- Email: [email protected]
Construction of a stable non-mucoid deletion mutant of the Streptococcus equi Pinnacle vaccine strain
Veterinary Microbiology 89 (2002) 311–321
Construction of a stable non-mucoid deletion mutant of the Streptococcus equi Pinnacle vaccine strain John A. Walker*, John F. Timoney Gluck Equine Research Centre, University of Kentucky, Lexington, KY 40546, USA Received 23 November 2001; received in revised form 5 August 2002; accepted 5 August 2002
Abstract Streptococcus equi causes equine strangles, a purulent lymphadenopathy of the head and neck. An avirulent, non-encapsulated strain (Pinnacle) has been used widely in North America as an intranasal vaccine. The aim of the study was to create a specific mutation of the hyaluronate synthase (hasA) gene in Pinnacle to permanently abolish the production of capsule and provide an easily recognisable genetic marker. An internal fragment of hasA was generated by PCR and cloned into pTW100 (Microscience, UK). An encapsulated revertant of Pinnacle was then transformed with the recombinant plasmid by electroporation and cultured under conditions to promote homologous recombination. Among 90 spectinomycin resistant transformants observed, one non-mucoid (non-encapsulated) spectinomycin resistant colony was detected. The presence of plasmid sequence within the hasA gene was confirmed by the PCR. After six passages in antibiotic-free medium, four non-mucoid spectinomycin sensitive colonies were found. Sequence analysis of one of these clones, designated Pinnacle HasNeg, revealed loss of the 30 end of the hasA and the 50 end of the hasB genes. This deletion mutant should serve as a useful candidate to replace Pinnacle since it cannot revert to a mucoid phenotype and can be distinguished genetically from wild type strains. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Streptococcus equi; Hyaluronate synthase; Capsule; Insertion–deletion mutagenesis; Pinnacle; Vaccine
1. Introduction Streptococcus equi (a Lancefield group C Streptococcus) is the cause of equine strangles, a highly contagious purulent lymphadenopathy of the head and neck. A hyaluronic acid capsule is constitutively expressed and is an important virulence factor (Chanter et al., 1994; Anzai et al., 1999). Commercial vaccines for subcutaneous or intramuscular * Corresponding author. Tel.: þ1-859-257-1669; fax: þ1-859-257-8542. E-mail address: [email protected] (J.A. Walker).
0378-1135/02/$ – see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 1 3 5 ( 0 2 ) 0 0 2 0 5 - 5
312
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
administration, rich in M-like and other proteins, although potent, have lacked efficacy in the field. Based on the premise that nasopharyngeal, mucosal antibody contributes to the immunity to reinfection characteristic of convalescence (Gala`n and Timoney, 1985; Hamlen et al., 1994), an intranasal vaccine consisting of a non-encapsulated, attenuated mutant 707-27, of S. equi CF32 was evaluated for safety and efficacy in experimental ponies. Strain 707-27 stimulated a significant level of resistance to experimental challenge (Timoney and Gala`n, 1985). A derivative (Pinnacle, Fort Dodge Laboratories, Fort Dodge, Iowa) of this attenuated strain has been used since 1998 as an intranasal strangles vaccine in North America. Although readily recognised by its small dry colony, cultures of Pinnacle sometimes show reversion to mucoidiness and cannot be distinguished from wild strains of S. equi. Moreover, the attenuating mutations in Pinnacle have not been defined and so there is no reliable genetic method of distinguishing vaccine from wild strains. There are very few reports of successful genetic manipulation of S. equi. One of two lysogenic bacteriophage has been used to introduce a gene for hyaluronidase synthesis (Spanier and Timoney, 1977). Transposon mutagenesis with Tn916 was used to inactivate streptolysin synthesis (Mukhtar and Timoney, 1988; Flanagan et al., 1998). Obstacles to transformation include absence of natural competence for uptake of DNA (Ha˚ varstein et al., 1997), the hyaluronic acid capsule, the thick cell wall, and the presence of high endonuclease activity (McLaughlin and Ferretti, 1995). Solutions to these problems include the use of glycine in the culture medium to weaken the cell wall, hyaluronidase to remove hyaluronic acid, and a pulse of high voltage electric current to force DNA through the cell wall (reviewed by Simon and Ferretti, 1991; McLaughlin and Ferretti, 1995). The construction of plasmid vectors that can be used in site-directed mutagenesis of streptococci has also been widely investigated. Shuttle plasmids that replicate in both E. coli and streptococci include pDL276 (Dunny et al., 1991) and pWV01 (Leenhouts et al., 1991). Many of these plasmids have multiple cloning sites to allow targeting of a specific gene sequence in the transformed streptococcus. Later modifications of these vectors included inactivation or temperature control of plasmid replication in streptococci, such as the pSF and pFW series derived from pDL276 (Tao et al., 1992; Podbielski et al., 1997) and the pGþhost series from pWV01 (Maguin and Prevost, 1996; Biswas et al., 1993). Inability to replicate in streptococci following transformation favours selection of clones in which integration of sequences in the genome has occurred. pTW100 (Microscience, London, UK) contains a temperature-sensitive origin of replication that permits replication at 30 8C but not at 37 8C and has been shown to be efficient for mutagenesis of group B streptococci (Shea, J., Personal communication). Capsule synthesis in the pyogenic streptococci is directed by genes of the hyaluronic acid synthesis (has) operon and has been extensively studied in S. pyogenes (Dougherty and van de Rijn, 1992; Dougherty and van de Rijn, 1993; Dougherty and van de Rijn, 1994). The operon is comprised of three genes: hyaluronate synthase (hasA); UDP-glucose dehydrogenase (hasB); and UDP-glucose pyrophosphorylase (hasC). Only hasA and hasB appear essential for capsule production in S. pyogenes (Ashbaugh et al., 1998). Deletion of one or more of the genes of the has operon eliminates the possibility of reversion to a mucoid phenotype, and the resulting mutant would be phenotypically and genotypically distinguishable from encapsulated wild strains of S. equi.
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
313
The aim of this study was to inactivate capsule synthesis in Pinnacle by integrating a recombinant pTW100 plasmid into the hasA sequence and then screen for additional mutants from which the plasmid sequence had excised imprecisely, giving rise to antibiotic sensitive and capsule negative mutants.
2. Materials and methods 2.1. Bacterial strains, plasmids and media Streptococcus equi (Pinnacle vaccine; Lot # 139115B, Fort Dodge Laboratories, Fort Dodge, Iowa) was cultured in Todd Hewitt Broth ðTHBÞ þ 2% yeast extract or Columbia CNA agar amended with 5% horse blood (CNA) and grown at either 30 or 37 8C. E. coli strain JM101 was maintained on Luria media. pTW100 is a temperature-sensitive shuttle plasmid which contains a gene for spectinomycin resistance and was obtained from Microscience (London, UK). Spectinomycin (100 mg/ml) was used to select for transformed E. coli and S. equi. Electroporation of E. coli was carried out as described (Ausbusal et al., 1992). 2.2. Recombinant DNA DNA was isolated from a 50 ml THB overnight culture of Pinnacle suspended in 10 mM Tris pH 8.0, and stored at 4 8C (Gala`n and Timoney, 1985). Oligonucleotide primers were obtained from Integrated DNATechnologies (Coralville, IA, USA), resuspended at 200 nm and stored at 20 8C (Table 1). Polymerase chain reactions were performed in a PCT-200 thermocycler (MJ Research Inc., Watertown, MA, USA) under the following conditions; 92 8C for 2 min, 30 cycles of 92 8C for 30 s, annealing for 1 min 30 s, extension at 72 8C for up to 3 min, 72 8C for 5 min, hold at 4 8C. The annealing temperatures varied depending on the Tm of the primers and the times for extension depended on the length of PCR fragment expected assuming 1 min/kb of DNA. Plasmid and amplified DNA were Table 1 Oligonucleotide primers used in the construction of mutants and in determination of DNA sequence Primer
#
Sequence 50 -30
Origin
Gene
Location
hasdelF hasdelR hasA261 hasA849 hasF spec479 158R3132 15R2577 repA436 hasR ptw258 ptw3927
1 2 3 4 5 6 7 8 9 10
GGAATTCTTTGCTGCGACGGGTCACCTT AGGATCCCCAGCGGTTTTGCTGCTTCAA TGTCATTGTTCATCGGTCAGA CCATAGGGCTACAAAAGGATTG CCGTTGACTCAGATACTTATATC TTCTGATGTGAGAAGAGCCATT TCATCACAGCAATCGTTGAGG GACATCTCTCGTGTAAACCTTG ACACTTGATGAACGCCAAAAA Degenerate primer CTCTCCAAGATAACTACGAACTG CCAGCTTTTGTTCCCTTTAGTGA
S. equi S. equi S. equi S. equi S. equi pTW100 S. equi S. equi pTW100 S. equi PTW100 pTW100
hasA hasA hasA hasA hasA aad9 hasC hasB/C repA hasA Vector Vector
425> <778 261> <849 353> <479 <3132 <2577 436> <1119 258> 3927>
314
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
purified using Quiagen columns (Quiagen, Valencia, CA, USA). DNA sequencing was determined using Dye Terminator Cycle Sequencing on an ABI310 automated sequencer (Applied Biosystems, Foster City, CA, USA) under standard conditions. All restriction and modifying enzymes were used according to the manufacturer’s instructions. 2.3. Electroporation of pinnacle Twenty millilitres of THB þ 90 mM glycine was inoculated with 200 ml of a log phase culture of a mucoid (encapsulated) revertant of Pinnacle and incubated with slight agitation overnight at 37 8C. 400 ml of THB þ 90 mM glycine were then inoculated with this overnight culture, to an OD of 0.05 and incubated at 37 8C for 2 h. Eight milligrams of hyaluronidase was added and incubation continued until the culture was approximately 0.2 OD at 600 nm. Following centrifugation at 4 8C (10,000 rpm, 10 min), the cells were washed twice in electroporation buffer (625 mM sucrose), and resuspended in 1 ml of electroporation buffer. One microgram of plasmid DNA was added to 200 ml of cells and electroporated in a prechilled 1mm electroporation cuvette (25 mF; 400 O; 2500 kV) with a time constant of greater than 5.0. The cells were then transferred to 1 ml of THB and incubated at 30 8C for 1 h, quickly pelleted, resuspended in 200 ml fresh THB, and plated onto CNA with 100 mg/ml spectinomycin and incubated at 30 8C for 24–48 h. 2.4. Selection of transformants Following electroporation and culture for 48 h at 30 8C, colonies were picked into 200 ml THB in a 96 well microtiter plate, incubated at 30 8C to an OD of 0.1, and then shifted to 37 8C for 3 h. Five microlitres aliquots were transferred to a fresh plate containing 200 ml THB þ spectinomycin and cultured overnight at 37 8C. The 37 8C overnight culture was then streaked onto CNA þ spectinomycin and incubated at 37 8C. Non-mucoid colonies were then serially passaged at 37 8C under antibiotic selection. A stable non-mucoid clone, Pinnacle HasSpec, was passaged in THB without spectinomycin at 30 8C, and then screened for loss of spectinomycin resistance. A clone, Pinnacle HasNeg, that maintained a non-mucoid phenotype and was spectinomycin sensitive was selected and subjected to PCR and sequence analysis to determine the changes in hasA (Table 2). Table 2 Amplicon sizes expected and observed following PCR of genomic DNA with primers from the has operon and pTW100 vector Primer pair
Pinnacle expected:observed
HasSpec expected:observed
HasNeg expected:observed
hasdelF:hasdelR hasA261:hasA849 hasR:repA436 hasF:spec479 hasA261:158R3132
353:350 588:600 None:no band None:no band 2871:2900 bp
353:350 5080:NT 1750:1700 1080:1100 7300:NT
353:350 Unknown: 2000a None:no band None:no band 1990 bpb:2000
NT: not tested. a Observed only under permissive annealing temperatures. b Based on sequence analysis.
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
315
3. Results The sequence of hasA in S. equi was identified by searching the S. equi database (http:// www.sanger.ac.uk/Projects/S_equi/blast_server.shtml) with the hasA sequence from S. equisimilis (accession number AF023876). A 350 bp fragment from S. equi was amplified by PCR using oligonucleotide primers hasdelF and hasdelR. Following digestion with BamHI and EcoRI, the amplicon was ligated into pTW100 which was then transformed into E. coli JM101. The E. coli transformants were grown at 30 8C with antibiotic selection to allow plasmid replication. Colonies were screened for the presence of the recombinant
Fig. 1. Construction of pJW901 and its use in the insertion deletion mutagenesis of the hasA gene in S. equi. (A) Structure of the has operon showing start and ending nucleotides of each gene from the genome of S. equi. Locations of primers shown by . Hasdel fragment of has gene cloned into pTW100 . (B) Ligation of hasdel fragment into the EcoRI/BamHI sites of pTW100 to produce pJW901. (C) Structure of the has operon in Pinnacle HasSpec. Note duplication of the hasdel fragment following insertion. (D) Structure of the has operon in Pinnacle HasNeg following excision of the pTW100 plasmid from the genome of Pinnacle HasSpec.
316
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
plasmid by digestion of their plasmids with HindIII. One clone, designated pJW901 (Fig. 1), was selected for further study. Following transformation of Pinnacle with pJW901, 90 spectinomycin resistant clones were isolated. Following culture at 30 8C these clones were heat shocked at 37 8C to identify clones that had undergone integration of the plasmid into the genome. Stable integrants were predicted to grow as a non-mucoid phenotype at 37 8C in the presence of spectinomycin. While the majority of colonies at 37 8C exhibited a mucoid phenotype, one clone, designated Pinnacle HasSpec, exhibited a stable non-mucoid phenotype during subsequent passages at 37 8C with spectinomycin selection. The integration of pJW901 into the hasA gene of Pinnacle was confirmed by PCR using the oligonucleotide primer pairs, spec479:hasF and repA436:hasR. Analysis of the resulting amplicons revealed that pJW901 had been inserted in the genome via a single crossover event and that duplication of the hasdel fragment had occurred (Figs. 1 and 2). Since the presence of antibiotic resistance in a vaccine strain was unacceptable, it was necessary to search for mutants in which either a portion of or all of the spectinomycin resistance gene had been excised. Pinnacle HasSpec was serially cultured in the absence of spectinomycin at 30 8C in THB to favour excision and loss of plasmid associated with spectinomycin resistance. After each passage at 30 8C, aliquots of the culture were plated on CNA without spectinomycin and incubated at 37 8C. After the fifth passage, non-
Fig. 2. Agarose gel electrophoresis of amplicons produced from S. equi Pinnacle and derived mutants. (A) Amplicons from Pinnacle HasSpec following PCR with hasF:spec479 (FS) and hasR:repA436 (RR) primer pairs. (B) Amplicons from Pinnacle mucoid revertant (Pw) and HasNeg mutant (Phm) (1 kb ¼ DNA standard markers). Sizes of amplicons are shown in bp in centre of the figure.
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
317
Fig. 3. Sequence of the hasA:ptw100:hasB boundaries from the 2 kb amplicon produced with primers has261 and 15R2577 from Pinnacle Hasneg. The hasdel fragment sequence from hasA is underlined. The hasB sequence is double underlined. The BamHI cloning site and the stop codon of the spectinomycin resistance gene are shown in bold. The location and direction of primers are shown beneath the sequence.
318
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
mucoid colonies as well as mucoid were observed. Fifty non-mucoid colonies from the sixth serial culture were grown at 37 8C in the presence and absence of spectinomycin, to distinguish clones in which excision of pTW100 had occurred but which had retained the excised plasmid. Four non-mucoid, spectinomycin sensitive colonies were isolated. All four clones had identical PCR profiles (data not shown). One clone, designated Pinnacle HasNeg maintained a stable non-mucoid phenotype and spectinomycin sensitivity after more than 15 passages. PCR of hasA in Pinnacle HasNeg using primer pairs hasF:spec479 and hasR:repA436, resulted in no amplification, indicating that the relevant sequences had been altered or excised (data not shown). Further characterisation of the putative deletion in Pinnacle HasNeg using has261, priming upstream of hasdelF, and has849, priming downstream of hasdelR (Table1, Fig. 1) at low annealing temperatures (50 8C) and a hot start antibody polymerase mix (Clontech) resulted in production of a 2 kb amplicon (data not shown). DNA sequence was obtained from the 2 kb amplicon using the has261primer but, despite numerous attempts, never with the reverse primer has849. Additional DNA sequence of this amplicon, obtained by walking down the insert using primers ptw3971 and ptw258, showed that excision of the plasmid from Pinnacle HasNeg had occurred between base 455 of pTW100 and base 2374 in the hasB gene (Figs. 2 and 3). Since the amplicon using primers has261 and has849 was the result of non-specific annealing an attempt was made, using primers has261 and a reverse primer from the middle of hasC (158R3132), to obtain authentic amplicons and confirm the sites of plasmid excision. This PCR resulted in more than one amplicon under stringent annealing conditions of 61 8C (Fig. 2) The 2 kb amplicon of the Pinnacle HasNeg clone deemed most probably authentic was purified. DNA sequence of this amplicon using primers has261, ptw3971, ptw258, 158R3132 and 15R2577 confirmed both its authenticity and the site of excision of pTW100 plasmid sequences (Fig. 3). The GenBank accession number for the nucleotide sequence of the altered has operon of Pinnacle HasSpec is AF518732
4. Discussion A fundamental challenge to genetic manipulation of the pyogenic streptococci including S. equi has been the difficulty of introducing genetic material into the cell. This is in part due to the thick cell wall and thick outer capsule. The addition of 90 mM glycine to the culture media followed by hyaluronidase (200 mg/ml) was designed to reduce these obstacles and increase the frequency of transformation. This strategy resulted in the production of 90 transformed colonies, some of which were confirmed to contain the recombinant plasmid. Various strategies and plasmid constructs have been utilised to mutagenise streptococci based on replication failure in streptococci (Tao et al., 1992; Podbielski et al., 1997) or involving use of temperature-sensitive plasmids (Maguin and Prevost, 1996; Biswas et al., 1993; Framson et al., 1997). Inhibition of plasmid replication at 37 8C was a valuable characteristic of pTW100. Specific integration of pJW901 into the genome of Pinnacle targeted an internal sequence of hasA. Following transformation, homology between the has sequence in
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
319
pTW901 and the genome led to site-specific integration of the recombinant plasmid via a single-crossover event (Fig. 1). As expected, integration resulted in loss of hasA expression and a non-encapsulated phenotype. However, isolation of capsule negative clones of S. equi with resistance to spectinomycin was at a much lower frequency than observed using pTW100 in group B streptococci (Zhou et al., 1999). Only one clone (Pinnacle HasNeg) from 90 transformants was found to maintain a capsule negative phenotype and spectinomycin resistance at 37 8C. The most likely explanation is a low rate of integration, possibly related to an inherent deficiency in homologous recombination in S. equi. It is also possible that the responsiveness of the repA gene to temperature regulation is less precise in S. equi than in E. coli or group B streptococci resulting in extrachromosomal persistence of the plasmid (Framson et al., 1997). Other explanations include selection of spectinomycin resistant mutants or sub-inhibitory levels of spectinomycin (100 mg/ml) that allowed overgrowth of non-transformed bacteria. However, 100 mg/ml of spectinomycin was inhibitory for the parent strain of Pinnacle. Pinnacle HasNeg maintained a stable nonmucoid phenotype over many passages when grown in the presence of spectinomycin. Since strains potentially useful as vaccines should not contain genes for antibiotic resistance, it was necessary to isolate a clone of Pinnacle HasSpec that had lost the spectinomycin resistance gene. The ratio of non-mucoid mutants after growth at 37 8C to transformants (1:100) indicated either that plasmid integration was low or precise excision of plasmid without elimination of pTW100 sequences occurred at a fairly high rate, with a concomitant reversion to a capsulated phenotype. Detection of mucoid colonies following just a few rounds of subculture at 30 8C indicated that precise excision had occurred at high frequency in the absence of antibiotic selection. Since the goal was to detect a clone in which imprecise excision of plasmid had occurred, non-mucoid colonies were screened for antibiotic sensitivity. Out of 50, 4 colonies found to be spectinomycin sensitive yielded identical amplicons following PCR. This indicated that all four clones had originated from a single excision event during an earlier passage. The high frequency of precise excision events noted during a few rounds of subculture suggested that deletions in the HasNeg mutants might involve few nucleotides. However, sequence analysis of Pinnacle HasNeg revealed that deletion of genomic and integrant DNA following excision of pTW100 was more extensive than expected. Not only had most of the pTW100 insert been deleted, but a total of 1596 bp of the has operon was deleted. This deletion included the remaining 30 end of hasA, the intergenic region between hasA and hasB and the first 987 bp of hasB (Figs. 1 and 3). As expected, given the improbability of restoration of such a large portion of the has operon, the phenotype of Pinnacle HasNeg remained stable over many passages. Analysis of the has operon in S. equi indicated that hasA, hasB and hasC (Fig. 1) have sizes and organisation similar to those of S. pyogenes An interesting, and as yet unexplained finding was that of an additional copy of hasC in another region of the S. equi genome. Since hasC is not essential for capsule production in S. pyogenes, it is possible that the additional copies in S. equi are indicative of another role for the hasC gene product. Use of this has deletion mutant in place of the parent Pinnacle strain currently used in the field will permit rapid genotypic recognition of the vaccine strain by the difference in size of amplicon produced using the has261 and has158R3132 primers. The large deletion of
320
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
the has operon removes any possibility of simple reversion to a potentially more virulent encapsulated form.
Acknowledgements The authors wish to acknowledge the financial support of Fort Dodge Animal Health, Fort Dodge, Iowa. We are also indebted to Dr. Jacqui Shea of Microscience, UK, for plasmid pTW100.
References Anzai, T., Timoney, J.F., Kuwamoto, Y., Fujita, Y., Wada, R., Inoue, T., 1999. In vivo pathogenicity and resistance to phagocytosis of Streptococcus equi strains with different levels of capsule expression. Vet. Microbiol. 67, 286–377. Ashbaugh, C.D., Alberti, S., Wessels, M.R., 1998. Molecular analysis of the capsule gene region of group A Streptococcus: the hasAB genes are sufficient for capsule expression. J. Bacteriol. 190, 4955–4959. Ausbusal, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1992. Short Protocols in Molecular Biology, 2nd ed. Wiley, New York, pp. 1.26–1.27. Biswas, I., Gruss, A., Ehrlich, S.D., Maguin, E., 1993. High-efficiency gene inactivation and replacement system for Gram-positive bacteria. J. Bacteriol. 175, 3625–3628. Chanter, N., Collin, N.C., Mumford, J.A., 1994. Resistance of Streptococcus equi in vitro to equine polymorphonuclear leucocytes. In: Nakajima, H., Plowright, W. (Eds.), Equine Infectious Diseases VII. R&W Publications, Newmarket, UK, pp. 201–205. Dougherty, B.A., van de Rijn, I., 1992. Molecular characterization of a locus required for hyaluronic acid capsule production in group A streptococci. J. Exp. Med. 175, 1291–1299. Dougherty, B.A., van de Rijn, I., 1993. Molecular characterization of hasB from an operon required for hyaluronic acid synthesis in group A streptococci. J. Biol. Chem. 268 (10), 7118–7124. Dougherty, B.A., van de Rijn, I., 1994. Molecular characterization of hasA from an operon required for hyaluronic acid synthesis in group A streptococci. J. Biol. Chem. 269 (1), 169–175. Dunny, G.M., Lee, L.N., Le Blanc, D.J., 1991. Improved electroporation and cloning vector system for Grampositive bacteria. Appl. Environ. Microbiol. 57, 1194–1201. Flanagan, J., Collin, N., Timoney, J., Mitchell, T., Mumford, J.A., Chanter, N., 1998. Characterization of the haemolytic activity of Streptococcus equi. Microbial Pathol. 24, 211–221. Framson, P.E., Nittayajarn, A., Merry, J., Youngman, P., Rubens, C.E., 1997. New genetic techniques for group B streptococci: high-efficiency transformation, maintenance of temperature-sensitive pWV01 plasmids and mutagenesis with Tn917. Appl. Environ. Microbiol. 63, 3539–3547. Gala`n, J.E., Timoney, J.F., 1985. Mucosal nasopharyngeal immune response of the horse to protein antigens of Streptococcus equi. Infect. Immun. 47, 623–628. Hamlen, H.J., Timoney, J.F., Bell, R.J., 1994. Epidemiologic and immunologic characteristics of Streptococcus equi infection in foals. J. Am. Vet. Med. Assoc. 204, 768–775. Ha˚varstein, L.S., Hakenbeck, R., Gaustad, P., 1997. Natural competence in the genus Streptococcus: evidence that streptococci can change pherotype by interspecies recombinational exchanges. J. Bacteriol. 179, 6589–6594. Leenhouts, K.J., Tolner, B., Bron, S., Kok, J., Venema, G., