Construction and evaluation of pMycoFos, a fosmid shuttle vector for Mycobacterium spp. with inducible gene expression and copy number control

Journal of Microbiological Methods 86 (2011) 320–326

Contents lists available at ScienceDirect

Journal of Microbiological Methods j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j m i c m e t h

Construction and evaluation of pMycoFos, a fosmid shuttle vector for Mycobacterium spp. with inducible gene expression and copy number control Mai Anh Ly, Elissa F. Liew, Nga B. Le, Nicholas V. Coleman ⁎ School of Molecular Bioscience, Building G08, University of Sydney, NSW 2006, Australia

a r t i c l e

i n f o

Article history: Received 1 April 2011 Received in revised form 1 June 2011 Accepted 5 June 2011 Available online 13 June 2011 Keywords: Mycobacterium Fosmid Cloning vector Gene expression

a b s t r a c t Molecular tools for Gram-positive bacteria such as Mycobacterium are less well-developed than those for Gram-negatives such as Escherichiacoli. This has slowed the molecular-genetic characterisation of Mycobacterium spp, which is unfortunate, since this genus has high medical, environmental and industrial significance. Here, we developed a new Mycobacterium shuttle vector (pMycoFos, 12.5 kb, Km R) which combines desirable features of several previous vectors (controllable copy number in E. coli, inducible gene expression in Mycobacterium) and provides a new multiple cloning site compatible with large inserts of high-GC content DNA. Copy number control in E. coli was confirmed by the increased Km R of cultures after arabinose induction and the greater DNA yield of vector from arabinose-induced cultures. Measurement of beta-galactosidase activity in pMycoFos clones carrying the lacZ gene showed that in Mycobacterium smegmatis mc 2-155, expression was inducible by acetamide, but in E. coli EPI300, the expression level was primarily determined by the vector copy number. Examination of protein profiles on SDS–PAGE gels confirmed the beta-galactosidase assay results. Construction of a fosmid library with the new vector confirmed that it could carry large DNA inserts. The new vector enabled the stable cloning and expression of an ethene monooxygenase gene cluster, which had eluded previous attempts at heterologous expression. © 2011 Elsevier B.V. All rights reserved.

1. Introduction The genus Mycobacterium has clinical, environmental and industrial importance. Most research has focussed on species that are dedicated human pathogens, such as Mycobacterium tuberculosis and Mycobacterium leprae (Hussain, 2007), but other members of this genus are important as opportunistic human pathogens (Behr, 2008; van Ingen et al., 2009), animal pathogens (Tobin and Ramakrishnan, 2008), vaccine strains (Xu et al., 2009; Bastos et al., 2009), agents of bioremediation (Coleman et al., 2002b; Hartmans and De Bont, 1992; Kim et al., 2004; Yagi et al., 1999) and biocatalysts (Habets-Crutzen et al., 1985; Snajdrova et al., 2006; van Ginkel et al., 1987). The ability to efficiently genetically manipulate mycobacteria is essential to improve our fundamental understanding of their biology and for the realisation of potential applications. However, molecular experiments in mycobacteria are difficult due to factors such as slow growth rate, clumping of cells, resistance to cell lysis, high levels of illegitimate recombination, and a lack of useful selective markers (Cirillo et al., 1991; Hinds et al., 1999). The development of genetic tools for heterologous expression and

⁎ Corresponding author. Tel.: + 61 2 9351 6047; fax: + 61 2 9351 4571. E-mail address: [email protected] (N.V. Coleman). 0167-7012/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2011.06.005

knockout experiments in mycobacteria has lagged behind that of Gram-negative bacteria such as Escherichia coli, and this has limited the ability to link mycobacterial gene sequences to specific physiological and biochemical functions. This bottleneck has become more acute since the recent explosion of genomic sequence data (21 Mycobacterium genomes have been deposited in Genbank to date; http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi). Due to differences in codon usage and other factors, mycobacterial proteins may not express correctly in E. coli, thus necessitating the development of cloning and expression vectors that replicate in mycobacteria. Most such vectors have been based on the pAL5000 plasmid of Mycobacterium fortuitum (Chen et al., 2004), including the basic cloning plasmids pMV261 (Stover et al., 1991), pSMT3 (Herrmann et al., 1996) and pNBV1 (Howard et al., 1995), the shuttle cosmid pMSC1 (Hinshelwood and Stoker, 1992), the expression vector pJAM2 (Triccas et al., 1998), the high-copy vector pSG300 (Griffin et al., 2009), the transposon delivery vector pCG63 (Guilhot et al., 1994), and the knockout construction plasmids pNUT12/pINC52 (Pashley et al., 2003). Another family of vectors based on the M. fortuitum plasmid pMF1 includes pBP10 (Bachrach et al., 2000) and pGB9.2 (Harth et al., 2004). While each of the vectors described above have specific advantages, all have limitations. One of the most serious limitations is that most vectors depend on a pUC plasmid backbone for replication in E. coli—this is a very high copy-number replicon (approximately 500 copies per cell (Chambers et al., 1988)) and can

