Construction and immunogenicity of recombinant pseudotype baculovirus expressing the capsid protein of porcine circovirus type 2 in mice

Journal of Virological Methods 150 (2008) 21–26

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Construction and immunogenicity of recombinant pseudotype baculovirus expressing the capsid protein of porcine circovirus type 2 in mice Huiying Fan a,c,1 , Yongfei Pan a,b,1 , Liurong Fang a,b , Dang Wang a,b , Shengping Wang a,b , Yunbo Jiang a,b , Huanchun Chen a,b , Shaobo Xiao a,b,∗ a

State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China Laboratory of Animal Virology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China c College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China b

a r t i c l e

i n f o

Article history: Received 20 September 2007 Received in revised form 18 February 2008 Accepted 21 February 2008 Available online 3 April 2008 Keywords: Porcine circovirus type 2 (PCV2) Capsid protein Pseudotype baculovirus Immunogenicity

a b s t r a c t Baculovirus has emerged recently as a novel and attractive gene delivery vehicle for mammalian cells. Porcine circovirus type 2 (PCV2) is known to be associated with post-weaning multisystemic wasting syndrome (PMWS), an emerging swine disease which results in tremendous economic losses. In this study, baculovirus pseudotyped with vesicular stomatitis virus glycoprotein (VSV-G) was used as a vector to express capsid (Cap) protein, the most important immunogen of PCV2, under the transcriptional control of cytomegalovirus immediate early (CMV-IE) enhancer/promoter. The resultant recombinant baculovirus (BV-G-ORF2) efficiently transduced and expressed the Cap protein in mammalian cells, as demonstrated by Western blot and flow cytometric analyses. After direct vaccination with 1 × 108 or 1 × 109 plaque forming units (PFU)/mouse of BV-G-ORF2, significant PCV2-specific ELISA antibodies, neutralizing antibodies, as well as cellular immune responses could be induced in mice. BV-G-ORF2 exhibited better immunogenicity than a DNA vaccine encoding the Cap protein, even at a dose of 1 × 108 PFU/mouse. Taken together, the improved immunogenicity of BV-G-ORF2, together with the unique advantages of pseudotype baculovirus, including easy manipulation, simple scale-up, lack of toxicity, and no pre-existing antibody against baculovirus in the hosts, indicate that pseudotype baculovirus-mediated gene delivery can be utilized as an alternative strategy to develop a new generation of vaccines against PCV2 infection. © 2008 Elsevier B.V. All rights reserved.

1. Introduction The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) has been used traditionally as an excellent tool to overexpress recombinant proteins in insect cells. Its host specificity was originally thought to be restricted to cells derived from arthropods. Recently, accumulated evidence has revealed that baculovirus, carrying mammalian cell-active promoters, is capable of transferring and expressing foreign genes in a variety of primary and established mammalian cells as well as animal models (Hofmann et al., 1995; Shoji et al., 1997; Kost et al., 2005). Furthermore, it has been reported that a pseudotype baculovirus displaying the glycoprotein of vesicular stomatitis virus (VSV-G) on the envelope can extend the host range and increase the transduction efficiency in mammalian cells and in mouse skeletal muscle

∗ Corresponding author at: Laboratory of Animal Virology, College of Veterinary Medicine, Huazhong Agricultural University, 1 Shi-zi-shan Street, Wuhan 430070, China. Tel.: +86 27 8728 6884; fax: +86 27 8728 1795. E-mail address: [email protected] (S. Xiao). 1 These authors contributed equally to this work. 0166-0934/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2008.02.011

(Barsoum et al., 1997; Facciabene et al., 2004). Thanks to highly efficient gene delivery, baculovirus has gained increasing interest as a novel vector for vaccine development. Several groups have demonstrated that direct vaccination with recombinant pseudotype baculovirus can induce high-level humoral and cell-mediated immunity against various antigens, including influenza virus HA (Abe et al., 2003; Lu et al., 2007; Yang et al., 2007), Plasmodium falciparum circumsporozoite protein (Strauss et al., 2007), and hepatitis C virus E2 glycoprotein (Facciabene et al., 2004). Porcine circovirus type 2 (PCV2), a member of the Circoviridae family, is associated with post-weaning multisystemic wasting syndrome (PMWS), an emerging disease characterized by clinical signs such as progressive weight loss, dyspnea, tachypnea, anemia, diarrhea, and jaundice in 5–12-week-old pigs (Allan and Ellis, 2000). PCV2 is a small non-enveloped single-stranded circular DNA virus with a 1.76-kb ambisense genome (Mankertz et al., 2000). The genome contains at least three major open reading frames (ORF1, ORF2, and ORF3) (Cheung and Bolin, 2002; Liu et al., 2005). The capsid (Cap) protein, encoded by ORF2 of the viral gene, is the major immunogenic protein and is associated with the production of PCV2-specific neutralizing antibodies (Nawagitgul et al., 2000; Pogranichnyy et al., 2000), which makes it a leading tar-

