- Email: [email protected]
Construction of a new cloning vector utilizing a cryptic plasmid and the highly expressed melanin-synthesizing gene operon from Streptomyces castaneoglobisporus
FEMS Microbiology Letters 168 (1998) 195^199
Construction of a new cloning vector utilizing a cryptic plasmid and the highly expressed melanin-synthesizing gene operon from Streptomyces castaneoglobisporus Kayo Ikeda a , Koji Suzuki b , Hideki Yoshioka c , Katsushiro Miyamoto d , Tsutomu Masujima a , Masanori Sugiyama a * a
Institute of Pharmaceutical Sciences, Hiroshima University School of Medicine, Kasumi 1-2-3, Minami-ku, Hiroshima 734-8551, Japan b Department of Chemistry and Material Engineering, Ibaraki National College of Technology, Nakane 866, Hitachinaka, Ibaraki 312-8508, Japan c Laboratory of Special Chemicals, Nippon Kayaku Co. Ltd., Iwahana-machi, Takasaki, Gunma 370-1208, Japan d Osaka University of Pharmaceutical Sciences, Takatsuki, Osaka 569-1041, Japan Received 25 August 1998; received in revised form 16 September 1998; accepted 18 September 1998
Abstract Streptomyces castaneoglobisporus HUT6202 overproduces a diffusible melanin pigment and harbors a cryptic 7.4-kb plasmid, pHY6202. We constructed a Streptomyces cloning vector, pSY10CMM, consisting of the HUT6202 rep gene, the thiostrepton resistance gene and an operon encoding the synthesis of melanin pigment, abbreviated mel, from S. castaneoglobisporus. The vector, which has SphI and BamHI sites as cloning sites with insertional inactivation of the mel, is a more convenient cloning vector than commonly used pIJ702, because of its broad host range for antibiotic-producing Streptomyces strains and its much greater production of diffusible melanin pigment. z 1998 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Cloning vector; Melanin pigment ; Streptomyces castaneoglobisporus
1. Introduction Most plasmids found in the streptomycetes are physiologically cryptic, except plasmids encoding the production and resistance to methylenomycin A * Corresponding author. Tel.: +81 (82) 257-5280; Fax: +81 (82) 257-5284; E-mail: [email protected] Abbreviations: Bm, bleomycin; mel, an operon encoding the synthesis of melanin pigment; rep, the gene encoding a protein essential for replication; Ts, thiostrepton
and pock-formation [1,2]. Several genes encoding the antibiotic-resistant determinants have been cloned from antibiotic-producing microorganisms using pock-forming plasmids [2^4]. Genes cloned by these plasmids have become useful markers in DNA technology to Streptomyces [5,6]. S. lividans ISP 5434 harbors four small high copy plasmids, pIJ101 and its natural deletion variants pIJ102, pIJ103 and pIJ104 [7]. A cloning vector pIJ702, carrying the pIJ102 replicon, is commonly used for Streptomyces gene manipulation [6]. This
0378-1097 / 98 / $19.00 ß 1998 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 8 ) 0 0 4 4 1 - 8
FEMSLE 8442 5-11-98
196
K. Ikeda et al. / FEMS Microbiology Letters 168 (1998) 195^199
vector uses the thiostrepton (Ts)-resistance gene and an operon responsible for synthesis of melanin pigment (mel), as selective genetic markers. The mel is convenient due to its cloning sites which are insertionally inactivated. However, it has been reported that Streptomyces species such as S. jumonjinensis, S. clavuligerus and S. kasugaensis, transformed with pIJ702, become resistant to Ts, but do not produce melanin pigment [8]. As shown in the present study, S. griseus transformed with pIJ702, also exhibited the same phenotypic characteristics as the above strains. Thus, not all Ts-resistant Streptomyces strains, transformed with pIJ702, express the mel, suggesting that the pIJ702 mel is not useful as an insertional inactivated-marker gene. Tyrosinase (o-diphenenol:oxygen oxidoreductase, EC 1.14.18.1), a copper-containing monooxygenase, is responsible for the production of melanin pigment from L-tyrosine [9]. Since we found that among the melanin pigment-producing streptomycetes S. castaneoglobisporus HUT6202 produces a greater amount of di¡usible melanin pigment, mel, which consists of the tyrosinase gene and an additional open reading frame (378 bp), has been cloned from its chromosomal DNA [10]. The tyrosinase activity of S. lividans carrying this mel was 110-fold higher than that of the same host transformed with pIJ702 [10]. In the present study, we found that S. castaneoglobisporus HUT6202 harbors a high copy plasmid, designated pHY6202. We constructed a cloning vector that should be useful in Streptomyces hosts in which the pIJ702 mel is not expressed, by utilizing the pHY6202 rep and the S. castaneoglobisporus mel.