M.A. Ly et al. / Journal of Microbiological Methods 86 (2011) 320–326

destabilise plasmids that carry repeated sequences or genes that are toxic to the bacterial host (Kim et al., 1992). Another problem with existing vectors is that they either lack specific promoters for expression of cloned DNA or their promoters are constitutively expressed (e.g. Phsp60)—the latter is another contributor to the instability of cloned DNA. Finally, most existing vectors contain a limited range of restriction sites and lack sites that are especially useful for cloning GC-rich Mycobacterium DNA, e.g. PacI (TTAAT^TAA) and SwaI (ATTT^AAAT). Our laboratory studies monooxygenase enzymes from Mycobacterium spp. and we have encountered extensive difficulties in cloning and expressing the corresponding genes using existing vectors. However, we noted that these genes could be stably maintained in E. coli at low copy number as fosmid clones. Our goal in the current study therefore was to make a new shuttle/expression vector for Mycobacterium spp. that would facilitate cloning of ‘difficult’ genes by combining the best features of existing Mycobacterium vectors (e.g. the acetamidase promoter system of pJAM2) with an enhanced multiple cloning site and a controllable copynumber E. coli fosmid replicon. 2. Materials and methods 2.1. Bacterial strains and growth conditions E . c o l i strain EPI300 (F − mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ −rpsL (Str R) nupG trfA dhfr) (Epicentre) and Mycobacterium smegmatis mc 2-155 (highly electrotransformable mutant of ATCC607 (Snapper et al., 1990)) were used as cloning hosts. E. coli P801 (Hfr (PO120), ara-41, lacY1, LAMind, xyl-7, mtlA2) was used as the source of the lacZ gene. Bacteria were routinely grown under aerobic conditions in Luria–Bertani (LB) medium (Sambrook and Russell, 2001), with kanamycin added where required (LB-Km; 50 μg/ml for E. coli, 20 μg/ml for M. smegmatis). Cultures of E. coli were grown at 37 °C while M. smegmatis was grown at 30 °C. Broth cultures were shaken at 200 rpm. For β-galactosidase assays, M. smegmatis was grown in minimal salts medium (MSM) broths (Coleman et al., 2002a,b) with 2% (w/v) succinate and 0.05% (w/v) Tween-80. Induction of high copy number of fosmid clones in EPI300 was done by addition of 0.02% (w/v) L-arabinose to the LB medium before inoculation. Induction of the acetamidase promoter in constructs was done by adding 0.2% or 2% (w/v) acetamide prior to inoculation. 2.2. Extraction, amplification, purification and manipulation of DNA Small plasmids were extracted from cultures using a standard alkaline lysis method (Sambrook and Russell, 2001), while fosmids were extracted using the FosmidMAX kit (Epicentre). Genomic DNA for use as a PCR template was extracted by bead beating (Yeates and Gillings, 1998). PCR was done in an Eppendorf Mastercycler ep S machine, using Taq polymerase (New England Biolabs) for routine experiments (e.g. screening for ligation junctions to detect successful constructs) or Phusion polymerase (Finnzymes) for long and accurate PCR for construction of the pMycoFOS vector. All PCRs were done in 25 μl volumes in the manufacturer's provided buffer, with 20 μM of dNTPs, 1 μM of each primer and approximately 50 ng of template DNA. Thermocycling using Taq polymerase was done using an initial denaturation of 94 °C for 2 min, then 35 cycles of 94 °C for 1 min, 50 °C for 30 s, and 72 °C for 1 min. Thermocycling using Phusion polymerase was done using an initial denaturation of 98 °C for 2 min, then 35 cycles of 98 °C for 10 s, 55 °C for 30 s, 72 °C for 3.5 min. PCR products were excised from 1% agarose gels made from 1× TAE buffer and purified using the Qiaquick kit (Qiagen). Restriction enzymes, T4 polymerase and T4 DNA ligase were obtained from New England Biolabs and used according to the manufacturer's instructions. The size and quality of DNA preparations were assessed by agarose gel

321

electrophoresis, using 1% agarose gels made in 0.5× TBE buffer (Sambrook and Russell, 2001), with post-staining in ethidium bromide (1 μg/ml for 30 min). 2.3. Construction of pMycoFos and pMycoFos.lacZ Plasmid pJV53 (van Kessel and Hatfull, 2007) was digested with BstBI and NheI, the ends blunted with T4 polymerase, and the plasmid backbone self-ligated with T4 ligase to yield pUS116. A 4.5 kb region of pUS116 including the acetamidase promoter region (amiCADS) and Mycobacterium replication origin oriM was amplified using primers NVC292 (CTTTTCTGCGAATCGATCTGATTCTGTGGATAAC) and NVC293 (GGTGGCGCTAGCTTAATTAAGAATTCTTACAGATGTGGACTC) (restriction sites underlined) and digested with ClaI and NheI. A 1.0 kb region of pUS116 containing the kanamycin resistance marker (aph) was amplified from pUS116 with primers NVC294 (CGGGCTAGCATTTAAATGGATCCGTGTCTCAAAATCTCTG) and NVC295 (CGCATCGATGTCAAGTCAGCGTAATGC) and digested with ClaI and NheI. A 6.9 kb region of the fosmid pCC1FOS (Epicentre) containing E. coli replication and partitioning functions was amplified using primers NVC296 (GCACATCGATTCCCGGTATCAAC) and NVC297 (CGTATCGATACGTCGTGACTGG) and digested with ClaI. The three PCR products were purified then joined in a 3way ligation. The ligation mixture was transformed by heat-shock into chemically competent EPI300 cells prepared by the rubidium chloride method (Hanahan, 1985). Kanamycin-resistant colonies were recovered, patched to new LB-Km plates, and screened for the presence of the expected ligation junctions using three different PCRs, using primers MAL29 (GGACGTTTCCGGGCCGCTAAG) with MAL30 (ACCGCACAGATGCGTAAGGAG), MAL31 (CTATGGAACTGCCTCGGTGAG) with MAL32 (CGCATAGGAATGGCGGAACG), and NW170 (AGGTGGTGACGCCTACGGTG) with NW211 (GCTCATAACACCCCTTGTATTACTG). One EPI300 clone yielding PCR products of the expected size in all ligation junction PCRs was retained for further work, and the construct in this clone was designated pMycoFos. The junction PCR products from pMycoFos were sequenced (Australian Genome Research Facility, Sydney Node), and a purified fosmid preparation was made from a culture grown in 100 ml LB-Km broth containing arabinose. The structure of pMycoFos was further confirmed by digestion with restriction enzymes (SmaI, NheI, PacI, SwaI, BamHI and EcoRI) and agarose gel electrophoresis. To make pMycoFos.lacZ, the lacZ gene was amplified from E. coli strain P801 with primers VMC13 (AACAATTTAAATAAGGAGGCAGCTATGACCATGATTACGG) and VMC14 (AATGGATTTAAATACGCGAAATACGGGCAGAC) to yield a 2.0 kb fragment that was digested with SwaI, purified, and cloned into the SwaI site of pMycoFos. Successful constructs were detected by selecting blue transformants on LB-Km agar with X-gal. A purified fosmid preparation was made from a culture grown in 100 ml LB-Km broth containing arabinose. The structure of pMycoFos.lacZ was further confirmed by performing restriction digests on the whole construct using enzymes SwaI, SmaI, StuI, and by confirming the Lac + phenotype by production of a yellow colour from ortho-nitrophenyl galactoside (ONPG). 2.4. Assessment of pMycoFos copy number by kanamycin resistance assay A 96-well microtitre plate containing 200 μl aliquots of LB broth was inoculated with an overnight LB-Km culture of EPI300 (pMycoFos) at an initial OD600 = 0.01. Kanamycin was added to each row of wells to form a concentration gradient from 0 to 1000 μg/ml. Arabinose was added to a final concentration of 0.02% (w/v) to one half of the plate, such that 4 rows of Km gradients had arabinose added and 4 did not. The microtitre plate was incubated with shaking at 37 °C and 200 rpm, then after 18 h, the OD600 values

322

M.A. Ly et al. / Journal of Microbiological Methods 86 (2011) 320–326

were measured using a Multiskan RC microtitre plate reader (Labsystems).

and repeated another three times using mc 2-155 cells carrying vector only.