22

H. Fan et al. / Journal of Virological Methods 150 (2008) 21–26

get in the design of a new generation of vaccines against PCV2 infection. In this study, a recombinant pseudotype baculovirus encoding PCV2 Cap protein was constructed and the expression characterization in mammalian cells and immunogenicity in a mouse model were investigated. The results showed that the Cap protein could be expressed efficiently in transduced mammalian cells. Direct immunization with the recombinant baculovirus induced PCV2-specific immune responses in the mouse model. 2. Materials and methods 2.1. Virus and cells A porcine kidney (PK-15) cell line free of PCV1 contamination was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS), 100 ␮g/ml of streptomycin and 100 IU/ml of penicillin. Spodrptera frugiperda (Sf-9) cells were used to propagate recombinant baculovirus and cultured in Grace’s insect media (Invitrogen) supplemented with 10% FBS at 27 ◦ C. PCV2 strain Yu-A used in this study was originally isolated from a pig with naturally occurring PMWS. PCV2 was propagated in PK-15 cells as previously described (Nawagitgul et al., 2000). 2.2. Construction of recombinant baculoviruses The baculovirus transfer vector, pFastBac-VSV/G in which the VSV-G gene was under the control of the polyhedron promoter of pFastbac1 (Invitrogen), was described previously (Fan et al., 2007). BV-G-CMV, a pseudotype baculovirus displaying the VSV-G on the virion envelope and containing the mammalian cell-active expression elements (CMV-IE promoter and BGH poly(A)) immediately downstream of the VSV-G expression cassette, was constructed previously (Fan et al., 2007). To generate recombinant baculovirus BV-G-ORF2, the DNA fragment containing the ORF2 expression cassette (CMV-ORF2-BGH poly(A)) was released from pc-ORF2 (Fan et al., 2008) and inserted into pFastBac-VSV/G, resulting in the recombinant transfer plasmid pFastBac-VSV/G-ORF2 (Fig. 1A). The recombinant baculovirus was subsequently generated by using the Bac-to-Bac® system (Invitrogen) following the manufacturer’s instructions. Recombinant baculovirus was further amplified by propagation in Sf-9 cells. Virus purification was performed as described (Abe et al., 2003) and the purified virus was resuspended in phosphate-buffered saline (PBS, pH 7.4). The virus titer was determined using BacPAK Rapid Titer assay (Clontech) in Sf-9 cells. 2.3. Baculovirus transduction, flow cytometry, and Western blot PK-15 cells were seeded at a concentration of 2.5 × 105 cells/well into six-well tissue culture plates (Nunc). When cells reached approximately 70–80% confluence, the culture medium was removed, washed three times with PBS (pH 7.4), replaced with baculovirus BV-G-ORF2 (MOI = 100) and incubated for 2 h at 27 ◦ C. Baculovirus BV-G-CMV at the same dose was used as a control. After removal of the virus, fresh medium was added and incubated further at 37 ◦ C. At 48 h post-transduction, the cells were harvested by digestion with trypsin/EDTA, washed twice with PBS supplemented with 0.05% Tween 80, fixed in 4% paraformaldehyde and then permeabilized with 0.1% Triton X-100 in PBS. The fixed cells were incubated with porcine anti-PCV2 polyclonal antibodies (1:200, VMRD, USA), followed by FITC-conjugated rabbit anti-porcine IgG (1:2000, SBA, USA). After three washes, the cells were resuspended in PBS for flow cytometric analysis (FACSCalibur, BD BioSciences, San Diego, CA, USA) according to the manufacturer’s instructions. 10,000 cells were analyzed for each sample and all experiments

