- Email: [email protected]
Construction of a plasmid vector for liver-specific inhibition of hepatocyte nuclear factor 4 alpha expression
Plasmid 67 (2012) 60–66
Contents lists available at SciVerse ScienceDirect
Plasmid journal homepage: www.elsevier.com/locate/yplas
Construction of a plasmid vector for liver-specific inhibition of hepatocyte nuclear factor 4 alpha expression Xue-Qin Song a,b,1, En-Qiang Chen a,b,1, Yue-Bin Wang a,b, Tao-You Zhou a,b, Li. Liu a,b, Cong Liu a,b, Xing Cheng a,b, Hong Tang a,b,⇑ a b
Center of Infectious Diseases, West China Hospital of Sichuan University, Chengdu 610041, People’s Republic of China Division of Infectious Diseases, State Key Laboratory of Biotherapy, Sichuan University, Chengdu 610041, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 20 April 2011 Accepted 8 August 2011 Available online 30 August 2011 Communicated by Saleem Khan Keywords: Hepatocyte nuclear factor 4 alpha Short hairpin RNA Liver specific
a b s t r a c t Hepatocyte nuclear factor-4alpha (HNF-4a) is an important transcription factor in the liver, and regulates a large number of genes involved in many aspects of hepatocyte functions. In this study, a liver-specific transcriptional regulatory element comprised of albumin promoter (ALBp) and alpha-fetoprotein enhancer (AFPe) was obtained and cloned into the plasmid pHNF4sh-CMV(short hairpin RNA targeting HNF4a) with original CMV promoter removed, resulting to pHNF4sh-EP for liver-specific knockdown of HNF4a expression. In an attempt to verify its characteristics, pHNF4sh-EP was transfected to L02, HepG2, and COS1 cell lines in vitro and delivered into mice in vivo. pHNF4sh-CMV and pNCsh-EP were used as controls. For in vitro, the level of HNF4a mRNA and protein was decreased in all cell lines transfected with pHNF4sh-CMV whereas HNF4a mRNA and protein decreasing was only observed in L02 and HepG2 cell lines upon transfection with pHNF4sh-EP, and this decreasing was more significant as compared with pHNF4sh-CMV transfected cells. For in vivo, the decreasing of HNF4a mRNA and protein was observed in both liver and kidney tissues upon transfection with pHNF4sh-CMV. After transfection with pHNF4sh-EP, decreasing of HNF4a mRNA and protein was only found in liver tissue and this decreasing was more significant. No obvious HNF4a mRNA and protein decreasing was detected either in vitro or in vivo after transfected with pNCsh-EP. In conclusion, pHNF4sh-EP could highly-active and liver-specific knockdown of HNF4a expression liver and it will be useful for further study of the funcitions of HNF4a in liver. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Hepatocyte nuclear factors (HNFs) network is one of the most investigated tissue-specific regulatory systems which control the specification and maintenance of hepatic cells (Lazarevich et al., 2010; Parviz et al., 2003). Nuclear receptor HNF4a, as one of the central elements of this regulatory net-
⇑ Corresponding author at: Center of Infectious Diseases, West China Hospital of Sichuan University, Chengdu 610041, People’s Republic of China. Fax: +86 28 85423052. E-mail address: [email protected] (H. Tang). 1 Contributed equally to this paper. Supported by the National Natural Science Foundation of China (No. 30972622) and the National Basic Research Program Of China (No.2007CB512902). 0147-619X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.plasmid.2011.08.001
work in the liver (Watt et al., 2003), regulates nearly fortytwo percent of all hepatocyte genes. Evidence showed that HNF4a was essential for differentiation and development of the liver during embryogenesis (Chen et al., 1994), and modulates the expression of genes involved in cholesterol, xenobiotic, amino-acid, carbohydrate, and lipid metabolism (Cheung et al., 2003; Hanniman et al., 2006; Inoue et al., 2006; Miura et al., 2006). Recently, someone reported that HNF4a also could regulate cytokine-induced inflammatory response in hepatic cells (Guo et al., 2003; Li et al., 2002), and the deregulation of this gene was associated with hepatocellular carcinoma (HCC) progression and induced the increase of proliferation rate, loss of epithelial morphology, dedifferentiation and metastasis (Costa et al., 2003; Lazarevich et al., 2010). In our previous work, we found
61
X.-Q. Song et al. / Plasmid 67 (2012) 60–66 Table 1 The information of plasmid involved in this study. Plasmid
Characteristics
Source
pSilence4.1-CMV/neo
Small interference RNA (siRNA) expression vector which employs a CMV promoter to drive the expression of cloned short hairpin RNA (shRNA) templates in a wide variety of cell types. Containg a liver- specific expression element AFPe-ALBp (EP) Expressing a short hairpin siRNA with limited homology to any known sequences in the human, mouse, and rat genomes. Employing a CMV promoter to drive the expression of shRNA targeting HNF4a Employing a liver-specific EP regulatory sequence to drive the expression of shRNA targeting HNF4a
Ambion corporation
pMD18-T/AFPe-ALBp pNCsh-CMV pHNF4sh-CMV pHNF4sh-EP
HNF4a also could support hepatitis B virus (HBV) replication by stimulating the transcription of the precore RNA and core RNA from the HBV core promoter (Tang et al., 2001b). Thus, the function of HNF4a is diverse, and it plays a key role in life cycle of cells. To further investigate the role of HNF4a, there is an urgent need of simple tools which could effectively regulate the expression of HNF4a. RNA interference (RNAi), as a system within living cells, takes part in controlling which genes are active and how active they are, and it has been widely exploited in experimental biology to study the function of genes in cell culture and in vivo in model organisms (Karagiannis and El-Osta, 2005). Previous studies had showed that HNF4a not only expressed in liver, but also in kidney, heart, spleen, intestine, even at different levels (Long et al., 2006). So how to liver-specifically silence HNF4a expression is concerned by scientists. However, current available RNAi plasmids targeting HNF4a directed gene silencing in many cells and tissues, which greatly embarrassed the function study of HNF4a in liver. Recently, we successfully constructed a highly active and liver-specific transcriptional regulatory element, by combining the albumin promoter (ALBp) and a-fetoprotein enhancer (AFPe), and we found it could be used as a tool to induce target gene expression in a liver-specific manner (Chen et al., 2011). In present study, we aimed to construct a liver-specific RNAi plasmid targeting HNF4a under the control of AFPe-ALBp. In addition, the characteristics of this novel RNAi plasmid would be confirmed.