2. Materials and methods 2.1. Plasmid and DNA fragment used for cloning A cloning vector, pIJ702 [6] was used as a source of Ts-resistance gene. A 3-kb BamHI fragment containing a bleomycin (Bm)-resistant gene, inserted into pUC18 [11,12], was used to subclone into the vector constructed in this study. 2.2. DNA manipulations Plasmid from Streptomyces was isolated according
to the method of Kieser [13]. Preparation, transformation and regeneration of Streptomyces protoplasts were carried out as described by Thompson et al. [5]. DNA sequencing was done by the dideoxy-DNA chain-termination method [14] using an auto-sequencer (Applied Biosystems, USA).
3. Results and discussion 3.1. Construction of a cloning vector pSY10CMM In this study, we found that S. castaneoglobisporus HUT6202 harbors a high copy 7.4-kb plasmid, designated pHY6202. Fig. 1 shows the restriction map of pHY6202. To develop the cryptic pHY6202 as a cloning vector we subcloned the 1.05 kb BclI fragment containing Ts-resistance gene from pIJ702, into the single BamHI site in pHY6202. After the S. lividans 1326 protoplasts, transformed with the chimeric plasmid, were regenerated, Ts (50 Wg ml31 ) resistantcolonies were selected and analyzed for the presence of the plasmid. The plasmid, designated pHY12, was able to replicate in several antibiotic-producing strains, including S. aureofaciens KCC S-0008, S. griseochromogenes HUT6232, S. fradiae HUT6096, S. kanamyceticus HUT6231, S. griseus 2247, Streptomyces sp. H1061-MY11 and Streptomyces sp. H1089-MY 28 was resistant to tetracycline, blasticidin S, neomycin, kanamycin, streptomycin, polyoxin and antimycin, respectively. This broad host range of pHY12 for antibiotic-producing streptomycetes, suggests that this plasmid is useful for genetic engineering in these antibiotic-producing, and hence, resistant hosts. We measured plasmid copy-number according to the method reported elsewhere [7]. The number of copies of pHY12 in both strains H1061-MY11 and H1089-MY28, appeared to be about 80. We deleted a region non-essential for replication, by digesting the plasmid with BamHI and BclI. The resulting large fragment (4.3 kb) was ligated to the BclI-cleaved pIJ702 containing the Ts-resistance gene (Fig. 1) to generate pSY10. The plasmid number of copies was 70^80 in S. lividans 66. The nucleotide sequence of the 4261-bp DNA fragment except Ts-resistance gene on pSY10, was determined and deposited in the DNA Data Bank of Japan
FEMSLE 8442 5-11-98
K. Ikeda et al. / FEMS Microbiology Letters 168 (1998) 195^199
197
Fig. 1. Construction strategy of pSY10CMM and its restriction enzyme map. mel, the operon encoding the synthesis of melanin pigment; tsr, thiostrepton resistance gene ; rep, the gene encoding a protein essential for replication; spd, an essential gene for e¡ective plasmid transfer within recipient cell ; orf68, the open reading frame, which is unidenti¢ed, consists of 68 amino acids; ori, replication origin. The nucleotide sequence was deposited in the DDBJ databases under accession no. AB016241.
(DDBJ) databases under the accession number AB016241. The results of this sequence analysis and an insertional experiment of a DNA segment
into the BglII site on pSY10 suggest that the rep and the replication origin of this plasmid are located near BglII site (Fig. 1).
FEMSLE 8442 5-11-98
198
K. Ikeda et al. / FEMS Microbiology Letters 168 (1998) 195^199
pSY10CMM has two unique restriction sites, SphI and BamHI, in the mel. 3.2. Use of pSY10CMM as a cloning vector
Fig. 2. Melanin pigment production by S. lividans 66 (A) and S. griseus PSR-2 (B) transformed with pSY10CMM or pIJ702. These strains were grown on TYR-FB medium containing 50 Wg Ts ml31 [10] at 28³C for 3 days.
Since the mel from S. castaneoglobisporus has two SphI sites [9], we substituted one of these SphI sites with a BamHI site generated by using the altered sites II-in vitro mutagenesis kit (Promega, USA) and a TGCCGGTAGGATCCGTCGTCACC primer. The mutant mel, digested with SmaI, was inserted into pSY10 blunt ended with T4 DNA polymerase after digestion with SphI. This new cloning vector
Fig. 2A shows that S. lividans 66 transformed with pSY10CMM produces a larger amount of melanin pigment than the same strain harboring pIJ702. In fact, the tyrosinase activity of the transformed cell was at approximately a 110-fold higher level than that of the same host carrying pIJ702. Fig. 2B shows that when pIJ702 was introduced into a streptomycin-high level resistant mutant PSR-2, derived from streptomycin-producing S. griseus [15], its transformed cells became resistant to Ts, but did not produce melanin pigment. In contrast, pSY10CMMtransformed S. griseus PSR-2 produced the melanin pigment (Fig. 2B). These results show that pSY10CMM can be used as cloning vector using insertional inactivation in S. griseus, in which pIJ702 cannot be used. In order to ascertain whether pSY10CMM is useful as a cloning vector, a 3-kb BamHI segment including bleomycin (Bm)-resistant gene from Bm-producing S. verticillus ATCC15003 was subcloned into the BamHI site of the pSY10CMM. S. lividans 66, transformed with the chimeric plasmid, could not produce di¡usible melanin pigment due to insertional inactivation of the mel. The host cell was susceptible to 50 Wg Bm ml31 , whereas the transformed cell was resistant to over 400 Wg Bm ml31 . The transformant-harbored plasmid surely had the 3-kb insert carrying Bm-resistant gene. When S. lividans 66 was transformed with pSY10CMM, the number of transformants obtained per 1 Wg of plasmid DNA was over 106 , this is almost the same e¤ciency as that with pIJ702. The copy-number of pSY10CMM in S. lividans 66 was estimated to be approximately 70 per host chromosome. We previously constructed a promoter-probe vector for E. coli using the mel from S. antibioticus as a reporter gene [16]. The highly expressed mel from S. castaneoglobisporus may contribute to the construction of a new promoter-probe vector which can be used to isolate some weak promoters. The usefulness of pSY10CMM would be enhanced by increasing the number of its unique cloning sites. In conclusion, pSY10CMM, is a more versatile
FEMSLE 8442 5-11-98
K. Ikeda et al. / FEMS Microbiology Letters 168 (1998) 195^199
cloning vector than the commonly used pIJ702 because of its broad host range for antibiotic-producing Streptomyces strains and its much greater production of di¡usible melanin pigment.
References [1] Bibb, M.J., Ward, J.M. and Hopwood, D.A. (1978) Transformation of plasmid DNA into Streptomyces at high frequency. Nature 274, 398^400. [2] Thompson, C.J., Ward, J.M. and Hopwood, D.A. (1980) DNA cloning in Streptomyces: resistance genes from antibiotic-producing species. Nature 286, 525^527. [3] Thompson, C.J., Kieser, T., Ward, J.M. and Hopwood, D.A. (1982) Physical analysis of antibiotic-resistance genes from Streptomyces and their use in vector construction. Gene 20, 51^62. [4] Murakami, T., Nojiri, C., Toyama, H., Hayashi, E., Katumata, K., Anzai, H., Matsuhashi, Y., Yamada, Y. and Nagaoka, K. (1983) Cloning of antibiotic-resistance genes in Streptomyces. J. Antibiotics 36, 1305^1311. [5] Thompson, C.J., Ward, J.M. and Hopwood D.A. (1982) Cloning of antibiotic resistance and nutritional genes in streptomycetes. J. Bacteriol. 151, 668^677. [6] Katz, E., Thompson, C.J. and Hopwood, D.A. (1983) Cloning and expression of the tyrosinase gene from Streptomyces antibioticus in Streptomyces lividans. J. Gen. Microbiol. 129, 2703^2714. [7] Kieser, T., Hopwood, D.A., Wright, H.M. and Thompson, C.J. (1982) pIJ101, a multi-copy broad host-range Streptomyces plasmid : functional analysis and development of DNA cloning vectors. Mol. Gen. Genet. 185, 223^238.
199
[8] Manome, T. (1989) The use of pIJ702 for probing Streptomyces promoters and the construction of pIJ702 derivatives with promoter substitution on mel gene. Actinomycetol. 3, 1^8. [9] Lerch, K. (1981) In: Metal Ions in Biological Systems (Sigel, H., Ed.). vol. 13, pp. 143^184. Dekker, New York. [10] Ikeda, K., Masujima, T., Suzuki, K. and Sugiyama, M. (1996) Cloning and sequence analysis of the highly expressed melanin-synthesizing gene operon from Streptomyces castaneoglobisporus. Appl. Microbiol. Biotechnol. 45, 80^85. [11] Sugiyama, M., Thompson, C.J., Kumagai, T., Suzuki, K., Deblaere, R., Villarroel, R. and Davies, J. (1994) Characterization by molecular cloning of two genes from Streptomyces verticillus encoding resistance to bleomycin. Gene 151, 11^16. [12] Matsuo, H., Mochizuki, H., Davies, J. and Sugiyama M. (1997) Production of bleomycin N-acetyltransferase in Escherichia coli and Streptomyces verticillus. FEMS Microbiol. Lett. 153, 83^88. [13] Kieser, T. (1984) Factors a¡ecting the isolation of cccDNA from Streptomyces lividans and Escherichia coli. Plasmid 12, 19^36. [14] Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463^5467. [15] Sugiyama, M., Katho, T., Mochizuki, H., Nimi, O. and Nomi, R. (1983) Ribosomal resistance to streptomycin in strains regenerated from protoplasts of a streptomycin-susceptible mutant derived from a streptomycin producer. J. Ferment. Technol. 61, 347^351. [16] Sugiyama, M., Nomura, H. and Nimi, O. (1990) Use of the tyrosinase gene from Streptomyces to probe promoter sequences for Escherichia coli. Plasmid 23, 237^241.
FEMSLE 8442 5-11-98
Construction of a new cloning vector utilizing a cryptic plasmid and the highly expressed melanin-synthesizing gene operon from Streptomyces castaneoglobisporus Kayo Ikeda a , Koji Suzuki b , Hideki Yoshioka c , Katsushiro Miyamoto d , Tsutomu Masujima a , Masanori Sugiyama a * a
Institute of Pharmaceutical Sciences, Hiroshima University School of Medicine, Kasumi 1-2-3, Minami-ku, Hiroshima 734-8551, Japan b Department of Chemistry and Material Engineering, Ibaraki National College of Technology, Nakane 866, Hitachinaka, Ibaraki 312-8508, Japan c Laboratory of Special Chemicals, Nippon Kayaku Co. Ltd., Iwahana-machi, Takasaki, Gunma 370-1208, Japan d Osaka University of Pharmaceutical Sciences, Takatsuki, Osaka 569-1041, Japan Received 25 August 1998; received in revised form 16 September 1998; accepted 18 September 1998
Abstract Streptomyces castaneoglobisporus HUT6202 overproduces a diffusible melanin pigment and harbors a cryptic 7.4-kb plasmid, pHY6202. We constructed a Streptomyces cloning vector, pSY10CMM, consisting of the HUT6202 rep gene, the thiostrepton resistance gene and an operon encoding the synthesis of melanin pigment, abbreviated mel, from S. castaneoglobisporus. The vector, which has SphI and BamHI sites as cloning sites with insertional inactivation of the mel, is a more convenient cloning vector than commonly used pIJ702, because of its broad host range for antibiotic-producing Streptomyces strains and its much greater production of diffusible melanin pigment. z 1998 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Cloning vector; Melanin pigment ; Streptomyces castaneoglobisporus