Fig. 1. Construction and expression of pseudotype baculovirus BV-G-ORF2. (A) Schematic diagrams of transfer plasmid for construction of recombinant baculovirus. The constitution of the transfer plasmid based on pFastBac1 is displayed. polh, the polyhedrin promoter of baculovirus; VSV/G, the glycoprotein of vesicular stomatitis virus; P CMV, cytomegalovirus immediate-early promoter/enhancer; poly(A), polyadenylation signal; ORF2, the ORF2 gene encoding the capsid protein of PCV2 strain Yu-A. (B) PK-15 cells were transduced with BV-G-CMV or BV-G-ORF2 at an MOI of 100, respectively. Cell lysates from PK-15 cells transduced with BV-GCMV (lane 1) or BV-G-ORF2 (lane 2) were prepared at 48-h post-transduction and subjected to Western blot. Cell lysates from PCV2-infected PK-15 cells were used as a positive control (lane 3). The membrane was probed with rabbit anti-Cap protein polyclonal antibodies. (C) PK-15 cells were transduced with BV-G-CMV or BV-GORF2 at an MOI of 100, respectively. At 48-h post-transduction, cells were harvested for flow cytometric analysis as described in Section 2. Data from one representative out of three independent experiments are given.

were carried out in triplicate. For Western blot analysis, the transduced cells were collected at 48 h post-transduction, lysed in SDS sample buffer and proteins were separated using 10% SDS-PAGE. Separated proteins were electroblotted onto a nitrocellulose membrane. Western blot was carried out as previously described (Fan et al., 2005) with rabbit anti-Cap protein polyclonal antibodies (1:100). PCV2-infected PK-15 cells were used as a positive control. 2.4. Immunization of mice Five to six-week-old female BALB/c mice were randomly divided into five groups (eight mice per group). Two groups were injected intramuscularly with 100 ␮l of PBS containing 1 × 108 or 1 × 109 plaque forming units (PFU) of BV-G-ORF2, respectively. The other two groups were injected intramuscularly with 100 ␮l of PBS containing 1 × 109 PFU of BV-G-CMV or 100 ␮g of pc-ORF2 (a DNA vaccine construct expressing PCV2 Cap protein) (Fan et al., 2008), respectively. The final group was used as a negative control and injected with 100 ␮l of PBS. An identical booster immunization was performed 3 weeks later. Serum samples were collected from the retro-orbital plexus at 3 and 6 weeks after immunization and used in serological tests. 2.5. Serological tests Cap protein-specific antibodies were determined with an endpoint ELISA using the recombinant Cap protein antigen as described previously (Fan et al., 2008). The titers were expressed as the reciprocal of the highest dilution of sera producing ratio values of 2.1. Serum neutralization assays were essentially performed as

H. Fan et al. / Journal of Virological Methods 150 (2008) 21–26

described by Meerts et al. (2006). The neutralization titer was calculated as the reciprocal of the highest serum dilution able to completely block PCV2-infection in PK-15 cells. 2.6. IFN- release assays Mouse splenocytes were prepared as described previously (Xiao et al., 2004), and incubated in 24-well, flat-bottom plates (1 × 106 cells/well) in the presence of recombinant Cap protein (20 ␮g/ml) (Fan et al., 2008). The concentration of Cap protein was determined by the Micro BCATM Protein Assay Kit of Pierce according to the manufacturer’s instructions. After 72 h incubation, the culture supernatant was harvested and the presence of IFN-␥ was tested with commercial mouse IFN-␥ ELISA kits (Biosource, USA) according to the manufacturer’s instructions. The concentration of mouse IFN-␥ in the samples was determined from the standard curves. 2.7. Real-time PCR analysis of IFN- mRNA expression Splenocytes (1 × 106 ml−1 ) were cultured in 24-well plates for 20 h at 37 ◦ C in the presence of 5% CO2 , with or without 20 ␮g/ml of recombinant Cap protein. Total RNA was extracted and one microgram of RNA was reverse transcribed using the Rever Tra Ace® kit (ToYoBo, China) in a 20-␮l reaction mixture. The cDNA product (0.5 ␮l) was amplified in a 25-␮l reaction mixture containing SYBR® Green Real-time PCR Master Mix (ToYoBo), 0.2 ␮M each of the forward and reverse gene-specific primers for mouse IFN␥ (TCAAGTGGCATAGATGTGGAAGAA/TGGCTCTGCAGGATTTTCATG) or ␤-actin(CACTGCCGCATCCTCTTCCTCCC/CAATAGTGATGACCTGGCCGT), aliquoted into 96-well plates (Applied Biosystems, Foster City, CA), and sealed with optical sealing tape (ABI). Each cDNA sample was prepared in triplicate. PCR amplifications were performed using an Applied Biosystems 7500 Real-Time PCR System (ABI). Thermal cycling conditions were 2 min at 50 ◦ C, 10 min at 94 ◦ C, and 40 cycles of 15 s at 94 ◦ C and 1 min at 60 ◦ C. Gene expression was measured by relative quantity, which compares the threshold cycle (Ct ) of the sample of interest to the Ct generated by a reference sample referred to as the calibrator (non-stimulated splenocytes incubated for the same time period as stimulated splenocytes). Cytokine gene expression was normalized to ␤-actin expression by subtraction of Ct to provide Ct values. The Ct was calculated as the difference between Ct values for stimulated and nonstimulated splenocytes from the test animal. The relative difference in cytokine expression between stimulated and non-stimulated cells was determined using equation 2−Ct according to the User Bulletin number 2, ABI prism 7500 Sequence Detection System (Applied Biosystems) instructions.

