In a previous study, we have identified from a pathogenic E. tarda strain a D15-like surface antigen, Esa1, and found that purified recombinant Esa1 induces protective immunity in Japanese flounder [31]. To examine the potential of Esa1 as a DNA vaccine, we in this study constructed an esa1based DNA vaccine plasmid, pCEsa1, which expresses esa1 from the human cytomegalovirus immediate-early promoter. Japanese flounder were vaccinated with pCEsa1, pCN3 (the control vector), and PBS, respectively. PCR and RT-PCR analyses showed that both plasmid DNA and esa1 transcripts were detected in muscle, liver, spleen, and kidney of pCEsa1-vaccinated fish at 7, 21, and 49 days p.v.. In contrast, no esa1 transcription was detected in pCN3- or PBS-vaccinated fish (Fig. 1 and data not shown). To examine whether Esa1 protein was synthesized in the vaccinated fish, immunohistochemistry analysis was performed, which showed that production of Esa1 protein was detected in the muscle tissue of pCEsa1-vaccinated fish, but not in that of pCN3-vaccinated fish (Fig. 2). 3.1.2. Protection by pCEsa1 against E. tarda challenge At one-month p.v., the vaccinated fish were challenged with E. tarda TX1 and monitored for cumulative mortality. The results showed that the accumulated mortalities of pCEsa1-, pCN3-, and
276
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
Furthermore, the presence of EGTA, a Ca2þ chelator, had no apparent effect on the serum bactericidal activity of pCEsa1vaccinated fish.
Fig. 1. PCR detection of pCEsa1 (A) and RT-PCR detection of esa1 transcription (B and C) in vaccinated fish. Japanese flounder were vaccinated with pCEsa1 (lanes 3, 5, 7, and 9) or pCN3 (lanes 2, 4, 6, and 8). At 7 days post-vaccination, DNA and RNA were extracted from muscle (lanes 2 and 3), liver (lanes 4 and 5), spleen (lanes 6 and 7), and kidney (lanes 8 and 9) and used for PCR and RT-PCR analysis, respectively. PCR was performed using primers specific to pCEsa1. RT-PCR was performed using primers specific to Esa1 (B) or b-actin (C) (as an internal control). Lane 1, DNA markers.
PBS-vaccinated fish were 20%, 76%, and 80%, respectively (Supplemental data Fig. 1). Hence, compared to PBS-vaccinated fish, pCEsa1-vaccinated fish were significantly (P < 0.05) protected, with a RPS of 75%. To examine the duration of protection, the vaccinated fish were challenged with TX1 at two-month p.v., and the results showed that the accumulated mortality of pCEsa1-vaccinated fish (24%) was significantly (P < 0.05) lower than those of pCN3- and PBS-vaccinated fish (88%, and 84%, respectively) (Supplemental data Fig. 1). The RPS of pCEsa1-vaccinated fish was 71% compared to PBS-vaccinated fish. Bacteriological analysis showed that TX1 was the only type of bacterial strain that was re-isolated from moribund fish. Histopathological examination revealed granuloma-like structures in the spleen of all the survival fish that that had been vaccinated with pCN3 or PBS but in none of the survival fish that had been vaccinated with pCEsa1. 3.2. Immune response induced by pCEsa1 3.2.1. Macrophage activation Macrophage activation analysis showed that, compared to macrophages from control fish, macrophages from pCEsa1-vaccinated fish exhibited significantly enhanced respiratory burst activity (P < 0.01), AP activity (P < 0.01), and bactericidal activity (P < 0.05) (Fig. 3). 3.2.2. Serum bactericidal activity Serum bactericidal activity analysis showed that the serum of pCEsa1-vaccinated fish exhibited significantly (P < 0.05) stronger bactericidal activity than the serum of the control fish (Fig. 4).
3.2.3. Serum antibody response and its significance to immunoprotection ELISA analysis showed that in fish vaccinated with pCEsa1, Esa1specific serum antibodies became detectable at 3-week p.v., reached maximum at 4-week p.v., and lasted until at least 7-week p.v. (Fig. 5). No specific serum antibody production was detected in fish vaccinated with pCN3. The potential contribution of serum antibodies to the protection elicited by pCEsa1 was determined by passive immunization, which showed that the cumulative mortalities of the fish immunized with sera from pCEsa1- and pCN3-vaccinated fish were 30% and 70%, respectively. Hence, the immunoprotective efficacy, in terms of RPS, of the serum from pCEsa1-vaccinated fish was 57%. 3.2.4. Expression of immune-related genes To examine the effect of pCEsa1 on the expression of immunerelated genes, qRT-PCR was carried out to determine the transcription of the genes encoding immunoglobulin M (IgM) and D (IgD), major histocompatibility complex (MHC) class Ia and class IIa, CD8a, CD40, complement C3, interleukin 1b(IL-1b), interleukin 6 (IL-6), IFN-g, tumor necrosis factor-alpha (TNF-a), interferon (IFN), interferon-induced Mx protein (Mx), and NK cell enhancing factor (NKEF). The results showed that compared to vaccination with pCN3, vaccination with pCEsa1 significantly (P < 0.01 or P < 0.05) upregulated the expression of all the examined genes except that encoding IgD (Fig. 6). 4. Discussion In this report, we described the construction and analysis of the immune effect of an E. tarda DNA vaccine, pCEsa1, based on the D15-like surface antigen Esa1 derived from a pathogenic E. tarda strain. Previous studies of virus DNA vaccines in rainbow trout, Atlantic salmon, and Atlantic cod models have indicated that, following i.m. injection, DNA vaccine plasmids were detected at the injection site as well as in kidney, spleen, and gills long after administration [32e34]. Similarly, in our study, we found that pCEsa1 and esa1 transcription were detected in muscle, liver, spleen, and kidney of the vaccinated fish until at least 49 days p.v., suggesting that upon vaccination, some pCEsa1 entered myocytes while others were transported away from muscle to other tissues where the plasmid DNA was taken up by the respective tissue cells, in which, as in myocytes, esa1 expression took place. We do not
Fig. 2. Production of Esa1 in the muscle tissue of pCEsa1-vaccinated fish. Muscle tissues were taken from Japanese flounder vaccinated with pCN3 (A) and pCEsa1 (B) at 7 days postvaccination and used for immunohistochemistry with gold-labeled antibodies. Arrows indicate gold particles. Bar ¼ 100 nm.
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
277
Fig. 3. Effect of pCEsa1 vaccination on macrophage activation. Japanese flounder were vaccinated with pCEsa1 or pCN3 (control), and head kidney macrophages were collected and used for the analysis of respiratory burst activity (A), acid phosphatase activity (B), and bactericidal activity (C). Data are presented as means SE (N ¼ 3). *P < 0.05; **P < 0.01.
know whether injection volume has any effect on the dissemination of the vaccine plasmid; it would be interesting to examine whether the same amount of vaccine administered at different volumes would have different dissemination results. Taken together, the wide distribution and persistence of pCEsa1 in the vaccinated fish observed in our study are likely to account at least in part for the relatively high level and lasting protection of pCEsa1. Of the few studies concerning DNA vaccines against bacterial pathogens, it is known that in fish vaccinated with an Aeromonas veronii DNA vaccine, specific serum antibodies were detected at 4and 6-week p.v., while in fish vaccinated with DNA vaccines against Mycobacterium marinum and Vibrio anguillarum, serum antibodies were detected at as early as 2-week p.v. and lasted until 5-week p.v. [4,5,7,8]. In the case of pCEsa1, we found that specific serum antibodies began to occur at 3-week p.v., reached maximum at 4-week p.v., and lasted until 7-week p.v.. Since passive immunization showed that naïve Japanese flounder immunized with the serum from pCEsa1-vaccinated fish exhibited a RPS of 57%, it is likely that antibody-mediated immune response plays an important part in pCEsa1-induced protective immunity. On the other hand, since the RPS of passive immunization is much lower than that of pCEsa1,