2. Materials and methods 2.1. Cells and animals used in this study Human hepatoma cells (HepG2), normal liver cells (L02) and African green monkey kidney cells (COS1) were
Our laboratory Ambion corporation Our laboratory Current study
conserved in our laboratory. HepG2 was maintained in DMEM (Invitrogen) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 lg/ml streptomycin. L02 and COS1 were grown in RPMI 1640 Medium (Invitrogen) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 lg/ml streptomycin. All cells were cultured at 37 °C in a humidified incubator with 5% CO2. Male BALB/c mice, 7–8 weeks old and weighing 18–20 g, were obtained from Huaxi Laboratory Animal Center of Sichuan University (Chengdu, China) and housed in our laboratory. 2.2. Plasmids used in this study pSilence4.1-CMV/neo was purchased from Ambion Corporation and used as a plasmid vector in the construction of pHNF4sh-CMV which expressed short hairpin RNA targeting HNF4a inducing by CMV promoter. pMD18-T/ AFPe-ALBp was used as the PCR template for the AFPeALBp (EP) elememt gene (Chen et al., 2011). RNAi sequence targeting HNF4a was designed by our laboratory, and detailed information of all plasmid and sequence involved in present study was summarized in Tables 1 and 2. 2.3. Construction of pHNF4sh-EP recombinant plasmid RNAi sequence targeting HNF4a which can knock down HNF4a expression in various cells was inserted to pSilence4.1-CMV/neo, resulting to pHNF4sh-CMV (unpublished data). The EP element was isolated from pMD18-T/ AFPe-ALBp by digesting with EcoRI and BamHI, and was cloned into pHNF4sh-CMV after digested by the same EcoRI and BamHI to substitute the CMV promotor, resulting in the recombinant plasmid pHNF4sh-EP. Plasmids in this study were identified by restriction enzyme digestion and gene sequence.
Table 2 The information of gene sequence involved in this study. Name
Description
AFPe
Accession number: AJ006475; Mus musculus AFP enhancer: 1339–1638 bp Accession number: J04738; Mus musculus ALB promoter: 1820–2070 bp See reference (Chen et al., 2011) Accession number: X87870 Top template strands: 50 -GATCCCCACATGTACTCCTGCAGA TTCAAGAGATCTGCAGGAGTACATGTGGTTA-30 Bottom template strands: 50 -AGCTTAACCACATGTACTCCTGCAGA TCTCTTGAATCTGCAGGAGTACATGTGGG-30
ALBp AFPe- ALBp (EP) HNF4a RNAi sequence of HNF4a in pHNF4sh-EP
62
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
The sequence of HNF4alfa targeted by above plasmid was AACCACATGTACTCCTGCAGA, and its position in HNF4alfa gene was 244 (Table 2).
plasmid was dissolved in 2 mL normal saline and injected via the tail vein within 5–8 s; mice were sacrificed 3 days later, and liver or kidney tissues were collected for isolation of total RNA or protein.
2.4. The transfection of pHNF4sh-EP in vitro and in vivo In an attempt to verify the characteristics of pHNF4shEP in vitro, liver derived cell lines (L02 and HepG2) and non-liver derived cell line (COS1) were passaged and plated in 6-cm culture plates for 24 h before transfection at 80–90% confluence. The pHNF4sh-EP (10 lg) was transfected to above cells with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) in Opti-MEM serum free culture medium for 6 h at 37 °C, 5% CO2, and then changed to normal medium with 10% fetal bovine serum. Finally, cells were collected for isolation of total RNA or protein. In this experiment, above cells transfected with pHNF4sh-CMV were used as control. In vivo experiment, pHNF4sh-EP was transfected into BALB/c mice via hydrodynamic-based injection (hydrodynamic in vivo transfection). And pHNF4sh-CMV was used as control. For hydrodynamic-based injection, 50 lg of
2.5. Reverse transcription-polymerase chain reaction Total RNA was isolated using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. A 0.5 lg sample of total RNA was employed for synthesis of first-strand cDNA with an M-ML RT kit (Promega). For amplification of HNF4a cDNA, the primer sequences were 50 -GGT CAA GCT ACG AGG ACA GC -30 (sense) and 50 - ATC CAG AAG GAG TTC GCA GA -30 (antisense). And the cDNA was amplified in a 50 ll reaction system. PCR products were initiated at 94 °C for 2 min, followed by 35 cycles of amplification (denaturation at 94 °C for 30 s, annealing at 55 °C 30 s, and extension at 72 °C for 25 s) with a final primer extension at 72 °C for 2 min. Final PCR products were separated on 2% agarose gel and stained with ethidium bromide. The PCR product of HNF4a was 220 base pairs (bp) in length.
Fig. 1. Schematic diagram for the construction of pHNF4sh-EP, a liver-specific RNAi plasmid targeting HNF4a.
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
63
Fig. 2. Inhibition of HNF4a mRNA transcription in vitro determined by RT-PCR. (A): no intervention; (B): treated with pNCsh-EP; (C): treated with pHNF4sh-CMV; (D): treated with pHNF4sh-EP. The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. The level of HNF4a mRNA in group A was set to 1, and the relative levels of groups B, C and D were calculated accordingly. The relative levels of HNF4a mRNA in groups A, B, C and D were 1.000, 0.992, 0.604 and 0.180, respectively in L02 cells; 1.000, 1.141, 0.607 and 0.205, respectively in HepG2 cells; and 1.000, 1.045, 0.589 and 0.921, respectively in COS1 cells. And the difference in decreasing levels of HNF4a mRNA between group C and D was significant among L02, HepG2 or COS1 cells, respectively (P < 0.05 for all).
The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. 2.6. Western blotting Total protein was extracted using Protein Extraction Kit. Protein concentration was determined by a BCA protein assay kit. A 30-lg protein extracts was separated by denaturing SDS–polyacrylamide gel electrophoresis and then electro-blotted to a PVDF membrane. The membranes were then incubated with each primary antibody for HNF4a (Santa Cruz, CA, USA) or GAPDH (ZHONGSHAN, Beijing, China), followed by incubation with an HRP-conjugate secondary antibody. The HNF4a and GAPDH bands were visualized with the Immobilon Western chemiluminescent HRP Substrate kit (Milipore, USA) and then exposed to X-ray film. Monoclonal anti-GAPDH antibody was used as an internal control for loading. 2.7. Statistical analysis Quantitative variables were expressed as mean and standard deviation. Comparisons between groups of
quantitative were performed using the student t -test. A P-value of less than 0.05 (two-tailed) was considered to indicate a significant difference. All statistical analyses were performed using the SPSS software package version 13.0 (SPSS Inc., Chicago, IL). 3. Results and discussion 3.1. The successful construction of pHNF4sh-EP RNAi is a process that effectively silences gene expression at the post-transcriptional level with a complex RNA–protein interactions cascade, and it has been widely applied in the functional study of genes and gene therapy (Milhavet et al., 2003). Gene therapy is the process of introduction of genetic material into target cells or tissues. However, liver-specific down-regulation of gene cannot be achieved by short hairpin RNA (shRNA) generated by RNA polymerase III promoter. Recently, some studies reported that ALBp induced a more sustained transgene expression in liver tissue as compared to other promoters (Herweijer et al., 2001; Wooddell et al., 2008), and AFP enhancers could regulate the adjacent ALB gene (Vacher
Fig. 3. Inhibition of HNF4a protein expression in vitro determined by Western blotting. (A): no intervention; (B): treated with pNCsh-EP; (C): treated with pHNF4sh-CMV; (D): treated with pHNF4sh-EP. The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. The level of HNF4a protein in group A was set to 1, and the relative levels of groups B, C and D were calculated accordingly. The relative levels of HNF4a protein in groups A, B, C and D were1.000,1.027, 0.792 and 0.414, respectively in L02 cells; 1.000, 1.058, 0.721 and 0.277, respectively in HepG2 cells; and 1.000, 0.914, 0.396 and 0.761, respectively in COS1 cells. And the difference in decreasing levels of HNF4a protein between group C and D was significant among L02, HepG2 or COS1 cells, respectively (P<0.05 for all).