23

3), could be detected in the cell lysates of BV-G-ORF2-transduced PK-15 cells (Fig. 1B lane 2), but not in the cell lysates of BV-G-CMVtransduced cells (Fig. 1B lane 1). To investigate whether BV-G-ORF2 has high transduction efficiency in mammalian cells, PK-15 cells were transduced with BV-G-ORF2 or BV-G-CMV and flow cytometric analysis was performed at 48 h after transduction. As shown in Fig. 1C, nearly 87% of cells could be transduced and expressed the Cap protein. These results indicated that the pseudotype baculovirus BV-G-ORF2 could mediate efficient gene delivery and expression of the Cap protein in transduced mammalian cells. 3.2. PCV2-specific humoral immune responses elicited by BV-G-ORF2 in mice Efficient expression and transduction in PK-15 cells allowed us to determine whether BV-G-ORF2 can induce PCV2-specific immune responses in vivo after direct immunization. To this end, BALB/c mice were immunized intramuscularly with 1 × 108 or 1 × 109 PFU/mouse of BV-G-ORF2, 1 × 109 PFU/mouse of BVG-CMV, or PBS, respectively. In addition, to compare the immunogenicity of BV-G-ORF2 with that of the DNA vaccine encoding the same antigen, pc-ORF2 was used as control. Cap protein-specific ELISA antibodies were monitored at 3 and 6 weeks after primary immunization. As shown in Fig. 2A, Cap protein-specific antibody responses could be detected in all mice immunized with 1 × 108 or 1 × 109 PFU of BV-G-ORF2 at 3 weeks

2.8. Statistical analysis Student’s t-test was used to compare the humoral and cellular immune responses between the different groups. P-values of <0.05 were considered statistically significantly different. 3. Results 3.1. Expression of the Cap protein in BV-G-ORF2-transduced mammalian cells To investigate whether the Cap protein is expressed in BV-GORF2-transduced mammalian cells, PK-15 cells were transduced with BV-G-ORF2 or BV-G-CMV at an MOI of 100, respectively, and Western blot was performed at 48 h after transduction. As shown in Fig. 1B, a notable band corresponding to a molecular weight of about 28 kDa, which is identical to the PCV2-infected cells (Fig. 1B lane

Fig. 2. Antibody responses in mice immunized with pseudotype baculovirus or DNA vaccine. 5–6-week-old BALB/c mice (eight per group) were vaccinated intramuscularly with 1 × 108 , and 1 × 109 PFU of BV-G-ORF2, 1 × 109 PFU of BV-G-CMV, 100 ␮g of pc-ORF2, or PBS, respectively. Booster vaccinations were performed 3 weeks later. Serum samples were collected at 3 and 6 weeks. Antibody levels were analyzed by Cap protein-specific ELISA (A) and serum neutralization assays (B). No PCV2-specific neutralizing antibodies were detected in mice treated with BV-G-CMV or PBS. Data represent the mean ± S.D. for eight mice.

24

H. Fan et al. / Journal of Virological Methods 150 (2008) 21–26

after primary immunization. The antibody levels increased rapidly up to 1:4000 and 1:7169 after booster immunization in mice receiving 1 × 108 or 1 × 109 PFU of BV-G-ORF2, respectively. Throughout this experiment, mice immunized with 1 × 109 or 1 × 108 PFU of BVG-ORF2 produced significantly higher ELISA antibody titers than mice vaccinated with 100 ␮g of pc-ORF2 at 3 or 6 weeks (P < 0.01) after primary immunization. Serum samples were evaluated for the ability to neutralize PCV2 in vitro by serum neutralization assays. As shown in Fig. 2B, mice immunized with 1 × 108 or 1 × 109 PFU of BV-GORF2 developed mean neutralizing antibody titers of 1:5 and 1:7 at 3 weeks after primary immunization, which increased further to 1:11 and 1:16 at 6 weeks, respectively. Although detectable PCV2-specific neutralizing antibodies can develop in mice immunized with pc-ORF2, the mean neutralizing antibody titer was 1:5 even at the end of the trial (6 weeks after primary immunization), which was significantly lower than the groups which received 1 × 108 or 1 × 109 PFU of BV-G-ORF2 (P < 0.01). As expected, sera from mice immunized with BV-G-CMV or PBS did not display any neutralizing antibody activity throughout the whole experiment. 3.3. PCV2-specific cellular immune responses elicited by BV-G-ORF2 in mice To characterize the cell-mediated immune responses in mice immunized with BV-G-ORF2, mice were killed at 6 weeks after primary immunization and IFN-␥ production in splenocytes restimulated with recombinant Cap protein was measured by ELISA. As shown in Fig. 3, a mean IFN-␥ production of 286, 202, and 190 pg/ml was detected in mice inoculated with 1 × 109 and 1 × 108 PFU of BV-G-ORF2, and 100 ␮g of pc-ORF2, respectively. Statistical analyses indicated that there was a significant difference between the group immunized with 1 × 109 PFU of BV-G-ORF2 and the group which received 100 ␮g of pc-ORF2 (P < 0.01), whereas no significant difference was observed between the group immunized with 1 × 108 PFU of BV-G-ORF2 and the group which received pcORF2 (P > 0.05). As expected, no significant production of IFN-␥ was detected in PBS-inoculated mice. Interestingly, splenocytes harvested from BV-G-CMV-injected mice produced higher background non-specific IFN-␥ responses (107 pg/ml) after re-stimulation in vitro with recombinant Cap protein. The IFN-␥ mRNA expression in splenocytes re-stimulated with the recombinant Cap protein was also analyzed by real-time RTPCR. Similar to the results of IFN-␥ determined by ELISA, the

Fig. 3. IFN-␥ production determined in the supernatant of splenocytes harvested from immunized mice after in vitro re-stimulation. Mice were immunized as shown in Fig. 2. Splenocytes were isolated 6 weeks after primary immunization and were re-stimulated in vitro with purified recombinant Cap proteins for 72 h. IFN-␥ production in the supernatant was analyzed by ELISA. Data represent the means ± S.D.

Fig. 4. IFN-␥ relative mRNA expression in splenocytes harvested from immunized mice after in vitro re-stimulation. Mice were immunized as shown in Fig. 2. Splenocytes were isolated 6 weeks after primary immunization and were incubated in vitro with or without the purified recombinant Cap proteins for 20 h. RNA was extracted and subjected to quantitative RT-PCR. Relative quantity of IFN-␥ mRNA expression was determined by relative quantitative RT-PCR using ␤-actin gene expression as the housekeeping gene. Mean relative quantity of IFN-␥ mRNA ± S.D. is shown.

mean relative IFN-␥ mRNA expression was significantly higher in mice immunized with 1 × 109 PFU of BV-G-ORF2 than in mice who received pc-ORF2 (P < 0.01) (Fig. 4). Likewise, a higher background of non-specific IFN-␥ mRNA expression was observed in mice immunized with pseudotype baculovirus, as mean relative IFN-␥ mRNA expression increased fivefold in the group injected with BV-G-CMV after re-stimulation in vitro with recombinant Cap protein (Fig. 4). 4. Discussion In the global swine industry PMWS has become a major disease (Allan and Ellis, 2000). Although other co-factors have been reported to contribute to this disease, there is no doubt that the expression of the clinical disease is dependent on the presence of PCV2 (Blanchard et al., 2003; Roca et al., 2004). Development of an effective vaccine against PCV2 infection has been accepted as a strategy for the prophylaxis of PMWS. Some experimental vaccines based on the major immunogenic Cap proteins, such as DNA vaccines (Blanchard et al., 2003; Kamstrup et al., 2004), recombinant vaccines of PCV1-PCV2 (Fenaux et al., 2004), and live virus-vectored vaccines (recombinant adenovirus and pseudorabies virus) (Wang et al., 2006; Song et al., 2007), have been developed and tested against PCV2 infection. In the present study, pseudotype baculovirus was used as a vector to express the Cap protein, and its immunogenicity was evaluated in a mouse model. This recombinant pseudotype baculovirus mediated efficient gene delivery and expressed the Cap protein in mammalian cells. More importantly, direct vaccination with recombinant baculovirus developed PCV2-specific immune responses, indicating that pseudotype baculovirus is an alternative vector in which to express and present antigens of PCV2, and may therefore be used to study further the induction of protective immunity in swine. Meerts et al. (2006) reported that the absence of PCV2neutralizing antibodies was correlated with high PCV2-replication and with PCV2-related disease (PMWS) if present, indicating that neutralizing antibodies play an important role in the defense against PCV2 infection and the sequential appearance of PMWS. Thus, it is necessary to increase the level of PCV2-neutralizing antibodies by developing a new generation of vaccines against PCV2. In the present study, mice immunized with BV-G-ORF2 at a dose of 1 × 108 and 1 × 109 PFU/mouse developed significant PCV2-neutralizing antibodies. BV-G-ORF2 exhibited better