2.5. Expression of β-galactosidase from pMycoFos.lacZ in E. coli and M. smegmatis

2.7. Testing fosmid library construction in E. coli and fosmid stability in Mycobacterium

E. coli EPI300 and M. smegmatis mc2-155 cultures containing either pMycoFos or pMycoFos.lacZ were grown to stationary phase in LB-Km broth (EPI300) or MSM-succinate-Tween-Km broth (mc 2-155) under a variety of different inducing conditions (with or without acetamide; with or without arabinose). The activity of β-galactosidase in cells was measured using a spectrophotometric assay with ONPG as the substrate, as described previously (Zhang and Bremer, 1995), except that for strain mc 2-155, cells were lysed by bead beating (2 cycles of 30 s at 5.5 m/s then 1 min on ice) using a FastPrep machine (Bio101) before addition to the assay. Activity was expressed as Miller units, calculated as (A420 × 1000) / (OD600 × 0.02 × reaction time (minute)). For SDS–PAGE analysis of lacZ expression (Laemmli, 1970), cells were washed and resuspended in 100 mM sodium phosphate buffer (pH 7), and lysed by sonication, using 4 cycles of 20 s on 90% power, then 30 s on ice, with a Branson sonifier 250 (Branson Ultrasonic). Approximately 150 μg protein was loaded into each lane of an SDS–PAGE gel (10% acrylamide), electrophoresed for 1.25 h at 40 mA, stained with Coomassie blue, destained with methanol-acetic acid solution and visualised on a BioRad GS-800 calibrated densitometer.

An aliquot of pMycoFos vector (1 μg) was completely digested with EcoRI (40 U, 37 °C, 2 h), dephosphorylated with Antarctic phosphatase (12.5 U, 37 °C, 1 h), and then the enzymes were heat inactivated (65 °C, 20 min). Genomic DNA (2 μg) from Nocardioides strain CF8 (kindly supplied by Luis Sayavedra-Soto, Oregon State University) was partially digested with EcoRI (4 U, 6 min, 37 °C) then immediately heat inactivated (65 °C, 20 min). The cut vector and genomic DNAs were ligated at a 3:1 vector-to-insert molar ratio (T4 DNA ligase, 20 U, overnight, 4 °C) and transformed by heat shock (42 °C, 30 s) into chemically competent EPI300 cells. Cells were recovered in LB broth (1 ml) for 1 h then plated onto LB-Km agar. Transformants were screened for the presence of inserts by PCR with primers NW170 (AGGTGGTGACGCCTACGGTG) and NW211 (GCTCATAACACCCCTTGTATTACTG) which flank the multiple cloning site—this PCR yields a 687 bp product if no insert is present and no product if a large DNA insert is present. The screening PCRs were done with Taq polymerase, as described above, with annealing at 53 °C, extension for 45 s, and using a colony picked up on a 10 μl tip as the template—the tip was dipped in and out of the master mix 5 times to dislodge sufficient cells to enable amplification. Six randomly selected recombinant clones were grown up overnight in 5 ml LB-Km with 0.02% arabinose, and fosmid DNA extracted via a standard alkaline lysis method. Recombinant fosmids (200 ng) were digested with BamHI (20 U, 37 °C, 2 h) and the restriction digest analysed by pulsed field gel electrophoresis (PFGE) on a 1% agarose gel in 1× TAE buffer containing 1 μl 10,000× GelRed dye (Biotium, USA); run settings = 1–6 s switch for 16 h at 5 V/cm with a 120° incline angle). One recombinant fosmid (referred to as clone #1) was transformed by electroporation (BioRad GenePulser; 800 Ω, 2.5 kV, 25 μFD) into 50 μl electrocompetent mc 2-155 cells (OD600, ~50; prepared by washing exponential-phase LB-grown cells 3× in ice-cold 10% glycerol). Cells were recovered in 1 ml LB+ 0.05% Tween for 4 h with shaking and plated onto LB-Km agar. Colonies appeared after 1 month incubation; a loopful of growth on this plate (approximately 20 colonies) was transferred into 2 ml TE buffer and lysed by bead-beating (FastPrep instrument; 30 s at 5.5 ms − 1). The lysate (10 μl) was transformed into EPI300 by heat shock, the cells recovered as above, and plated on LBKm. Fosmid was extracted via alkaline lysis from one KmR EPI300 transformant, digested with BamHI, and analysed by PFGE as described above.