64
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
3.2. Efficiency and liver-specific effect of pHNF4sh-EP in vitro
Fig. 4. Inhibition of HNF4a mRNA transcription in vivo determined by RT-PCR. (A): no intervention; (B): treated with pNCsh-EP; (C): treated with pHNF4sh-CMV; (D): treated with pHNF4sh-EP.The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. The levels of HNF4a mRNA in group A was set to 1, and the relative levels of groups B,C and D were calculated accordingly. In liver tissue, the relative levels of HNF4a mRNA in groups A, B, C and D were 1.000, 0.984 ± 0.029, 0.612 ± 0.020, 0.297 ± 0.002; In kidney tissue, the relative levels of HNF4a mRNA in groups A, B, C and D were 1.000, 0.998 ± 0.011, 0.582 ± 0.045, 0.893 ± 0.012, respectively. And significant more decreasing of HNF4a mRNA was found in group D as compared to group C in liver tissue (P < 0.05). There were three mice in each group, and the experiment was repeated three times.
and Tilghman, 1990; Wen et al., 1991). In this study, by using the liver-specific genetic regulatory element (named AFPe-ALBp, EP) we previously constructed, a highly-active and liver-specific eukaryotic expression RNAi vector (named pHNF4sh-EP) targeting HNF4a was constructed in present study. Firstly, a plasmid named pHNF4sh-CMV was constructed. After negative control RNAi sequence of pSilence4.1-CMV/neo vector was removed by restriction digestion, the hairpin structure of shRNA with same restriction site was directly inserted downstream from the CMV promoter, resulting in pHNF4sh-CMV (unpublished data). For construction of pHNF4sh-EP (Fig. 1), the AFPe-ALBp (EP) sequence was extracted from pMD18-TAFPe-ALBp, and our previous work had already confirmed that this EP sequence could be used as a tool to induce liver-specific expression of a target gene (Chen et al., 2011). Then EP sequence was subcloned into pHNF4shCMV that had been prepared by EcoRI/BamHI restriction with CMV promoter sequence removed. Additionally, the liver-specific general RNAi plasmid named pNCsh-EP was also constructed by replacing the CMV promoter of pNCsh-CMV with EP. The authenticity of the plasmids constructed in this experiment was identified by endonuclease digestion and sequencing. In this study, pNCsh-EP was used as a negative control, and pHNF4sh-CMV was used as a positive control, which could knockdown HNF4a expression regardless of cell and tissue types. So, the liver-specific and highly-active characteristics of pHNF4sh-EP were assessed by comparison with pHNF4sh-CMV.
As we know, HNF4a not only expressed in liver, but also expressed in kidney and intestine (Long et al., 2006). RNAi as a newly developed technology is increasingly used to knockdown HNF4a expression in experiments (Wang et al., 2011). However, current available RNAi plasmids targeting HNF4a have no cell- or tissue-selectivity, which may cause unexpected side-effects. Thus it is important to construct a liver-specific RNAi plasmid targeting HNF4a. In our previous work, we found that AFPe could enhance target gene expression under the control of ALBp; and successfully established a AFPe-ALBp regulated plasmid named pVAX-AFPe-ALBp-S inducing hepatitis B surface antigen (HBsAg) coding gene expression, and our experiments showed that HBsAg coded by pVAX-AFPeALBp-S was only detected in hepatic cells and liver (Chen et al., 2011). These results suggested that the sequence of AFPe-ALBp could induce target gene expression at liverspecific manner. Based on these findings, we constructed an AFPe-ALBp regulated HNF4a RNAi plasmid. To evaluate the hepatic specificity in vitro, pHNF4sh-EP as well as two control plasmids (pHNF4sh-CMV and pNCsh-EP) was transiently transfected into L02, HepG2and COS1 cell lines. The relative levels of HNF4a mRNA in cells transfected with various plasmids was showed in Fig. 2. No obvious HNF4a mRNA decreasing was detected in L02, HepG2, or COS1 cells transfected with pNCsh-EP. HNF4a mRNA decreasing was detected in all cell lines transfected with pHNF4sh-CMV whereas HNF4a mRNA decreasing was only observed in L02 and HepG2 cell lines upon transfection with pHNF4sh-EP. In this experiment, the relative levels of HNF4a protein in cells transfected with various plasmids was also calculated (Fig. 3). The same decreasing trend was found in HNF4a protein expression. Above data indicated that pHNF4sh-EP constructed in this study could liver-specific down-regulate HNF4a expression. Interesting, we also found the levels of HNF4a mRNA decreased more significantly in pHNF4sh-EP transfected hepatic cells, as compared with pHNF4sh-CMV transfected hepatic cells. And this situation was also found in the relative levels of HNF4a protein in cells transfected with various plasmids. These data further indicated that pHNF4sh-EP could knockdown HNF4a expression in hepatic cells in vitro more effectively. 3.3. Highly-active and liver-specific inhibition of HNF4a expression in vivo The results from vitro study had showed the efficiency and liver-specific effect of pHNF4sh-EP to a certain degree. In this experiment, the characteristics of pHNF4sh-EP were also verified in vivo. The relative levels of HNF4a mRNA and protein in liver and kidney tissues were presented in Figs. 4 and 5. The relative levels of HNF4a mRNA were not affected in liver or kidney tissues after pNCsh-EP transfection. Decreasing of HNF4a mRNA and protein was observed in both liver and kidney tissues upon transfection with pHNF4sh-CMV. After transfection with pHNF4sh-EP, decreasing of HNF4a mRNA and protein was only found in liver. The expression decreasing of HNF4a in liver
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
65
Fig. 5. Inhibition of HNF4a protein expression in vivo determined by Western blotting. (A): no intevention; (B): treated with pNCsh-EP; (C): treated with pHNF4sh-CMV; (D): treated with pHNF4sh-EP.The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. The levels of HNF4a protein in group A was set to 1, and the relative levels of groups B,C and D were calculated accordingly. In liver tissue, the relative levels of HNF4a protein in groups A, B, C and D were 1.000, 1.013 ± 0.024, 0.715 ± 0.007, 0.288 ± 0.014; In kidney tissue, the relative levels of HNF4a protein in groups A, B, C and D were 1.000, 0.945 ± 0.026, 0.545 ± 0.015, 0.983 ± 0.002, respectively. And significant more decreasing of HNF4a protein was found in group D as compared to group C in liver tissue (P < 0.05). There were three mice in each group, and the experiment was repeated three times.
tissues further and clearly suggested that pHNF4sh-EP could down-regulate the expression of HNF4a effectively and liver-specific in vivo. Some studies reported that ALBp could induce a more sustained target gene expression in liver tissue as compared to other promoters (Herweijer et al., 2001), and in another transfection experiments, AFP enhancers were reported to strongly stimulate ALBp expression in cells that silence the AFP promoter (Jin et al., 1995). In this study, shRNA plasmid was controlled by AFP enhancer and ALB promoter, and our previous results also indicated the combination of AFP enhancer and ALB promoter is a good tool for the effective tissue-specific regulation (Chen et al., 2011). In the literatures, some other liver-specific shRNA vectors also were reported (Lam et al., 2007; Ren et al., 2011). For example, shRNA plasmid under the control of CMV enhancer-modified ApoA-I promoter could also induce significant inhibitory effect on target gene (Ren et al., 2011). All those shRNA plasmids would enrich the liver-specific gene silencing studies. It is worth mentioning that pNCsh-EP, we constructed in present study, also could be used as a common carrier for various liver-specific RNAi plasmids construction in future. Previously, we found HNF4a could enhance the transcription and replication of hepatitis B virus (Tang et al., 2001a). So, the establishment of a highly-active and liverspecific shRNA plasmid targeting HNF4a may provide a new target for therapy. Besides, HNF4a is also the key
regulator of carbohydrate, lipid, cholesterol, amino and bile acid homeostasis and is essential for formation of epithelial phenotype of hepatocytes and hepatocyte differentiation, and recently, HNF4a was found to play a role in regulating the cytokine-induced inflammatory response in hepatic cells (Guo et al., 2003). Thus, using pHNF4sh-EP liver-specific knockdown HNF4a expression liver will be helpful to further elucidate the function of HNF4a in liver. References Chen, E.Q. et al., 2011. Construction of a highly-active, liver-specific transcriptional regulatory element through combination of the albumin promoter and alpha-fetoprotein enhancer. Plasmid 65, 125–131. Chen, W.S. et al., 1994. Disruption of the HNF-4 gene, expressed in visceral endoderm, le ads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev. 8, 2466– 2477. Cheung, C. et al., 2003. Hepatic expression of cytochrome P450s in hepatocyte nuclear factor 1-alpha (HNF1alpha)-deficient mice. Biochem. Pharmacol. 66, 2011–2020. Costa, R.H. et al., 2003. Transcription factors in liver development, differentiation, and regeneration. Hepatology 38, 1331–1347. Guo, H. et al., 2003. Serine/threonine phosphorylation regulates HNF4alpha-dependent redox-mediated iNOS expression in hepatocytes. Am. J. Physiol. Cell Physiol. 284, C1090–C1099. Hanniman, E.A. et al., 2006. Apolipoprotein A-IV is regulated by nutritional and metabolic stress: involvement of glucocorticoids, HNF-4 alpha, and PGC-1 alpha. J. Lipid Res. 47, 2503–2514. Herweijer, H. et al., 2001. Time course of gene expression after plasmid DNA gene transfer to the liver. J. Gene Med. 3, 280–291. Inoue, Y. et al., 2006. Regulation of bile acid biosynthesis by hepatocyte nuclear factor 4alpha. J. Lipid Res. 47, 215–227.
66
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
Jin, J.R. et al., 1995. Enhancer sharing in a plasmid model containing the alphafetoprotein and albumin promoters. DNA Cell Biol. 14, 267–272. Karagiannis, T.C., El-Osta, A., 2005. RNA interference and potential therapeutic applications of short interfering RNAs. Cancer Gene Ther. 12, 787–795. Lam, P.Y. et al., 2007. An efficient and safe herpes simplex virus type 1 amplicon vector for transcriptionally targeted therapy of human hepatocellular carcinomas. Mol. Ther. 15, 1129–1136. Lazarevich, N.L. et al., 2010. Deregulation of hepatocyte nuclear factor 4 (HNF4)as a marker of epithelial tumors progression. Exp. Oncol. 32, 167–171. Li, X. et al., 2002. Hepatocyte nuclear factor 4 response to injury involves a rapid decrease in DNA binding and transactivation via a JAK2 signal transduction pathway. Biochem. J. 368, 203–211. Long, Y. et al., 2006. Expression of hepatocyte nuclear factor 4a and 3b in human tissues. Shijie Huaren Xiaohua Zazhi 14, 2504–2509. Milhavet, O. et al., 2003. RNA interference in biology and medicine. Pharmacol. Rev. 55, 629–648. Miura, A. et al., 2006. Hepatocyte nuclear factor-4alpha is essential for glucose-stimulated insulin secretion by pancreatic beta-cells. J. Biol. Chem. 281, 5246–5257. Parviz, F. et al., 2003. Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat. Genet. 34, 292–296.
Ren, X. et al., 2011. Construction, modification and evaluation of apolipoprotein A-I promoter-driven shRNA expression vectors against hTERT. Plasmid 65, 42–50. Tang, H. et al., 2001a. Hepatitis B virus transcription and replication. Drug News Perspect. 14, 325–334. Tang, H. et al., 2001b. Replication of the wild type and a natural hepatitis B virus nucleocapsid promoter variant is differentially regulated by nuclear hormone receptors in cell culture. J. Virol. 75, 8937– 8948. Vacher, J., Tilghman, S.M., 1990. Dominant negative regulation of the mouse alpha-fetoprotein gene in adult liver. Science 250, 1732– 1735. Wang, Z. et al., 2011. Expression profile analysis of the inflammatory response regulated by hepatocyte nuclear factor 4alpha. BMC Genom. 12, 128. Watt, A.J. et al., 2003. HNF4: a central regulator of hepatocyte differentiation and function. Hepatology 37, 1249–1253. Wen, P. et al., 1991. Enhancer, repressor, and promoter specificities combine to regulate the rat alpha-fetoprotein gene. DNA Cell Biol. 10, 525–536. Wooddell, C.I. et al., 2008. Sustained liver-specific transgene expression from the albumin promoter in mice following hydrodynamic plasmid DNA delivery. J. Gene Med. 10, 551–563.