H. Fan et al. / Journal of Virological Methods 150 (2008) 21–26

immunogenicity than the DNA vaccine (pc-ORF2) encoding the same antigen, as demonstrated by significantly higher ELISA antibodies and neutralizing antibodies. There are three possible explanations for the enhanced immunogenicity of recombinant baculovirus: (i) higher transduction efficiency in vivo. Previous studies have demonstrated that pseudotype baculovirus can enter mouse skeletal muscle cells with higher efficiency (Barsoum et al., 1997; Facciabene et al., 2004). It is well known that only 1–2% of muscle cells can capture plasmid DNA after direct intramuscular DNA vaccination. The higher transduction efficiency of pseudotype baculovirus may result in greater antigen expression, an increased chance of being taken up by antigen-presenting cells (APCs), and subsequently a higher efficacy in the induction of immune responses. (ii) More efficient antigen presentation. A recent study has demonstrated that baculovirus vectors cannot only transduce mouse skeletal muscle cells, but are also able to transduce efficiently dendritic cells (DCs), the most important APCs (Strauss et al., 2007). Theoretically, more efficient antigen presentation results in more efficient immune responses. (iii) It is possible that residual Cap protein in the BV-G-ORF2 preparation was present as a possible source of antigen instead of DNA transcription in the host, which would also enhance immune responses. In this study, significantly high IFN-␥ production in mice immunized with a dose of 1 × 109 PFU/mouse was also observed compared with mice which received pc-ORF2. Apart from the factors discussed above which would enhance humoral immune responses, the ‘adjuvant’ effect of baculovirus should also be considered. Previous studies have revealed that baculovirus itself has the ability to induce innate immune responses through the Toll-like receptor 9 (TLR9)/MyD88-dependent signaling pathway, resulting in the production of various cytokines, including tumor necrosis factor-alpha (TNF-␣), interleukin-6 (IL-6), and interferon (Gronowski et al., 1999; Facciabene et al., 2004; Abe et al., 2005; Hervas-Stubbs et al., 2007). In this study, a higher background of non-specific IFN-␥ production in splenocytes harvested from baculovirus-injected mice was observed. Cell-mediated immunity is central to protection mechanisms in a variety of viral infections. However, its role against PCV2 infection has not been elucidated. Recently, Meerts et al. (2005) found that IFN-␥ added to the culture medium before, during, or after inoculation increased the replication of PCV2 in PK-15 cells and porcine monocytic cells (3D4/31). Chang et al. (2006) reported that bacterial lipopolysaccharide (LPS), which is used to stimulate type I IFN production, could induce PCV2 replication in swine alveolar macrophages. These observations indicate that high levels of IFN seem to have a deleterious effect on protective immunity. In contrast to this assumption, two reports have demonstrated unequivocally that the use of vaccine adjuvants (such as Mycoplasma hyopneumoniae and ADJ, a commercial vaccine adjuvant), which can stimulate the production of non-specific cellular immunity, did not contribute to PCV2 replication and the occurrence of PMWS in pigs under field conditions (Resendes et al., 2004; Haruna et al., 2006). These controversial results make it difficult to decide whether the higher IFN-␥ production induced by BV-GORF2-vaccination is beneficial in protective immunity against PCV2 infection. As a novel vaccine vector, baculovirus have many advantages, including easy manipulation, high recombinant viral titers (>1010 PFU/ml), simple scale-up, a large DNA insertion capacity, lack of replication in mammalian cells, and lack of toxicity (Kost et al., 2005). More importantly, there is no pre-existing antibody against baculovirus in animals that might interfere with administration of recombinant genes in the host (Strauss et al., 2007). These advantages, together with the better immunogenicity of BV-G-ORF2 in the mouse model, make this vaccine worthy of further investigation in the pig, the natural host of PCV2.