2.6. Heterologous expression of ethene monooxygenase in pMycoFos Primers VMC8 (CTCATTTAAATCTATCCAGACGGAACG) and VMC9 (GAGCATTTAAATGGCTGTTAGTCACATTC) containing SwaI sites (underlined) were used to amplify the putative ethene monooxygenase genes etnABCD from genomic DNA of Mycobacterium chubuense strain NBB4 (Coleman et al., 2011). The PCR product was digested with SwaI, ligated into SwaI-digested, phosphatase-treated pMycoFos vector, and transformed into E. coli EPI300. Positive clones were detected by PCRscreening for the expected ligation junctions using the primer pairs NW170-VMC2 (CGTAGGAGGATTTAAATTTAGGAACCTCGGAG) and NW211-VMC12 (TCCATTTAAATGGGTGACACAGTAACCGTAC). One positive clone was retained for further work, and a large-scale (100 ml culture) arabinose-induced fosmid preparation of this clone was made, and named pETN. The junction PCRs from this fosmid clone were sequenced, and restriction digests using SwaI, EcoRI, and BamHI were done to confirm the expected structure. The pETN construct was transformed into mc 2-155, and the resultant mc 2-155(pETN) cells grown in 30 ml minimal medium broth (MSM-succinate-Tween-Km-acetamide) to an OD600 of 1.0. The cells were harvested by centrifugation, washed three times in buffer containing K2HPO4 (20 mM, pH 7.0), glucose (20 mM) and Tween-80 (0.05% v/v), resuspended in 1 ml of the same buffer to an OD600 of 10, transferred to 16 ml serum bottles, and crimp-sealed with Teflon®-faced butyl rubber stoppers. Either 2 μmol cisdichloroethene (from 2.5 mM aqueous stock solution) or 40 μmol ethene (as 1 ml of neat gas) were added, and the bottles incubated at 30 °C with shaking at 200 rpm either for 7 h (ethene) or 24 h (dichloroethene). Cell suspensions with ethene also contained an upright open 2 ml autosampler vial containing 1 ml of 4-(4nitrobenzyl)pyridine reagent (100 mM in ethylene glycol) to trap the epoxide product (Guengerich et al., 1979)—upon termination of the ethene assay, the NBP reagent was removed, heated at 80 °C for 1 h, then mixed with 1 ml triethylamine/acetone solution (1:1), and the absorbance read immediately at 555 nm. The absorbance was converted to micromoles of epoxide using the molar absorption coefficient 2100 M cm −1 (Morrill et al., 1981). Cell suspensions containing dichloroethene were processed via colorimetric chloride assay as described previously (Le and Coleman, 2011). All of the above assays were repeated three times in separate experiments,

3. Results 3.1. Construction of pMycoFos vector A three-way ligation was used to construct the pMycoFos vector (Fig. 1). The E. coli replication and partitioning functions and the lambda cos sites from the pCC1FOS fosmid were joined to the Mycobacterium replication functions and acetamidase promoter regulatory genes derived from pJV53, and the kanamycin resistance gene from pJV53 (the latter was amplified separately to facilitate construction of a new multiple cloning site at the junction of the two pJV53-derived fragments). Amplification and sequencing of the three ligation junctions indicated that all had the expected structure (data not shown), and the new multiple cloning site (MCS) sequence was confirmed as GAATTCTTAATTAAGCTAGCTAGCATTTAAATGGATCC (EcoRI, PacI, NheI, SwaI, BamHI). Digestion of pMycoFos with each of the enzymes in the MCS yielded single bands at 12.5 kb, confirming that all these sites were unique.

M.A. Ly et al. / Journal of Microbiological Methods 86 (2011) 320–326

Fig. 1. Map of the pMycoFos cloning vector. Features and their origins are as follows:aphA, kanamycin resistance gene (Tn5); res, resolvase (F plasmid); oriV, origin of replication (RP4 plasmid); oriS, origin of replication (F plasmid); repE, replication initiator (F plasmid); parABC, partitioning proteins (F plasmid); cos, cohesive ends site (lambda phage); loxP, recombination site for Cre recombinase (P1 phage); oriM, origin of replication (pAL5000 plasmid); amiCADS, acetamidase regulatory proteins (Mycobacterium smegmatis), P2, acetamidase promoter (M. smegmatis). The unique cloning sites EcoRI, PacI, NheI, SwaI, and BamHI are situated downstream from amiS, and controlled by P2 in response to acetamide induction. The inner circle describes the 3-way ligation used to construct the vector and indicates the source of the DNA (pCC1FOS or pUS116) and the location and type of restriction site junctions.

323

Fig. 2. Effect of arabinose induction on growth of Escherichia coli EPI300 (pMycoFos) in LB broth containing different kanamycin concentrations. Growth was measured as OD600 after 18 h incubation. Results are means and standard deviations from four replicate experiments. Inset: agarose gel electrophoresis showing yields of plasmid DNA from arabinose-induced and -uninduced cultures of EPI300 (pMycoFos). One microlitre of plasmid is loaded in each lane, from a preparation of 25 μl derived from 5 ml culture.

3.3. Expression of β-galactosidase from pMycoFos.lacZ in E. coli and M. smegmatis Another important aspect in the design of an improved Mycobacterium cloning vector was to obtain better control over expression of cloned genes, since unwanted expression can contribute to vector instability. The acetamidase promoter and associated regulatory genes (originally from pJAM2) were chosen

Digestion with SmaI gave the expected pattern (5.5, 3.0, 2.5 and 1.5 kb fragments), further confirming the correct size and structure of the construct (data not shown). The sequence of pMycoFos was deposited in Genbank with the accession number HQ388459.

3.2. Demonstration of copy number control with arabinose in E. coli EPI300 Our main motivation for constructing pMycoFos was that almost all existing Mycobacterium shuttle vectors have very high copy number in E. coli, which makes the plasmids unstable when toxic genes are cloned in them. Therefore, confirming the controllable copy number of pMycoFos was important. This was done in two ways, firstly by preparing plasmid extractions from equal volumes of arabinose-induced and uninduced EPI300 cultures and secondly by measuring growth at different levels of kanamycin in the presence and absence of arabinose—the latter test assumes that the antibiotic resistance of the vector will be increased at higher copy number due to increased gene dosage of the Km R gene aphA. Much higher yields of pMycoFos DNA were obtained from arabinose-induced cultures (0.54 μg/ml culture) compared to uninduced cultures (0.02 μg/ml culture) (Fig. 2 inset). Arabinoseinduced cultures of EPI300 grew better than uninduced cultures over most of the Km concentration range tested (200–900 μg/ml) (Fig. 2). An exception to this pattern was notable at lower Km levels (0–100 μg/ml), where the induced cultures showed less growth— this could be due to the metabolic burden on the cells of replicating higher copy number plasmids, which don't provide a corresponding benefit until the antibiotic concentration rises above a certain threshold level. Overall, the data indicate that the copy number of pMycoFos was controllable via arabinose induction in the same way as the parental fosmid pCC1FOS.

Fig. 3. SDS–PAGE analysis of lacZ expression in Escherichia coli EPI300 (lanes 1–6) and M. smegmatis mc2-155 (lanes 7–12) containing either pMycoFos or pMycoFos.lacZ. Lanes are as follows: m, molecular weight marker; 1, EPI300 (pMycoFos) with no induction; 2, EPI300 (pMycoFos) with 0.02% arabinose; 3, EPI300 (pMycoFos) with 0.2% acetamide; 4, EPI300 (pMycoFos.lacZ) with no induction; 5, EPI300 (pMycoFos.lacZ) with 0.02% arabinose; 6, EPI300 (pMycoFos.lacZ) with 0.2% acetamide; 7, mc2-155 (pMycoFos) with no induction; 8, mc2-155 (pMycoFos) with 0.2% acetamide; 9, mc2-155 (pMycoFos) with 2% acetamide; 10, mc2-155 (pMycoFos.lacZ) with no induction; 11, mc2-155 (pMycoFos.lacZ) with 0.2% acetamide; 12, mc2-155 (pMycoFos.lacZ) with 2% acetamide. Sizes of the proteins in the molecular weight marker are given in kiloDaltons (kDa) on the left hand side. Expected size of LacZ is 116.5 kDa.

324

M.A. Ly et al. / Journal of Microbiological Methods 86 (2011) 320–326

Fig. 4. BamHI digests of pMycoFos clones carrying inserts of Nocardioides CF8 DNA. Lanes are as follows: m, molecular weight markers; 1–6, digests of randomly picked KmR clones; 7, digest of pMycoFOS vector with no insert.

for this, since this system provides inducible expression from a low basal level to a high induced level using a cheap, readily available, and relatively non-toxic inducer molecule (acetamide). The marker gene lacZ from E. coli was chosen as a useful reporter of promoter activity, and this was cloned into the SwaI site of pMycoFos to create pMycoFos.lacZ. Expression of lacZ was investigated by detecting the enzyme activity by spectrophotometric assay (nitrophenol production from ONPG) and by detecting the LacZ protein itself (size 116.5 kDa) on SDS–PAGE gels. In E. coli EPI300 (pMycoFos.lacZ), expression of lacZ was highest in cultures induced with arabinose or arabinose plus acetamide, while acetamide alone did not appear to affect expression of the cloned gene (Table 1). Arabinose induction led to an approximately 8-fold increase in β-galactosidase activity above the basal level in EPI300 (pMycoFos.lacZ), while arabinose and acetamide together gave an approximately 14-fold increase in activity compared to no inducer. Since the errors associated with the experiment testing arabinose + acetamide induction together were large, we believe that this result is not significantly different to the results with arabinose alone as inducer. Although the acetamidase promoter was

Table 1 Effect of arabinose and acetamide induction on β-galactosidase activities of pMycoFos. lacZ construct in Escherichia coli EPI300 and Mycobacterium smegmatis mc2-155. Host

Plasmid

EPI300 pMycofos vector only

pMycofos.lacZ

mc2155

pMycofos vector only pMycofos.lacZ

a b

Culture conditions No inducer 0.02% arabinose 0.2% acetamide 0.02% arabinose + 0.2% acetamide No inducer 0.02% arabinose 0.2% acetamide 0.02% arabinose + 0.2% acetamide No inducer 0.2% acetamide 2% acetamide No inducer 0.2% acetamide 2% acetamide

β-galactosidase activity (Miller units)a,b 5±9 2±1 6 ± 10 8 ± 14 690 ± 110 5400 ± 1100 810 ± 150 9500 ± 4200 1.3 ± 0.6 5.6 ± 4.2 2.0 ± 1.0 1100 ± 310 3800 ± 1700 5500 ± 660

Results are means and standard deviations from three independent experiments. Results rounded to two significant figures.

not inducible in EPI300, it appeared that this promoter (or other promoters in the vector) were driving lacZ expression to some extent, since the β-galactosidase activity of uninduced EPI300 (pMycoFos.lacZ) cultures was approximately 100-fold higher than cultures carrying the vector alone (Fig. 3). SDS–PAGE of cell lysates confirmed the β-galactosidase assay results, showing a strong band near the expected size of LacZ in arabinose-induced cultures of EPI300 (pMycoFos.lacZ), but not under any other conditions. Since a band corresponding to LacZ was not seen in uninduced cultures of EPI300 (pMycoFos.lacZ), yet these cultures had appreciable levels of β-galactosidase, it appears that the spectrophotometric assay was a more sensitive indicator of lacZ expression than the SDS–PAGE. In cultures of M. smegmatis mc 2-155 (pMycoFos.lacZ), clear evidence of acetamide-inducible lacZ expression was obtained, with levels of β-galactosidase increasing approximately 4-fold above basal levels at 0.2% acetamide, and approximately 5-fold above basal levels at 2% acetamide. The uninduced cultures still had substantial β-galactosidase activity in the absence of arabinose (several hundred-fold higher than vector alone), indicating that control of the expression of cloned genes in the pMycoFos vector was not very tight in strain mc 2-155 (Fig. 3). SDS–PAGE of cell lysates confirmed the β-galactosidase assay results in mc 2-155, showing a band near the expected size of LacZ in acetamide-induced cultures, but not in uninduced cultures, or cultures carrying the vector alone. The LacZ protein band was notably more intense in cultures treated with 2% acetamide compared to 0.2% acetamide. Since arabinose control only affects one of the E. coli replication origins, arabinose was not tested for induction in mc 2-155 (it would be expected to have no effect). 3.4. Heterologous expression of ethene monooxygenase using pMycoFos A large part of the motivation for the construction of pMycoFos was to enable us to study monooxygenases from Mycobacterium spp which have resisted cloning and expression in other vector systems. The monooxygenase enzyme EtnABCD has been previously implicated in ethene oxidation via transcriptomic and proteomic approaches (Chuang and Mattes, 2007; Coleman and Spain, 2003; Coleman et al., 2011), but to date, no direct evidence for the functionality of this enzyme has been obtained, despite repeated attempts to clone and express the genes using E. coli or Mycobacterium vectors (Coleman, unpublished data). The etnABCD genes from Mycobacterium chubuense strain NBB4 (Coleman et al., 2011) were amplified by PCR, and cloned as a SwaI fragment into pMycoFos to generate pETN. The structure of this plasmid was confirmed to be correct by sequencing the ligation junctions and by restriction digestion using multiple enzymes (data not shown). The pETN plasmid was transformed into strain mc2-155, the culture was induced with acetamide then whole cells were assayed for monooxygenase activity by monitoring epoxidation of ethene and dechlorination of cis-dichloroethene (Fig. 5). The amounts of epoxide and chloride produced were 15-fold and 3-fold higher, respectively, in mc2-155 (pETN) cells compared to mc2-155 (pMycoFos) cells. The results provide conclusive evidence that the etnABCD genes encode a (chloro)ethene monooxygenase and demonstrate the usefulness of the pMycoFos vector for heterologous expression of Mycobacterium genes. 3.5. Testing fosmid library construction in E. coli and fosmid stability in Mycobacterium A small fosmid library was constructed using DNA from the butaneoxidising strain Nocardioides CF8 (Hamamura and Arp, 2000) in order to evaluate the performance of the new vector. For simplicity and to keep costs low, the first stage of library construction was done by electroporation of the ligation mixture into E. coli EPI300 rather than by phage packaging. From 60 Km R colonies screened by PCR, 43 were found to have inserts. Fosmids were extracted from 6 randomly selected

M.A. Ly et al. / Journal of Microbiological Methods 86 (2011) 320–326

Fig. 5. Monooxygenase activity of mc2-155 cells containing either pMycoFos or pETN, as measured by epoxyethane production from ethene, and inorganic chloride production from cis-dichloroethene. The data are end-point assays from resting cell suspensions, incubated for either 7 h (ethene) or 24 h (dichloroethene). Data are the average of three separate experiments and error bars show one standard deviation.

KmR clones, and characterised by restriction digestion (Fig. 4)—this indicated that all the clones were different, and all contained insert DNA, with estimated insert sizes of 20–50 kb. One fosmid clone (#1 in Fig. 5) was chosen for further work and was electroporated into mc 2155, transferred back into EPI300, and the fosmid DNA characterised by restriction digestion. The restriction pattern of clone #1 changed after shuttling between Mycobacterium and E. coli (data not shown), and the size of the clone was reduced from 37 kb to 20 kb as a result of this process. 4. Discussion Cloning and heterologous expression of Mycobacterium genes is an important tool in understanding the pathogenicity of species such as M. tuberculosis, and in developing the industrial and environmental applications of hydrocarbon-oxidising mycobacteria. The vector we describe here will greatly enhance our ability to clone and express genes from Mycobacterium spp., particularly genes which are difficult to clone in standard vector systems due to their toxicity, such as membrane proteins and some types of metabolic enzymes (e.g. monooxygenases). The pMycoFos construct is the first shuttle vector that features controllable copy-number in E. coli with the ability to replicate and express genes in Mycobacterium hosts. This vector is versatile, in the sense that it can be used to make largeinsert clone libraries (i.e. as a fosmid) or to clone smaller DNA regions for the purpose of protein production (i.e. as an expression vector). In the former case, gene expression is still possible from native Mycobacterium promoters after transfer to cloning hosts such as M. smegmatis mc2-155, allowing detection of genes in large-insert libraries via the phenotype they confer on the host. The pMycoFos vector contains the pAL5000 replicon, which functions in M. smegmatis, but also in diverse fast and slow-growing Mycobacterium species (Cosma et al., 2003). We therefore anticipate that pMycoFos would be useful in many different contexts, e.g. for complementation experiments with knockout mutants, especially in the case of large knockouts such as whole gene clusters. The acetamidase promoter and regulatory genes amiCADS from M. smegmatis were chosen here for gene expression in pMycoFos

325

with the expectation that this would provide better control than the hsp60 promoter from Mycobacteriumbovis, which is constitutively expressed, and only partly inducible by factors such as heat shock ((Al-Zarouni and Dale, 2002; Batoni et al., 1998). Data from βgalactosidase activity assays and SDS–PAGE indicated that the acetamidase promoter in pMycoFos did provide inducible gene expression in M. smegmatis, although the control of expression was not as tight as might be desired. Previous studies have shown the acetamidase promoter to have leaky expression (Parish et al., 1997, 2001; Roberts et al., 2003), so this outcome was not entirely unexpected. The fold-change in expression between uninduced and induced cultures of mc2-155 (pMycoFos.lacZ) was consistent with previous studies on this regulatory system (Parish et al., 1997; Triccas et al., 1998). We could not find evidence for acetamide induction in E. coli, but leaky expression of the cloned lacZ gene was also seen in cultures of EPI300 (pMycoFos.lacZ). It is not clear from the experiments done here whether the acetamidase promoter itself was causing this leaky expression in E. coli, or whether other promoters in the vector were responsible for this due to readthrough transcription. The basal level of cloned gene expression in EPI300 cultures could be minimised by keeping the copy number of the vector low via omitting arabinose; this emphasizes the usefulness of being able to independently control both copy number and cloned gene expression. Other plasmids using the acetamidase control system have been reported to be unstable in M. tuberculosis (Brown and Parish, 2006). We have not tested M. tuberculosis as a host for pMycoFos, and so cannot comment directly on this possibility. Ligation of the etnABCD monooxygenase genes from Mycobacterium NBB4 into pMycoFos yielded stable plasmid clones in E. coli, and allowed expression of the monooxygenase after transfer to strain mc2-155 and acetamide induction. This is the first demonstration of the successful heterologous expression of an ethene monooxygenase, and it confirms the expected activity of this enzyme (i.e. epoxidation of alkenes and dechlorination of chloroalkenes). Previous experiments in the Coleman lab and in other labs (T.E. Mattes, unpublished data) using standard E. coli/Mycobacterium shuttle vectors (e.g. pMV261) all failed to obtain stable plasmid clones containing the etnABCD genes, let alone express the genes to yield active enzyme—we believe this is due to the high plasmid copy number of such standard vectors in E. coli and/or the lack of control over expression of the cloned genes. The availability of a cloning system for the ethene monooxygenase opens up new possibilities for biochemical studies and biotechnological applications of this enzyme, e.g. site-directed mutagenesis and directed evolution. The data obtained from constructing a small fosmid library of Nocardioides DNA confirmed that the vector could maintain large inserts in E. coli, but indicated that there may be problems with stability of the constructs in Mycobacterium. A 17 kb deletion (or deletions) occurred after shuttling one test fosmid from EPI300 to mc 2-155 and back again—this may be due to general instability of the vector in Mycobacterium or specific issues with this particular fosmid clone or genomic DNA source. Alternatively, the changes observed may be due to the DNA transformation and extraction methods used. Plasmid rearrangements after electroporation into other Actinobacteria have been reported previously (Lal et al., 1998). The extraction method we used here to retrieve the fosmid from strain mc 2-155 was quite vigorous (bead-beating) and may have induced deletions. Further work using more test clones and more gentle DNA extraction methods are required to determine the stability of pMycoFos constructs in Mycobacterium. The pMycoFos vector developed here provides a versatile cloning and expression system which we anticipate will be widely useful, both for advancing our fundamental knowledge of the genus Mycobacterium and for developing biotechnological applications for the interesting enzymes of mycobacteria and related actinomycetes.