Contents lists available at SciVerse ScienceDirect
Plasmid journal homepage: www.elsevier.com/locate/yplas
Construction of a plasmid vector for liver-specific inhibition of hepatocyte nuclear factor 4 alpha expression Xue-Qin Song a,b,1, En-Qiang Chen a,b,1, Yue-Bin Wang a,b, Tao-You Zhou a,b, Li. Liu a,b, Cong Liu a,b, Xing Cheng a,b, Hong Tang a,b,⇑ a b
Center of Infectious Diseases, West China Hospital of Sichuan University, Chengdu 610041, People’s Republic of China Division of Infectious Diseases, State Key Laboratory of Biotherapy, Sichuan University, Chengdu 610041, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 20 April 2011 Accepted 8 August 2011 Available online 30 August 2011 Communicated by Saleem Khan Keywords: Hepatocyte nuclear factor 4 alpha Short hairpin RNA Liver specific
a b s t r a c t Hepatocyte nuclear factor-4alpha (HNF-4a) is an important transcription factor in the liver, and regulates a large number of genes involved in many aspects of hepatocyte functions. In this study, a liver-specific transcriptional regulatory element comprised of albumin promoter (ALBp) and alpha-fetoprotein enhancer (AFPe) was obtained and cloned into the plasmid pHNF4sh-CMV(short hairpin RNA targeting HNF4a) with original CMV promoter removed, resulting to pHNF4sh-EP for liver-specific knockdown of HNF4a expression. In an attempt to verify its characteristics, pHNF4sh-EP was transfected to L02, HepG2, and COS1 cell lines in vitro and delivered into mice in vivo. pHNF4sh-CMV and pNCsh-EP were used as controls. For in vitro, the level of HNF4a mRNA and protein was decreased in all cell lines transfected with pHNF4sh-CMV whereas HNF4a mRNA and protein decreasing was only observed in L02 and HepG2 cell lines upon transfection with pHNF4sh-EP, and this decreasing was more significant as compared with pHNF4sh-CMV transfected cells. For in vivo, the decreasing of HNF4a mRNA and protein was observed in both liver and kidney tissues upon transfection with pHNF4sh-CMV. After transfection with pHNF4sh-EP, decreasing of HNF4a mRNA and protein was only found in liver tissue and this decreasing was more significant. No obvious HNF4a mRNA and protein decreasing was detected either in vitro or in vivo after transfected with pNCsh-EP. In conclusion, pHNF4sh-EP could highly-active and liver-specific knockdown of HNF4a expression liver and it will be useful for further study of the funcitions of HNF4a in liver. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Hepatocyte nuclear factors (HNFs) network is one of the most investigated tissue-specific regulatory systems which control the specification and maintenance of hepatic cells (Lazarevich et al., 2010; Parviz et al., 2003). Nuclear receptor HNF4a, as one of the central elements of this regulatory net-
⇑ Corresponding author at: Center of Infectious Diseases, West China Hospital of Sichuan University, Chengdu 610041, People’s Republic of China. Fax: +86 28 85423052. E-mail address: [email protected] (H. Tang). 1 Contributed equally to this paper. Supported by the National Natural Science Foundation of China (No. 30972622) and the National Basic Research Program Of China (No.2007CB512902). 0147-619X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.plasmid.2011.08.001
work in the liver (Watt et al., 2003), regulates nearly fortytwo percent of all hepatocyte genes. Evidence showed that HNF4a was essential for differentiation and development of the liver during embryogenesis (Chen et al., 1994), and modulates the expression of genes involved in cholesterol, xenobiotic, amino-acid, carbohydrate, and lipid metabolism (Cheung et al., 2003; Hanniman et al., 2006; Inoue et al., 2006; Miura et al., 2006). Recently, someone reported that HNF4a also could regulate cytokine-induced inflammatory response in hepatic cells (Guo et al., 2003; Li et al., 2002), and the deregulation of this gene was associated with hepatocellular carcinoma (HCC) progression and induced the increase of proliferation rate, loss of epithelial morphology, dedifferentiation and metastasis (Costa et al., 2003; Lazarevich et al., 2010). In our previous work, we found
61
X.-Q. Song et al. / Plasmid 67 (2012) 60–66 Table 1 The information of plasmid involved in this study. Plasmid
Characteristics
Source
pSilence4.1-CMV/neo
Small interference RNA (siRNA) expression vector which employs a CMV promoter to drive the expression of cloned short hairpin RNA (shRNA) templates in a wide variety of cell types. Containg a liver- specific expression element AFPe-ALBp (EP) Expressing a short hairpin siRNA with limited homology to any known sequences in the human, mouse, and rat genomes. Employing a CMV promoter to drive the expression of shRNA targeting HNF4a Employing a liver-specific EP regulatory sequence to drive the expression of shRNA targeting HNF4a
Ambion corporation
pMD18-T/AFPe-ALBp pNCsh-CMV pHNF4sh-CMV pHNF4sh-EP
HNF4a also could support hepatitis B virus (HBV) replication by stimulating the transcription of the precore RNA and core RNA from the HBV core promoter (Tang et al., 2001b). Thus, the function of HNF4a is diverse, and it plays a key role in life cycle of cells. To further investigate the role of HNF4a, there is an urgent need of simple tools which could effectively regulate the expression of HNF4a. RNA interference (RNAi), as a system within living cells, takes part in controlling which genes are active and how active they are, and it has been widely exploited in experimental biology to study the function of genes in cell culture and in vivo in model organisms (Karagiannis and El-Osta, 2005). Previous studies had showed that HNF4a not only expressed in liver, but also in kidney, heart, spleen, intestine, even at different levels (Long et al., 2006). So how to liver-specifically silence HNF4a expression is concerned by scientists. However, current available RNAi plasmids targeting HNF4a directed gene silencing in many cells and tissues, which greatly embarrassed the function study of HNF4a in liver. Recently, we successfully constructed a highly active and liver-specific transcriptional regulatory element, by combining the albumin promoter (ALBp) and a-fetoprotein enhancer (AFPe), and we found it could be used as a tool to induce target gene expression in a liver-specific manner (Chen et al., 2011). In present study, we aimed to construct a liver-specific RNAi plasmid targeting HNF4a under the control of AFPe-ALBp. In addition, the characteristics of this novel RNAi plasmid would be confirmed.