25

Acknowledgements This work was supported by State 863 High Technology R&D Project (2006AA10A204), Key Technology R&D Programme (2006BAD06A07), the National Basic Research Program (973) of China (2005CB523200) and the National Natural Sciences Foundation of China (No. 30400322). References Abe, T., Hemmi, H., Miyamoto, H., Moriishi, K., Tamura, S., Takaku, H., Akira, S., Matsuura, Y., 2005. Involvement of the Toll-like receptor 9 signaling pathway in the induction of innate immunity by baculovirus. J. Virol. 79, 2847–2858. Abe, T., Takahashi, H., Hamazaki, H., Miyano-Kurosaki, N., Matsuura, Y., Takaku, H., 2003. Baculovirus induces an innate immune response and confers protection from lethal influenza virus infection in mice. J. Immunol. 171, 1133–1139. Allan, G.M., Ellis, J.A., 2000. Porcine Circoviruses: a review. J. Vet. Diagn. Invest. 12, 3–14. Barsoum, J., Brown, R., McKee, M., Boyce, F.M., 1997. Efficient transduction of mammalian cells by a recombinant baculovirus having the vesicular stomatitis virus G glycoprotein. Hum. Gene Ther. 8, 2011–2018. Blanchard, P., Mahe, D., Cariolet, R., Keranflec’h, A., Baudouard, M.A., Cordioli, P., Albina, E., Jestin, A., 2003. Protection of swine against post-weaning multisystemic wasting syndrome (PMWS) by porcine circovirus type 2 (PCV2) proteins. Vaccine 21, 4565–4575. Chang, H.W., Pang, V.F., Chen, L.J., Chia, M.Y., Tsai, Y.C., Jeng, C.R., 2006. Bacterial lipopolysaccharide induces porcine circovirus type 2 replication in swine alveolar macrophages. Vet. Microbiol. 115, 311–319. Cheung, A.K., Bolin, S.R., 2002. Kinetics of porcine circovirus type 2 replication. Arch. Virol. 147, 43–58. Facciabene, A., Aurisicchio, L., La Monica, N., 2004. Baculovirus vectors elicit antigenspecific immune responses in mice. J. Virol. 78, 8663–8672. Fan, H., Chen, H., Tong, T., Ju, C., Lu, J., Huang, H., 2005. The expression of porcine circovirus type 2 ORF2 gene in insect cells and its character. Acta J. Biotechnol. 21, 975–978. Fan, H., Xiao, S., Fang, L., Chen, H., 2007. Efficient transduction of porcine kidney cells with pseudotype baculovirus. J. Huazhong Agric. Univ. 26, 478–481. Fan, H., Xiao, S., Tong, T., Wang, S., Xie, L., Jiang, Y., Chen, H., Fang, L., 2008. Immunogenicity of porcine circovirus type 2 capsid protein targeting to different subcellular compartments. Mol. Immunol. 45, 653–660. Fenaux, M., Opriessnig, T., Halbur, P.G., Elvinger, F., Meng, X.J., 2004. A chimeric porcine circovirus (PCV) with the immunogenic capsid gene of the pathogenic PCV type 2 (PCV2) cloned into the genomic backbone of the nonpathogenic PCV1 induces protective immunity against PCV2 infection in pigs. J. Virol. 78, 6297–6303. Gronowski, A.M., Hilbert, D.M., Sheehan, K.C., Garotta, G., Schreiber, R.D., 1999. Baculovirus stimulates antiviral effects in mammalian cells. J. Virol. 73, 9944–9951. Haruna, J., Hanna, P., Hurnik, D., Ikede, B., Miller, L., Yason, C., 2006. The role of immunostimulation in the development of postweaning multisystemic wasting syndrome in pigs under field conditions. Can. J. Vet. Res. 70, 269–276. Hervas-Stubbs, S., Rueda, P., Lopez, L., Leclerc, C., 2007. Insect baculoviruses strongly potentiate adaptive immune responses by inducing type I IFN. J. Immunol. 178, 2361–2369. Hofmann, C., Sandig, V., Jennings, G., Rudolph, M., Schlag, P., Strauss, M., 1995. Efficient gene transfer into human hepatocytes by baculovirus vectors. Proc. Natl. Acad. Sci. U.S.A. 92, 10099–10103. Kamstrup, S., Barfoed, A.M., Frimann, T.H., Ladekjaer-Mikkelsen, A.S., Botner, A., 2004. Immunisation against PCV2 structural protein by DNA vaccination of mice. Vaccine 22, 1358–1361. Kost, T.A., Condreay, J.P., Jarvis, D., 2005. Baculovirus as versatile vectors for protein expression in insect and mammalian cells. Nat. Biotechnol. 23, 567–575. Liu, J., Chen, I., Kwang, J., 2005. Characterization of a previously unidentified viral protein in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis. J. Virol. 79, 8262–8274. Lu, L., Yu, L., Kwang, J., 2007. Baculovirus surface-displayed hemagglutinin of H5N1 influenza virus sustains its authentic cleavage, hemagglutination activity, and antigenicity. Biochem. Biophys. Res. Commun. 358, 404–409. Mankertz, A., Domingo, M., Folch, J.M., LeCann, P., Jestin, A., Segales, J., Chmielewicz, B., Plana-Duran, J., Soike, D., 2000. Characterisation of PCV-2 isolates from Spain, Germany and France. Virus Res. 66, 65–77. Meerts, P., Misinzo, G., Lefebvre, D., Nielsen, J., Botner, A., Kristensen, C.S., Nauwynck, H.J., 2006. Correlation between the presence of neutralizing antibodies against porcine circovirus 2 (PCV2) and protection against replication of the virus and development of PCV2-associated disease. BMC Vet. Res. 2, 6. Meerts, P., Misinzo, G., Nauwynck, H.J., 2005. Enhancement of porcine circovirus 2 replication in porcine cell lines by IFN-gamma before and after treatment and by IFN-alpha after treatment. J. Interferon Cytokine Res. 25, 684–693. Nawagitgul, P., Morozov, I., Bolin, S.R., Harms, P.A., Sorden, S.D., Paul, P.S., 2000. Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J. Gen. Virol. 81, 2281–2287. Pogranichnyy, R.M., Yoon, K.J., Harms, P.A., Swenson, S.L., Zimmerman, J.J., Sorden, S.D., 2000. Characterization of immune response of young pigs to porcine circovirus type 2 infection. Viral Immunol. 13, 143–153.