326

M.A. Ly et al. / Journal of Microbiological Methods 86 (2011) 320–326

Acknowledgments We thank Graham Hatfull for providing pJV53, Neil Wilson for construction of pUS116, and Luis Sayavedra-Soto for providing Nocardioides CF8 DNA. Vicky McCarl and Andy Holmes are acknowledged for co-supervision of MAL. This research was supported by Discovery grant DP0877315 from the Australian Research Council. MAL was supported by an Australian Postgraduate Award Scholarship. References Al-Zarouni, M., Dale, J.W., 2002. Expression of foreign genes in Mycobacterium bovis BCG strains using different promoters reveals instability of the hsp60 promoter for expression of foreign genes in Mycobacterium bovis BCG strains. Tuberculosis 82, 283–291. Bachrach, G., Colston, M.J., Bercovier, H., Bar-Nir, D., Anderson, C., Papavinasasundaram, K.G., 2000. A new single-copy mycobacterial plasmid, pMF1, from Mycobacterium fortuitum which is compatible with the pAL5000 replicon. Microbiology 146, 297–303. Bastos, R.G., Borsuk, S., Seixas, F.K., Dellagostin, O.A., 2009. Recombinant Mycobacterium bovis BCG. Vaccine 27, 6495–6503. Batoni, G., Maisetta, G., Florio, W., Freer, G., Campa, M., Senesi, S., 1998. Analysis of the Mycobacterium bovis hsp60 promoter activity in recombinant Mycobacterium avium. FEMS Microbiol. Lett. 169, 117–124. Behr, M.A., 2008. Current Mycobacterium: what's on tomorrow's menu? Microbes Infect. 10, 968–972. Brown, A.C., Parish, T., 2006. Instability of the acetamide-inducible expression vector pJAM2 in Mycobacterium tuberculosis. Plasmid 55, 81–86. Chambers, S.P., Prior, S.E., Barstow, D.A., Minton, N.P., 1988. The pMTL nic-cloning vectors. 1. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing. Gene 68, 139–149. Chen, C.L., Liu, W.T., Chong, M.L., Wong, M.T., Ong, S.L., Seah, H., Ng, W.J., 2004. Community structure of microbial biofilms associated with membrane-based water purification processes as revealed using a polyphasic approach. Appl. Microbiol. Biotechnol. 63, 466–473. Chuang, A.S., Mattes, T.E., 2007. Identification of polypeptides expressed in response to vinyl chloride, ethene, and epoxyethane in Nocardioides sp. strain JS614 by using peptide mass fingerprinting. Appl. Environ. Microbiol. 73, 4368–4372. Cirillo, J.D., Barletta, R.G., Bloom, B.R., Jacobs, W.R., 1991. A novel transposon trap for mycobacteria: isolation and characterization of IS1096. J. Bacteriol. 173, 7772–7780. Coleman, N.V., Spain, J.C., 2003. Epoxyalkane: coenzyme M transferase in the ethene and vinyl chloride biodegradation pathways of Mycobacteriumstrain JS60. J. Bacteriol. 185, 5536–5545. Coleman, N.V., Mattes, T.E., Gossett, J.M., Spain, J.C., 2002a. Biodegradation of cisdichloroethene as the sole carbon source by a beta-proteobacterium. Appl. Environ. Microbiol. 68, 2726–2730. Coleman, N.V., Mattes, T.E., Gossett, J.M., Spain, J.C., 2002b. Phylogenetic and kinetic diversity of aerobic vinyl chloride-assimilating bacteria from contaminated sites. Appl. Environ. Microbiol. 68, 6162–6171. Coleman, N.V., Yau, S., Wilson, N.L., Nolan, L.M., Migocki, M.D., Ly, M.-a., Crossett, B., Holmes, A.J., 2011. Untangling the multiple monooxygenases of Mycobacterium chubuense strain NBB4, a versatile hydrocarbon degrader. Environ. Microbiol. Rep. 3, 297–307. Cosma, C.L., Sherman, D.R., Ramakrishnan, L., 2003. The secret lives of pathogenic mycobacteria. Ann. Rev. Microbiol. 57, 641–676. Griffin, S., Williamson, A.L., Chapman, R., 2009. Optimisation of a mycobacterial replicon increases foreign antigen expression in mycobacteria. Tuberculosis 89, 225–232. Guengerich, F.P., Crawford, W.M.J., Watanabe, P.G., 1979. Activation of vinyl chloride to covalently bound metabolites: roles of 2-chloroethylene oxide and 2-chloroacetaldeyhde. Biochemistry 18, 5177–5182. Guilhot, C., Otal, I., Van Rompaey, I., Martin, C., Gicquel, B., 1994. Efficient transposition in mycobacteria: construction of Mycobacterium smegmatis insertional mutant libraries. J. Bacteriol. 176, 535–539. Habets-Crutzen, A., Carlier, S., de Bont, J.W.D., Schurig, V., Hartmans, S., Tramper, J., 1985. Stereospecific formation of 1,2-epoxypropane, 1,2-epoxybutane, and 1chloro, 2,3-epoxpropane by alkene-utilizing bacteria. Enzyme Microb. Technol. 7, 17–21. Hamamura, N., Arp, D.J., 2000. Isolation and characterization of alkane-utilizing Nocardioides sp. strain CF8. FEMS Microbiol. Lett. 186, 21–26. Hanahan, D., 1985. Techniques for transformation of E. coli. In: Glover, D.M. (Ed.), DNA Cloning, vol. I. IRL Press, Oxford, pp. 109–135. Harth, G., Maslesa-Galic, S., Horwitz, M.A., 2004. A two-plasmid system for stable, selective-pressure-independent expression of multiple extracellular proteins in mycobacteria. Microbiology 150, 2143–2151.