2. Materials and methods 2.1. Cells and animals used in this study Human hepatoma cells (HepG2), normal liver cells (L02) and African green monkey kidney cells (COS1) were
Our laboratory Ambion corporation Our laboratory Current study
conserved in our laboratory. HepG2 was maintained in DMEM (Invitrogen) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 lg/ml streptomycin. L02 and COS1 were grown in RPMI 1640 Medium (Invitrogen) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 lg/ml streptomycin. All cells were cultured at 37 °C in a humidified incubator with 5% CO2. Male BALB/c mice, 7–8 weeks old and weighing 18–20 g, were obtained from Huaxi Laboratory Animal Center of Sichuan University (Chengdu, China) and housed in our laboratory. 2.2. Plasmids used in this study pSilence4.1-CMV/neo was purchased from Ambion Corporation and used as a plasmid vector in the construction of pHNF4sh-CMV which expressed short hairpin RNA targeting HNF4a inducing by CMV promoter. pMD18-T/ AFPe-ALBp was used as the PCR template for the AFPeALBp (EP) elememt gene (Chen et al., 2011). RNAi sequence targeting HNF4a was designed by our laboratory, and detailed information of all plasmid and sequence involved in present study was summarized in Tables 1 and 2. 2.3. Construction of pHNF4sh-EP recombinant plasmid RNAi sequence targeting HNF4a which can knock down HNF4a expression in various cells was inserted to pSilence4.1-CMV/neo, resulting to pHNF4sh-CMV (unpublished data). The EP element was isolated from pMD18-T/ AFPe-ALBp by digesting with EcoRI and BamHI, and was cloned into pHNF4sh-CMV after digested by the same EcoRI and BamHI to substitute the CMV promotor, resulting in the recombinant plasmid pHNF4sh-EP. Plasmids in this study were identified by restriction enzyme digestion and gene sequence.
Table 2 The information of gene sequence involved in this study. Name
Description
AFPe
Accession number: AJ006475; Mus musculus AFP enhancer: 1339–1638 bp Accession number: J04738; Mus musculus ALB promoter: 1820–2070 bp See reference (Chen et al., 2011) Accession number: X87870 Top template strands: 50 -GATCCCCACATGTACTCCTGCAGA TTCAAGAGATCTGCAGGAGTACATGTGGTTA-30 Bottom template strands: 50 -AGCTTAACCACATGTACTCCTGCAGA TCTCTTGAATCTGCAGGAGTACATGTGGG-30
ALBp AFPe- ALBp (EP) HNF4a RNAi sequence of HNF4a in pHNF4sh-EP
62
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
The sequence of HNF4alfa targeted by above plasmid was AACCACATGTACTCCTGCAGA, and its position in HNF4alfa gene was 244 (Table 2).
plasmid was dissolved in 2 mL normal saline and injected via the tail vein within 5–8 s; mice were sacrificed 3 days later, and liver or kidney tissues were collected for isolation of total RNA or protein.
2.4. The transfection of pHNF4sh-EP in vitro and in vivo In an attempt to verify the characteristics of pHNF4shEP in vitro, liver derived cell lines (L02 and HepG2) and non-liver derived cell line (COS1) were passaged and plated in 6-cm culture plates for 24 h before transfection at 80–90% confluence. The pHNF4sh-EP (10 lg) was transfected to above cells with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) in Opti-MEM serum free culture medium for 6 h at 37 °C, 5% CO2, and then changed to normal medium with 10% fetal bovine serum. Finally, cells were collected for isolation of total RNA or protein. In this experiment, above cells transfected with pHNF4sh-CMV were used as control. In vivo experiment, pHNF4sh-EP was transfected into BALB/c mice via hydrodynamic-based injection (hydrodynamic in vivo transfection). And pHNF4sh-CMV was used as control. For hydrodynamic-based injection, 50 lg of
2.5. Reverse transcription-polymerase chain reaction Total RNA was isolated using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. A 0.5 lg sample of total RNA was employed for synthesis of first-strand cDNA with an M-ML RT kit (Promega). For amplification of HNF4a cDNA, the primer sequences were 50 -GGT CAA GCT ACG AGG ACA GC -30 (sense) and 50 - ATC CAG AAG GAG TTC GCA GA -30 (antisense). And the cDNA was amplified in a 50 ll reaction system. PCR products were initiated at 94 °C for 2 min, followed by 35 cycles of amplification (denaturation at 94 °C for 30 s, annealing at 55 °C 30 s, and extension at 72 °C for 25 s) with a final primer extension at 72 °C for 2 min. Final PCR products were separated on 2% agarose gel and stained with ethidium bromide. The PCR product of HNF4a was 220 base pairs (bp) in length.
Fig. 1. Schematic diagram for the construction of pHNF4sh-EP, a liver-specific RNAi plasmid targeting HNF4a.
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
63
Fig. 2. Inhibition of HNF4a mRNA transcription in vitro determined by RT-PCR. (A): no intervention; (B): treated with pNCsh-EP; (C): treated with pHNF4sh-CMV; (D): treated with pHNF4sh-EP. The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. The level of HNF4a mRNA in group A was set to 1, and the relative levels of groups B, C and D were calculated accordingly. The relative levels of HNF4a mRNA in groups A, B, C and D were 1.000, 0.992, 0.604 and 0.180, respectively in L02 cells; 1.000, 1.141, 0.607 and 0.205, respectively in HepG2 cells; and 1.000, 1.045, 0.589 and 0.921, respectively in COS1 cells. And the difference in decreasing levels of HNF4a mRNA between group C and D was significant among L02, HepG2 or COS1 cells, respectively (P < 0.05 for all).
The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. 2.6. Western blotting Total protein was extracted using Protein Extraction Kit. Protein concentration was determined by a BCA protein assay kit. A 30-lg protein extracts was separated by denaturing SDS–polyacrylamide gel electrophoresis and then electro-blotted to a PVDF membrane. The membranes were then incubated with each primary antibody for HNF4a (Santa Cruz, CA, USA) or GAPDH (ZHONGSHAN, Beijing, China), followed by incubation with an HRP-conjugate secondary antibody. The HNF4a and GAPDH bands were visualized with the Immobilon Western chemiluminescent HRP Substrate kit (Milipore, USA) and then exposed to X-ray film. Monoclonal anti-GAPDH antibody was used as an internal control for loading. 2.7. Statistical analysis Quantitative variables were expressed as mean and standard deviation. Comparisons between groups of
quantitative were performed using the student t -test. A P-value of less than 0.05 (two-tailed) was considered to indicate a significant difference. All statistical analyses were performed using the SPSS software package version 13.0 (SPSS Inc., Chicago, IL). 3. Results and discussion 3.1. The successful construction of pHNF4sh-EP RNAi is a process that effectively silences gene expression at the post-transcriptional level with a complex RNA–protein interactions cascade, and it has been widely applied in the functional study of genes and gene therapy (Milhavet et al., 2003). Gene therapy is the process of introduction of genetic material into target cells or tissues. However, liver-specific down-regulation of gene cannot be achieved by short hairpin RNA (shRNA) generated by RNA polymerase III promoter. Recently, some studies reported that ALBp induced a more sustained transgene expression in liver tissue as compared to other promoters (Herweijer et al., 2001; Wooddell et al., 2008), and AFP enhancers could regulate the adjacent ALB gene (Vacher
Fig. 3. Inhibition of HNF4a protein expression in vitro determined by Western blotting. (A): no intervention; (B): treated with pNCsh-EP; (C): treated with pHNF4sh-CMV; (D): treated with pHNF4sh-EP. The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. The level of HNF4a protein in group A was set to 1, and the relative levels of groups B, C and D were calculated accordingly. The relative levels of HNF4a protein in groups A, B, C and D were1.000,1.027, 0.792 and 0.414, respectively in L02 cells; 1.000, 1.058, 0.721 and 0.277, respectively in HepG2 cells; and 1.000, 0.914, 0.396 and 0.761, respectively in COS1 cells. And the difference in decreasing levels of HNF4a protein between group C and D was significant among L02, HepG2 or COS1 cells, respectively (P<0.05 for all).
64
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
3.2. Efficiency and liver-specific effect of pHNF4sh-EP in vitro
Fig. 4. Inhibition of HNF4a mRNA transcription in vivo determined by RT-PCR. (A): no intervention; (B): treated with pNCsh-EP; (C): treated with pHNF4sh-CMV; (D): treated with pHNF4sh-EP.The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. The levels of HNF4a mRNA in group A was set to 1, and the relative levels of groups B,C and D were calculated accordingly. In liver tissue, the relative levels of HNF4a mRNA in groups A, B, C and D were 1.000, 0.984 ± 0.029, 0.612 ± 0.020, 0.297 ± 0.002; In kidney tissue, the relative levels of HNF4a mRNA in groups A, B, C and D were 1.000, 0.998 ± 0.011, 0.582 ± 0.045, 0.893 ± 0.012, respectively. And significant more decreasing of HNF4a mRNA was found in group D as compared to group C in liver tissue (P < 0.05). There were three mice in each group, and the experiment was repeated three times.
and Tilghman, 1990; Wen et al., 1991). In this study, by using the liver-specific genetic regulatory element (named AFPe-ALBp, EP) we previously constructed, a highly-active and liver-specific eukaryotic expression RNAi vector (named pHNF4sh-EP) targeting HNF4a was constructed in present study. Firstly, a plasmid named pHNF4sh-CMV was constructed. After negative control RNAi sequence of pSilence4.1-CMV/neo vector was removed by restriction digestion, the hairpin structure of shRNA with same restriction site was directly inserted downstream from the CMV promoter, resulting in pHNF4sh-CMV (unpublished data). For construction of pHNF4sh-EP (Fig. 1), the AFPe-ALBp (EP) sequence was extracted from pMD18-TAFPe-ALBp, and our previous work had already confirmed that this EP sequence could be used as a tool to induce liver-specific expression of a target gene (Chen et al., 2011). Then EP sequence was subcloned into pHNF4shCMV that had been prepared by EcoRI/BamHI restriction with CMV promoter sequence removed. Additionally, the liver-specific general RNAi plasmid named pNCsh-EP was also constructed by replacing the CMV promoter of pNCsh-CMV with EP. The authenticity of the plasmids constructed in this experiment was identified by endonuclease digestion and sequencing. In this study, pNCsh-EP was used as a negative control, and pHNF4sh-CMV was used as a positive control, which could knockdown HNF4a expression regardless of cell and tissue types. So, the liver-specific and highly-active characteristics of pHNF4sh-EP were assessed by comparison with pHNF4sh-CMV.
As we know, HNF4a not only expressed in liver, but also expressed in kidney and intestine (Long et al., 2006). RNAi as a newly developed technology is increasingly used to knockdown HNF4a expression in experiments (Wang et al., 2011). However, current available RNAi plasmids targeting HNF4a have no cell- or tissue-selectivity, which may cause unexpected side-effects. Thus it is important to construct a liver-specific RNAi plasmid targeting HNF4a. In our previous work, we found that AFPe could enhance target gene expression under the control of ALBp; and successfully established a AFPe-ALBp regulated plasmid named pVAX-AFPe-ALBp-S inducing hepatitis B surface antigen (HBsAg) coding gene expression, and our experiments showed that HBsAg coded by pVAX-AFPeALBp-S was only detected in hepatic cells and liver (Chen et al., 2011). These results suggested that the sequence of AFPe-ALBp could induce target gene expression at liverspecific manner. Based on these findings, we constructed an AFPe-ALBp regulated HNF4a RNAi plasmid. To evaluate the hepatic specificity in vitro, pHNF4sh-EP as well as two control plasmids (pHNF4sh-CMV and pNCsh-EP) was transiently transfected into L02, HepG2and COS1 cell lines. The relative levels of HNF4a mRNA in cells transfected with various plasmids was showed in Fig. 2. No obvious HNF4a mRNA decreasing was detected in L02, HepG2, or COS1 cells transfected with pNCsh-EP. HNF4a mRNA decreasing was detected in all cell lines transfected with pHNF4sh-CMV whereas HNF4a mRNA decreasing was only observed in L02 and HepG2 cell lines upon transfection with pHNF4sh-EP. In this experiment, the relative levels of HNF4a protein in cells transfected with various plasmids was also calculated (Fig. 3). The same decreasing trend was found in HNF4a protein expression. Above data indicated that pHNF4sh-EP constructed in this study could liver-specific down-regulate HNF4a expression. Interesting, we also found the levels of HNF4a mRNA decreased more significantly in pHNF4sh-EP transfected hepatic cells, as compared with pHNF4sh-CMV transfected hepatic cells. And this situation was also found in the relative levels of HNF4a protein in cells transfected with various plasmids. These data further indicated that pHNF4sh-EP could knockdown HNF4a expression in hepatic cells in vitro more effectively. 3.3. Highly-active and liver-specific inhibition of HNF4a expression in vivo The results from vitro study had showed the efficiency and liver-specific effect of pHNF4sh-EP to a certain degree. In this experiment, the characteristics of pHNF4sh-EP were also verified in vivo. The relative levels of HNF4a mRNA and protein in liver and kidney tissues were presented in Figs. 4 and 5. The relative levels of HNF4a mRNA were not affected in liver or kidney tissues after pNCsh-EP transfection. Decreasing of HNF4a mRNA and protein was observed in both liver and kidney tissues upon transfection with pHNF4sh-CMV. After transfection with pHNF4sh-EP, decreasing of HNF4a mRNA and protein was only found in liver. The expression decreasing of HNF4a in liver
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
65
Fig. 5. Inhibition of HNF4a protein expression in vivo determined by Western blotting. (A): no intevention; (B): treated with pNCsh-EP; (C): treated with pHNF4sh-CMV; (D): treated with pHNF4sh-EP.The intensity of each band was quantified by Quantity-One imaging system and normalized to values for GAPDH. The levels of HNF4a protein in group A was set to 1, and the relative levels of groups B,C and D were calculated accordingly. In liver tissue, the relative levels of HNF4a protein in groups A, B, C and D were 1.000, 1.013 ± 0.024, 0.715 ± 0.007, 0.288 ± 0.014; In kidney tissue, the relative levels of HNF4a protein in groups A, B, C and D were 1.000, 0.945 ± 0.026, 0.545 ± 0.015, 0.983 ± 0.002, respectively. And significant more decreasing of HNF4a protein was found in group D as compared to group C in liver tissue (P < 0.05). There were three mice in each group, and the experiment was repeated three times.