pCEsa1 must have elicited immune responses other than that mediated by antibodies. DNA vaccines are known to elicit both innate and adaptive immunity. Byon et al. [35] have reported that Japanese flounder vaccinated with a DNA vaccine expressing the glycoprotein gene of viral hemorrhagic septicemia virus exhibited increased expression of the immune factors involved in nonspecific and specific responses. Similar observations have been made by other research groups in the studies of DNA vaccines against fish viruses [36e38]. However, no kindred studies have been documented for bacterial DNA vaccines against fish pathogens except our previous report on the study of the E. tarda DNA vaccine pCE6, which was found to induce humoral and cellular immunity, due in part to the immunopotentiating effect of a molecular adjuvant [9]. In this study, we observed that vaccination with pCEsa1 enhanced macrophage respiratory burst activity and bactericidal activity and increased serum bactericidal activity in a Ca2þ-independent manner, suggesting that pCEsa1 activated macrophages and the complement system, the latter probably via the alternative complement activation pathway. Although the macrophage activation study was conducted with fish of larger size (for the convenience of macrophage collection), similar immunological response may be expected in the smaller fish used in the vaccination trials. In line with the observation that pCEsa1-vaccinated fish produced specific serum
Fig. 4. Effect of pCEsa1 vaccination on serum bactericidal activity. Japanese flounder were vaccinated with pCEsa1 and pCN3 (control), respectively. Sera were collected from the fish and used to determine bactericidal activity in the absence or presence of EGTA. Data are presented as means SE (N ¼ 3). *P < 0.05.
Fig. 5. Serum antibody production in pCEsa1-vaccinated fish. Japanese flounder were vaccinated with pCEsa1 and PBS (control), respectively. Sera were collected from the fish at 2e7 weeks post-vaccination, and serum antibodies against Esa1 were determined by ELISA. Data are presented as means SE (N ¼ 4). *P < 0.05; **P < 0.01.
278
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279
Fig. 6. qRT-PCR analysis of the expression of immune genes in pCEsa1-vaccinated fish. Japanese flounder were vaccinated with pCEsa1 or pCN3 and challenged with TX1. Total RNA was extracted from spleen at 24 h post-challenge and used for qRT-PCR. For each gene, the mRNA level of the fish vaccinated with pCN3 was set as 1. Data are presented as means SE (N ¼ 3). *P < 0.05; **P < 0.01.
antibodies, expression of the IgM gene was significantly induced by pCEsa1 vaccination. In contrast, IgD expression was unaffected by pCEsa1. The function of IgD in fish is essentially unknown; in humans and mouse, IgD is an antigen receptor found on the surface of B cells and is down-regulated upon antigen encounter, however, the signaling mechanism of IgD is unclear [39]. The observation that IgD expression levels were comparable in pCEsa1-vaccinated fish and control fish suggests that IgD is not a key factor in pCEsa1induced immunity. In addition to IgM, the expressions of a number of other immune relevant genes, particularly those encoding C3, Mx, IFN, MHC IIa, MHC Ia, TNF-a, IL-1b, NKEF, CD40, and CD8a, were also upregulated by pCEsa1 to significant extents. These results suggest that pCEsa1 is likely to induce B cell immunity, innate humoral and cellular response, and possibly specific cellular immune response. In summary, the results of this study demonstrate that pCEsa1 is an effective DNA vaccine that can protect Japanese flounder against lethal E. tarda challenge. The immunoprotective effect of pCEsa1 is probably the result of its ability to activate macrophages and the complement system and to induce the expression of a wide spectrum of genes that are possibly associated with specific and nonspecific immunity. Acknowledgements This work was supported by the grants from the Ministry of Science and Technology (2008AA092501) and the National Natural Science Foundation of China grant 31025030. Appendix. Supplementary data Supplementary data associated with this article can be found in the online version, at doi:10.1016/j.fsi.2010.10.020. References [1] Tonheim TC, Bogwald J, Dalmo RA. What happens to the DNA vaccine in fish? A review of current knowledge. Fish Shellfish Immunol 2008;25:1e18. [2] Heppell J, Davis HL. Application of DNA vaccine technology to aquaculture. Adv Drug Deliv Rev 2000;43:29e43. [3] Lorenzen N, Lorenzen E, Einer-Jensen K, LaPatra SE. DNA vaccines as a tool for analysing the protective immune response against rhabdoviruses in rainbow trout. Fish Shellfish Immunol 2002;12:439e53. [4] Kumar SR, Parameswaran V, Ahmed VP, Musthaq SS, Hameed AS. Protective efficiency of DNA vaccination in Asian seabass (Lates calcarifer) against Vibrio anguillarum. Fish Shellfish Immunol 2007;23:316e26.
[5] Pasnik DJ, Smith SA. Immunogenic and protective effects of a DNA vaccine for Mycobacterium marinum in fish. Vet Immunol Immunopathol 2005;103: 195e206. [6] Pasnik DJ, Smith SA. Immune and histopathologic responses of DNA-vaccinated hybrid striped bass Morone saxatilis M. chrysops after acute Mycobacterium marinum infection. Dis Aquat Org 2006;73:33e41. [7] Vazquez-Juarez RC, Gomez-Chiarri M, Barrera-Saldana H, HernandezSaavedra N, Dumas S, Ascencio F. Evaluation of DNA vaccination of spotted sand bass (Paralabrax maculatofasciatus) with two major outer-membrane protein-encoding genes from Aeromonas veronii. Fish Shellfish Immunol 2005;19:153e63. [8] Yang H, Chen J, Yang G, Zhang XH, Liu R, Xue X. Protection of Japanese flounder (Paralichthys olivaceus) against Vibrio anguillarum with a DNA vaccine containing the mutated zinc-metalloprotease gene. Vaccine 2009;27: 2150e5. [9] Jiao XD, Zhang M, Hu YH, Sun L. Construction and evaluation of DNA vaccines encoding Edwardsiella tarda antigens. Vaccine 2009;27:5195e202. [10] Matsuyama T, Kamaishi T, Ooseko N, Kurohara K, Iida T. Pathogenicity of motile and non-motile Edwardsiella tarda to some marine fish. Fish Pathol 2005;40:133e5. [11] Swain P, Behura A, Dash S, Nayak SK. Serum antibody response of Indian major carp, Labeo rohita to three species of pathogenic bacteria. Aeromonas hydrophila, Edwardsiella tarda and Pseudomonas fluorescens. Vet Immunol Immunopathol 2007;117:137e41. [12] Thune RL, Stanley LA, Cooper RK. Pathogenesis of gram negative bacterial infections in warm water fish. Annu Rev Fish Dis 1991;3:37e68. [13] Castro N, Toranzo AE, Barja JL, Nunez S, Magarinos B. Characterization of Edwardsiella tarda strains isolated from turbot, Psetta maxima (L). J Fish Dis 2006;29:541e7. [14] Yang CZ, Wang XH, Huang J. Identification and phylogenetic analysis of pathogen- Edwardsiella tarda from cultured turbot (Scophthalmus maximus). J Shanghai Fish Univ 2008;17:280e4. [15] Nelson JJ, Nelson CA, Carter JE. Extraintestinal manifestations of Edwardsiella tarda infection: a 10-year retrospective review. J La State Med Soc 2009;161:103e6. [16] Slaven EM, Lopez FA, Hart SM, Sanders CV. Myonecrosis caused by Edwardsiella tarda: a case report and case series of extraintestinal E. tarda infections. Clin Infect Dis 2001;32:1430e3. [17] Castro N, Toranzo AE, Nunez S, Magarinos B. Development of an effective Edwardsiella tarda vaccine for cultured turbot (Scophthalmus maximus). Fish Shellfish Immunol 2008;25:208e12. [18] Kwon SR, Nam YK, Kim SK, Kim KH. Protection of tilapia (Oreochromis mosambicus) from edwardsiellosis by vaccination with Edwardsiella tarda ghosts. Fish Shellfish Immunol 2006;20:621e6. [19] Lee DJ, Kwon SR, Zenke K, Lee EH, Nam YK, Kim SK, et al. Generation of safety enhanced Edwardsiella tarda ghost vaccine. Dis Aquat Org 2008;81:249e54. [20] Jiao X, Dang W, Hu Y, Sun L. Identification and immunoprotective analysis of an in vivo-induced Edwardsiella tarda antigen. Fish Shellfish Immunol 2009; 27:633e8. [21] Zhang M, Sun K, Sun L. Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain. Microbiology 2008;154: 2060e9. [22] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press; 1989. [23] Wang H, Hu Y, Zhang W, Sun L. Construction of an attenuated Pseudomonas fluorescens strain and evaluation of its potential as a cross-protective vaccine. Vaccine 2009;27:4047e55. [24] Amend DF. Potency testing of fish vaccinesInternational symposium on fish biologics: serodiagnostics and vaccines. Dev Biol Stand 1981;49:447e54. [25] Zhang W, Sun K, Cheng S, Sun L. Characterization of DegQVh, a Serine Protease and a protective immunogen from a pathogenic Vibrio harveyi strain. Appl Environ Microbiol 2008;74:6254e62. [26] Jiao X, Cheng S, Hu Y, Sun L. Comparative study of the effects of aluminum adjuvants and Freund’s incomplete adjuvant on the immune response to an Edwardsiella tarda major antigen. Vaccine 2010;28:1832e7. [27] Chung S, Secombes CJ. Activation of rainbow trout macrophages. J Fish Biol 1987;31:51e6. [28] Chung S, Secombes CJ. Analysis of events occurring with teleost macrophages during the respiratory burst. Comp Biochem Physiol 1988;89B:539e44. [29] Graham S, Jeffries AH, Secombes CJ. A novel assay to detect macrophage bactericidal activity in fish: factors influencing the killing of Aeromonas salmonicida. J Fish Dis 1988;11:389e96. [30] Pasnik DJ, Evans JJ, Klesius PH. Passive immunization of Nile tilapia (Oreochromis niloticus) provides significant protection against Streptococcus agalactiae. Fish Shellfish Immunol 2006;21:365e71. [31] Sun Y, Liu C, Sun L. Identification of an Edwardsiella tarda surface antigen and analysis of its immunoprotective potential as a purified recombinant subunit vaccine and a surface-anchored subunit vaccine expressed by a fish commensal strain. Vaccine, in press. [32] Boudinot P, Blanco M, de Kinkelin P, Benmansour A. Combined DNA immunization with the glycoprotein gene of viral hemorrhagic septicemia virus and infectious hematopoietic necrosis virus induces double-specific protective immunity and nonspecific response in rainbow trout. Virology 1998;249: 297e306. [33] Tonheim TC, Dalmo RA, Bogwald J, Seternes T. Specific uptake of plasmid DNA without reporter gene expression in Atlantic salmon (Salmo salar L.)
Y. Sun et al. / Fish & Shellfish Immunology 30 (2011) 273e279 kidney after intramuscular administration. Fish Shellfish Immunol 2008;24: 90e101. [34] Seternes T, Tonheim TC, Løvoll M, Bøgwald J, Dalmo RA. Specific endocytosis and degradation of naked DNA in the endocardial cells of cod (Gadus morhua L.). J Exp Biol 2007;210:2091e103. [35] Byon JY, Ohira T, Hirono I, Aoki T. Use of a cDNA microarray to study immunity against viral hemorrhagic septicemia (VHS) in Japanese flounder (Paralichthys olivaceus) following DNA vaccination. Fish Shellfish Immunol 2005;18:135e47. [36] Cuesta A, Tafalla C. Transcription of immune genes upon challenge with viral hemorrhagic septicemia virus (VHSV) in DNA vaccinated rainbow trout (Oncorhynchus mykiss). Vaccine 2009;27:280e9.
279
[37] Purcell MK, Nichols KM, Winton JR, Kurath G, Thorgaard GH, Wheeler P, et al. Comprehensive gene expression profiling following DNA vaccination of rainbow trout against infectious hematopoietic necrosis virus. Mol Immunol 2006;43:2089e106. [38] Utke K, Kock H, Schuetze H, Bergmann SM, Lorenzen N, Einer-Jensen K, et al. Combined DNA immunization with the glycoprotein gene of viral hemorrhagic septicemia virus and infectious hematopoietic necrosis virus induces double-specific protective immunity and nonspecific response in rainbow trout. Dev Comp Immunol 2008;32:239e52. [39] Chen K, Cerutti A. New insights into the enigma of immunoglobulin D. Immunol Rev 2010;237:160e79.