Hartmans, S., De Bont, J.A., 1992. Aerobic vinyl chloride metabolism in Mycobacterium aurum L1. Appl. Environ. Microbiol. 58, 1220–1226. Herrmann, J.L., Ogaora, P., Gallagher, A., Thole, J.E.R., Young, D.B., 1996. Bacterial glycoproteins: a link between glycosylation and proteolytic cleavage of a 19 kDa antigen from Mycobacterium tuberculosis. EMBO J. 15, 3547–3554. Hinds, J., Mahenthiralingam, E., Kempsell, K.E., Duncan, K., Stokes, R.W., Parish, T., Stoker, N.G., 1999. Enhanced gene replacement in mycobacteria. Microbiology 145, 519–527. Hinshelwood, S., Stoker, N.G., 1992. An Escherichiacoli-Mycobacterium shuttle cosmid vector, pMSC1. Gene 110, 115–118. Howard, N.S., Gomez, J.E., Ko, C., Bishai, W.R., 1995. Color selection with a hygromycin-resistance-based Escherichia coli-mycobacterial shuttle vector. Gene 166, 181–182. Hussain, T., 2007. Leprosy and tuberculosis: an insight-review. Crit. Rev. Microbiol. 33, 15–66. Kim, U.J., Shizuya, H., de Jong, P.J., Birren, B., Simon, M.I., 1992. Stable propagation of cosmid sized human DNA inserts in an F factor based vector. Nuc. Acids Res. 20, 1083–1085. Kim, S.-J., Jones, R.C., Cha, C.-J., Kweon, O., Edmondson, R.D., Cerniglia, C.E., 2004. Identification of proteins induced by polycyclic aromatic hydrocarbon in Mycobacterium vanbaalenii PYR-1 using two-dimensional polyacrylamide gel electrophoresis and de novo sequencing methods. Proteomics 4, 3899–3908. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Lal, R., Khanna, R., Dhingra, N., Khanna, M., Lal, S., 1998. Development of an improved cloning vector and transformation system in Amycolatopsis mediterranei (Nocardia mediterranei). J. Antibiot. 51, 161–169. Le, N.B., Coleman, N.V., 2011. Biodegradation of vinyl chloride, cis-dichloroethene and 1,2-dichloroethane in the alkene/alkane-oxidising Mycobacterium strain NBB4. Biodegradation. doi:10.1007/s10532-011-9466-0. Morrill, T.C., Friedrich, L.E., Machonkin, M.A., Whitbourne, J.E., Eastman, C.A., 1981. N-(2-hydroxyethyl)-4-(p-nitrobenzylidene)-1,4-dihydropyridine (DHP) from the reaction of 4-(p-nitrobenzyl)pyridine (NBP) with ethylene oxide. J. Heterocycl. Chem. 18, 1645–1647. Parish, T., Mahenthiralingam, E., Draper, P., Davis, E.O., Colston, E.O., 1997. Regulation of the inducible acetamidase gene of Mycobacterium smegmatis. Microbiology 143, 2267–2276. Parish, T., Turner, J., Stoker, N., 2001. amiA is a negative regulator of acetamidase expression in Mycobacterium smegmatis. BMC Microbiol. 1, 19. Pashley, C.A., Parish, T., McAdam, R.A., Duncan, K., Stoker, N.G., 2003. Gene replacement in mycobacteria by using incompatible plasmids. Appl. Environ. Microbiol. 69, 517–523. Roberts, G., Muttucumaru, D.G.N., Parish, T., 2003. Control of the acetamidase gene of Mycobacterium smegmatis by multiple regulators. FEMS Microbiol. Lett. 221, 131–136. Sambrook, J., Russell, D.W., 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York. Snajdrova, R., Grogan, G., Mihovilovic, M.D., 2006. Resolution of fused bicyclic ketones by a recombinant biocatalyst expressing the Baeyer–Villiger monooxygenase gene Rv3049c from Mycobacterium tuberculosis H37Rv. Bioorg. Med. Chem. Lett. 16, 4813–4817. Snapper, S.B., Melton, R.E., Mustafa, S., Kieser, T., Jacobs, W.R., 1990. Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol. Microbiol. 4, 1911–1919. Stover, C.K., Delacruz, V.F., Fuerst, T.R., Burlein, J.E., Benson, L.A., Bennett, L.T., Bansal, G.P., Young, J.F., Lee, M.H., Hatfull, G.F., Snapper, S.B., Barletta, R.G., Jacobs, W.R., Bloom, B.R., 1991. New use of BCG for recombinant vaccines. Nature 351, 456–460. Tobin, D.M., Ramakrishnan, L., 2008. Comparative pathogenesis of Mycobacterium marinum and Mycobacterium tuberculosis. Cell. Microbiol. 10, 1027–1039. Triccas, J.A., Parish, T., Britton, W.J., Gicquel, B., 1998. An inducible expression system permitting the efficient purification of a recombinant antigen from Mycobacterium smegmatis FEMS Microbiol. Lett. 167, 151–156. van Ginkel, C.G., Welten, H.G.J., de Bont, J.A.M., 1987. Oxidation of gaseous and volatile hydrocarbons by selected alkene-utilizing bacteria. Appl. Environ. Microbiol. 53, 2903–2907. van Ingen, J., Boeree, M.J., Dekhuijzen, P.N.R., van Soolingen, D., 2009. Environmental sources of rapid growing nontuberculous mycobacteria causing disease in humans. Clin. Microbiol. Infect. 15, 888–893. van Kessel, J.C., Hatfull, G.F., 2007. Recombineering in Mycobacterium tuberculosis. Nat. Methods. 4, 147–152. Xu, L., Wang, Y., Zheng, X., Gui, X., Tao, L., Wei, H., 2009. Immunotherapeutical potential of Mycobacterium vaccae on M. tuberculosis infection in mice. Cell. Mol. Immunol. 6, 67–72. Yagi, O., Hashimoto, A., Iwasaki, K., Nakajima, M., 1999. Aerobic degradation of 1,1,1-trichloroethane by Mycobacterium spp. isolated from soil. Appl. Environ. Microbiol. 65, 4693–4696. Yeates, C., Gillings, M.R., 1998. Rapid purification of DNA from soil for molecular biodiversity analysis. Lett. Appl. Microbiol. 27, 49–53. Zhang, X., Bremer, H., 1995. Control of the Escherichia coli rrnB P1 promoter strength by ppGpp. J. Biol. Chem. 270, 11181–11189.