26

H. Fan et al. / Journal of Virological Methods 150 (2008) 21–26

Resendes, A., Segales, J., Balasch, M., Calsamiglia, M., Sibila, M., Ellerbrok, H., Mateu, E., Plana-Duran, J., Mankertz, A., Domingo, M., 2004. Lack of an effect of a commercial vaccine adjuvant on the development of postweaning multisystemic wasting syndrome (PMWS) in porcine circovirus type 2 (PCV2) experimentally infected conventional pigs. Vet. Res. 35, 83–90. Roca, M., Balasch, M., Segales, J., Calsamiglia, M., Viaplana, E., Urniza, A., Hattermann, K., Mankertz, A., Plana-Duran, J., Domingo, M., 2004. In vitro and in vivo characterization of an infectious clone of a European strain of porcine circovirus type 2. J. Gen. Virol. 85, 1259–1266. Shoji, I., Aizaki, H., Tani, H., Ishii, K., Chiba, T., Saito, I., Miyamura, T., Matsuura, Y., 1997. Efficient gene transfer into various mammalian cells, including non-hepatic cells, by baculovirus vectors. J. Gen. Virol. 78, 2657–2664. Song, Y., Jin, M., Zhang, S., Xu, X., Xiao, S., Cao, S., Chen, H., 2007. Generation and immunogenicity of a recombinant pseudorabies virus expressing cap protein of porcine circovirus type 2. Vet. Microbiol. 119, 97–104.

Strauss, R., Huser, A., Ni, S., Tuve, S., Kiviat, N., Sow, P.S., Hofmann, C., Liebe, A., 2007. Baculovirus-based vaccination vectors allow for efficient induction of immune responses against plasmodium falciparum circumsporozoite protein. Mol. Ther. 15, 193–202. Wang, X., Jiang, W., Jiang, P., Li, Y., Feng, Z., Xu, J., 2006. Construction and immunogenicity of recombinant adenovirus expressing the capsid protein of porcine circovirus 2 (PCV2) in mice. Vaccine 24, 3374–3380. Xiao, S., Chen, H., Fang, L., Liu, C., Zhang, H., Jiang, Y., Hong, W., 2004. Comparison of immune responses and protective efficacy of suicidal DNA vaccine and conventional DNA vaccine encoding glycoprotein C of pseudorabies virus in mice. Vaccine 22, 345–351. Yang, D., Chung, Y., Lai, Y., Lai, C., Liu, H., Hu, Y., 2007. Avian influenza virus hemagglutinin display on baculovirus envelope: cytoplasmic domain affects virus properties and vaccine potential. Mol. Ther. 15, 989–996.