1. Introduction Most plasmids found in the streptomycetes are physiologically cryptic, except plasmids encoding the production and resistance to methylenomycin A * Corresponding author. Tel.: +81 (82) 257-5280; Fax: +81 (82) 257-5284; E-mail: [email protected] Abbreviations: Bm, bleomycin; mel, an operon encoding the synthesis of melanin pigment; rep, the gene encoding a protein essential for replication; Ts, thiostrepton
and pock-formation [1,2]. Several genes encoding the antibiotic-resistant determinants have been cloned from antibiotic-producing microorganisms using pock-forming plasmids [2^4]. Genes cloned by these plasmids have become useful markers in DNA technology to Streptomyces [5,6]. S. lividans ISP 5434 harbors four small high copy plasmids, pIJ101 and its natural deletion variants pIJ102, pIJ103 and pIJ104 [7]. A cloning vector pIJ702, carrying the pIJ102 replicon, is commonly used for Streptomyces gene manipulation [6]. This
0378-1097 / 98 / $19.00 ß 1998 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 8 ) 0 0 4 4 1 - 8
FEMSLE 8442 5-11-98
196
K. Ikeda et al. / FEMS Microbiology Letters 168 (1998) 195^199
vector uses the thiostrepton (Ts)-resistance gene and an operon responsible for synthesis of melanin pigment (mel), as selective genetic markers. The mel is convenient due to its cloning sites which are insertionally inactivated. However, it has been reported that Streptomyces species such as S. jumonjinensis, S. clavuligerus and S. kasugaensis, transformed with pIJ702, become resistant to Ts, but do not produce melanin pigment [8]. As shown in the present study, S. griseus transformed with pIJ702, also exhibited the same phenotypic characteristics as the above strains. Thus, not all Ts-resistant Streptomyces strains, transformed with pIJ702, express the mel, suggesting that the pIJ702 mel is not useful as an insertional inactivated-marker gene. Tyrosinase (o-diphenenol:oxygen oxidoreductase, EC 1.14.18.1), a copper-containing monooxygenase, is responsible for the production of melanin pigment from L-tyrosine [9]. Since we found that among the melanin pigment-producing streptomycetes S. castaneoglobisporus HUT6202 produces a greater amount of di¡usible melanin pigment, mel, which consists of the tyrosinase gene and an additional open reading frame (378 bp), has been cloned from its chromosomal DNA [10]. The tyrosinase activity of S. lividans carrying this mel was 110-fold higher than that of the same host transformed with pIJ702 [10]. In the present study, we found that S. castaneoglobisporus HUT6202 harbors a high copy plasmid, designated pHY6202. We constructed a cloning vector that should be useful in Streptomyces hosts in which the pIJ702 mel is not expressed, by utilizing the pHY6202 rep and the S. castaneoglobisporus mel.
2. Materials and methods 2.1. Plasmid and DNA fragment used for cloning A cloning vector, pIJ702 [6] was used as a source of Ts-resistance gene. A 3-kb BamHI fragment containing a bleomycin (Bm)-resistant gene, inserted into pUC18 [11,12], was used to subclone into the vector constructed in this study. 2.2. DNA manipulations Plasmid from Streptomyces was isolated according
to the method of Kieser [13]. Preparation, transformation and regeneration of Streptomyces protoplasts were carried out as described by Thompson et al. [5]. DNA sequencing was done by the dideoxy-DNA chain-termination method [14] using an auto-sequencer (Applied Biosystems, USA).
3. Results and discussion 3.1. Construction of a cloning vector pSY10CMM In this study, we found that S. castaneoglobisporus HUT6202 harbors a high copy 7.4-kb plasmid, designated pHY6202. Fig. 1 shows the restriction map of pHY6202. To develop the cryptic pHY6202 as a cloning vector we subcloned the 1.05 kb BclI fragment containing Ts-resistance gene from pIJ702, into the single BamHI site in pHY6202. After the S. lividans 1326 protoplasts, transformed with the chimeric plasmid, were regenerated, Ts (50 Wg ml31 ) resistantcolonies were selected and analyzed for the presence of the plasmid. The plasmid, designated pHY12, was able to replicate in several antibiotic-producing strains, including S. aureofaciens KCC S-0008, S. griseochromogenes HUT6232, S. fradiae HUT6096, S. kanamyceticus HUT6231, S. griseus 2247, Streptomyces sp. H1061-MY11 and Streptomyces sp. H1089-MY 28 was resistant to tetracycline, blasticidin S, neomycin, kanamycin, streptomycin, polyoxin and antimycin, respectively. This broad host range of pHY12 for antibiotic-producing streptomycetes, suggests that this plasmid is useful for genetic engineering in these antibiotic-producing, and hence, resistant hosts. We measured plasmid copy-number according to the method reported elsewhere [7]. The number of copies of pHY12 in both strains H1061-MY11 and H1089-MY28, appeared to be about 80. We deleted a region non-essential for replication, by digesting the plasmid with BamHI and BclI. The resulting large fragment (4.3 kb) was ligated to the BclI-cleaved pIJ702 containing the Ts-resistance gene (Fig. 1) to generate pSY10. The plasmid number of copies was 70^80 in S. lividans 66. The nucleotide sequence of the 4261-bp DNA fragment except Ts-resistance gene on pSY10, was determined and deposited in the DNA Data Bank of Japan
FEMSLE 8442 5-11-98
K. Ikeda et al. / FEMS Microbiology Letters 168 (1998) 195^199
197
Fig. 1. Construction strategy of pSY10CMM and its restriction enzyme map. mel, the operon encoding the synthesis of melanin pigment; tsr, thiostrepton resistance gene ; rep, the gene encoding a protein essential for replication; spd, an essential gene for e¡ective plasmid transfer within recipient cell ; orf68, the open reading frame, which is unidenti¢ed, consists of 68 amino acids; ori, replication origin. The nucleotide sequence was deposited in the DDBJ databases under accession no. AB016241.
(DDBJ) databases under the accession number AB016241. The results of this sequence analysis and an insertional experiment of a DNA segment
into the BglII site on pSY10 suggest that the rep and the replication origin of this plasmid are located near BglII site (Fig. 1).
FEMSLE 8442 5-11-98
198
K. Ikeda et al. / FEMS Microbiology Letters 168 (1998) 195^199
pSY10CMM has two unique restriction sites, SphI and BamHI, in the mel. 3.2. Use of pSY10CMM as a cloning vector
Fig. 2. Melanin pigment production by S. lividans 66 (A) and S. griseus PSR-2 (B) transformed with pSY10CMM or pIJ702. These strains were grown on TYR-FB medium containing 50 Wg Ts ml31 [10] at 28³C for 3 days.
Since the mel from S. castaneoglobisporus has two SphI sites [9], we substituted one of these SphI sites with a BamHI site generated by using the altered sites II-in vitro mutagenesis kit (Promega, USA) and a TGCCGGTAGGATCCGTCGTCACC primer. The mutant mel, digested with SmaI, was inserted into pSY10 blunt ended with T4 DNA polymerase after digestion with SphI. This new cloning vector
Fig. 2A shows that S. lividans 66 transformed with pSY10CMM produces a larger amount of melanin pigment than the same strain harboring pIJ702. In fact, the tyrosinase activity of the transformed cell was at approximately a 110-fold higher level than that of the same host carrying pIJ702. Fig. 2B shows that when pIJ702 was introduced into a streptomycin-high level resistant mutant PSR-2, derived from streptomycin-producing S. griseus [15], its transformed cells became resistant to Ts, but did not produce melanin pigment. In contrast, pSY10CMMtransformed S. griseus PSR-2 produced the melanin pigment (Fig. 2B). These results show that pSY10CMM can be used as cloning vector using insertional inactivation in S. griseus, in which pIJ702 cannot be used. In order to ascertain whether pSY10CMM is useful as a cloning vector, a 3-kb BamHI segment including bleomycin (Bm)-resistant gene from Bm-producing S. verticillus ATCC15003 was subcloned into the BamHI site of the pSY10CMM. S. lividans 66, transformed with the chimeric plasmid, could not produce di¡usible melanin pigment due to insertional inactivation of the mel. The host cell was susceptible to 50 Wg Bm ml31 , whereas the transformed cell was resistant to over 400 Wg Bm ml31 . The transformant-harbored plasmid surely had the 3-kb insert carrying Bm-resistant gene. When S. lividans 66 was transformed with pSY10CMM, the number of transformants obtained per 1 Wg of plasmid DNA was over 106 , this is almost the same e¤ciency as that with pIJ702. The copy-number of pSY10CMM in S. lividans 66 was estimated to be approximately 70 per host chromosome. We previously constructed a promoter-probe vector for E. coli using the mel from S. antibioticus as a reporter gene [16]. The highly expressed mel from S. castaneoglobisporus may contribute to the construction of a new promoter-probe vector which can be used to isolate some weak promoters. The usefulness of pSY10CMM would be enhanced by increasing the number of its unique cloning sites. In conclusion, pSY10CMM, is a more versatile
FEMSLE 8442 5-11-98
K. Ikeda et al. / FEMS Microbiology Letters 168 (1998) 195^199
cloning vector than the commonly used pIJ702 because of its broad host range for antibiotic-producing Streptomyces strains and its much greater production of di¡usible melanin pigment.
References [1] Bibb, M.J., Ward, J.M. and Hopwood, D.A. (1978) Transformation of plasmid DNA into Streptomyces at high frequency. Nature 274, 398^400. [2] Thompson, C.J., Ward, J.M. and Hopwood, D.A. (1980) DNA cloning in Streptomyces: resistance genes from antibiotic-producing species. Nature 286, 525^527. [3] Thompson, C.J., Kieser, T., Ward, J.M. and Hopwood, D.A. (1982) Physical analysis of antibiotic-resistance genes from Streptomyces and their use in vector construction. Gene 20, 51^62. [4] Murakami, T., Nojiri, C., Toyama, H., Hayashi, E., Katumata, K., Anzai, H., Matsuhashi, Y., Yamada, Y. and Nagaoka, K. (1983) Cloning of antibiotic-resistance genes in Streptomyces. J. Antibiotics 36, 1305^1311. [5] Thompson, C.J., Ward, J.M. and Hopwood D.A. (1982) Cloning of antibiotic resistance and nutritional genes in streptomycetes. J. Bacteriol. 151, 668^677. [6] Katz, E., Thompson, C.J. and Hopwood, D.A. (1983) Cloning and expression of the tyrosinase gene from Streptomyces antibioticus in Streptomyces lividans. J. Gen. Microbiol. 129, 2703^2714. [7] Kieser, T., Hopwood, D.A., Wright, H.M. and Thompson, C.J. (1982) pIJ101, a multi-copy broad host-range Streptomyces plasmid : functional analysis and development of DNA cloning vectors. Mol. Gen. Genet. 185, 223^238.
199
[8] Manome, T. (1989) The use of pIJ702 for probing Streptomyces promoters and the construction of pIJ702 derivatives with promoter substitution on mel gene. Actinomycetol. 3, 1^8. [9] Lerch, K. (1981) In: Metal Ions in Biological Systems (Sigel, H., Ed.). vol. 13, pp. 143^184. Dekker, New York. [10] Ikeda, K., Masujima, T., Suzuki, K. and Sugiyama, M. (1996) Cloning and sequence analysis of the highly expressed melanin-synthesizing gene operon from Streptomyces castaneoglobisporus. Appl. Microbiol. Biotechnol. 45, 80^85. [11] Sugiyama, M., Thompson, C.J., Kumagai, T., Suzuki, K., Deblaere, R., Villarroel, R. and Davies, J. (1994) Characterization by molecular cloning of two genes from Streptomyces verticillus encoding resistance to bleomycin. Gene 151, 11^16. [12] Matsuo, H., Mochizuki, H., Davies, J. and Sugiyama M. (1997) Production of bleomycin N-acetyltransferase in Escherichia coli and Streptomyces verticillus. FEMS Microbiol. Lett. 153, 83^88. [13] Kieser, T. (1984) Factors a¡ecting the isolation of cccDNA from Streptomyces lividans and Escherichia coli. Plasmid 12, 19^36. [14] Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463^5467. [15] Sugiyama, M., Katho, T., Mochizuki, H., Nimi, O. and Nomi, R. (1983) Ribosomal resistance to streptomycin in strains regenerated from protoplasts of a streptomycin-susceptible mutant derived from a streptomycin producer. J. Ferment. Technol. 61, 347^351. [16] Sugiyama, M., Nomura, H. and Nimi, O. (1990) Use of the tyrosinase gene from Streptomyces to probe promoter sequences for Escherichia coli. Plasmid 23, 237^241.
FEMSLE 8442 5-11-98