tissues further and clearly suggested that pHNF4sh-EP could down-regulate the expression of HNF4a effectively and liver-specific in vivo. Some studies reported that ALBp could induce a more sustained target gene expression in liver tissue as compared to other promoters (Herweijer et al., 2001), and in another transfection experiments, AFP enhancers were reported to strongly stimulate ALBp expression in cells that silence the AFP promoter (Jin et al., 1995). In this study, shRNA plasmid was controlled by AFP enhancer and ALB promoter, and our previous results also indicated the combination of AFP enhancer and ALB promoter is a good tool for the effective tissue-specific regulation (Chen et al., 2011). In the literatures, some other liver-specific shRNA vectors also were reported (Lam et al., 2007; Ren et al., 2011). For example, shRNA plasmid under the control of CMV enhancer-modified ApoA-I promoter could also induce significant inhibitory effect on target gene (Ren et al., 2011). All those shRNA plasmids would enrich the liver-specific gene silencing studies. It is worth mentioning that pNCsh-EP, we constructed in present study, also could be used as a common carrier for various liver-specific RNAi plasmids construction in future. Previously, we found HNF4a could enhance the transcription and replication of hepatitis B virus (Tang et al., 2001a). So, the establishment of a highly-active and liverspecific shRNA plasmid targeting HNF4a may provide a new target for therapy. Besides, HNF4a is also the key
regulator of carbohydrate, lipid, cholesterol, amino and bile acid homeostasis and is essential for formation of epithelial phenotype of hepatocytes and hepatocyte differentiation, and recently, HNF4a was found to play a role in regulating the cytokine-induced inflammatory response in hepatic cells (Guo et al., 2003). Thus, using pHNF4sh-EP liver-specific knockdown HNF4a expression liver will be helpful to further elucidate the function of HNF4a in liver. References Chen, E.Q. et al., 2011. Construction of a highly-active, liver-specific transcriptional regulatory element through combination of the albumin promoter and alpha-fetoprotein enhancer. Plasmid 65, 125–131. Chen, W.S. et al., 1994. Disruption of the HNF-4 gene, expressed in visceral endoderm, le ads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev. 8, 2466– 2477. Cheung, C. et al., 2003. Hepatic expression of cytochrome P450s in hepatocyte nuclear factor 1-alpha (HNF1alpha)-deficient mice. Biochem. Pharmacol. 66, 2011–2020. Costa, R.H. et al., 2003. Transcription factors in liver development, differentiation, and regeneration. Hepatology 38, 1331–1347. Guo, H. et al., 2003. Serine/threonine phosphorylation regulates HNF4alpha-dependent redox-mediated iNOS expression in hepatocytes. Am. J. Physiol. Cell Physiol. 284, C1090–C1099. Hanniman, E.A. et al., 2006. Apolipoprotein A-IV is regulated by nutritional and metabolic stress: involvement of glucocorticoids, HNF-4 alpha, and PGC-1 alpha. J. Lipid Res. 47, 2503–2514. Herweijer, H. et al., 2001. Time course of gene expression after plasmid DNA gene transfer to the liver. J. Gene Med. 3, 280–291. Inoue, Y. et al., 2006. Regulation of bile acid biosynthesis by hepatocyte nuclear factor 4alpha. J. Lipid Res. 47, 215–227.
66
X.-Q. Song et al. / Plasmid 67 (2012) 60–66
Jin, J.R. et al., 1995. Enhancer sharing in a plasmid model containing the alphafetoprotein and albumin promoters. DNA Cell Biol. 14, 267–272. Karagiannis, T.C., El-Osta, A., 2005. RNA interference and potential therapeutic applications of short interfering RNAs. Cancer Gene Ther. 12, 787–795. Lam, P.Y. et al., 2007. An efficient and safe herpes simplex virus type 1 amplicon vector for transcriptionally targeted therapy of human hepatocellular carcinomas. Mol. Ther. 15, 1129–1136. Lazarevich, N.L. et al., 2010. Deregulation of hepatocyte nuclear factor 4 (HNF4)as a marker of epithelial tumors progression. Exp. Oncol. 32, 167–171. Li, X. et al., 2002. Hepatocyte nuclear factor 4 response to injury involves a rapid decrease in DNA binding and transactivation via a JAK2 signal transduction pathway. Biochem. J. 368, 203–211. Long, Y. et al., 2006. Expression of hepatocyte nuclear factor 4a and 3b in human tissues. Shijie Huaren Xiaohua Zazhi 14, 2504–2509. Milhavet, O. et al., 2003. RNA interference in biology and medicine. Pharmacol. Rev. 55, 629–648. Miura, A. et al., 2006. Hepatocyte nuclear factor-4alpha is essential for glucose-stimulated insulin secretion by pancreatic beta-cells. J. Biol. Chem. 281, 5246–5257. Parviz, F. et al., 2003. Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat. Genet. 34, 292–296.
Ren, X. et al., 2011. Construction, modification and evaluation of apolipoprotein A-I promoter-driven shRNA expression vectors against hTERT. Plasmid 65, 42–50. Tang, H. et al., 2001a. Hepatitis B virus transcription and replication. Drug News Perspect. 14, 325–334. Tang, H. et al., 2001b. Replication of the wild type and a natural hepatitis B virus nucleocapsid promoter variant is differentially regulated by nuclear hormone receptors in cell culture. J. Virol. 75, 8937– 8948. Vacher, J., Tilghman, S.M., 1990. Dominant negative regulation of the mouse alpha-fetoprotein gene in adult liver. Science 250, 1732– 1735. Wang, Z. et al., 2011. Expression profile analysis of the inflammatory response regulated by hepatocyte nuclear factor 4alpha. BMC Genom. 12, 128. Watt, A.J. et al., 2003. HNF4: a central regulator of hepatocyte differentiation and function. Hepatology 37, 1249–1253. Wen, P. et al., 1991. Enhancer, repressor, and promoter specificities combine to regulate the rat alpha-fetoprotein gene. DNA Cell Biol. 10, 525–536. Wooddell, C.I. et al., 2008. Sustained liver-specific transgene expression from the albumin promoter in mice following hydrodynamic plasmid DNA delivery. J. Gene Med. 10, 551–563.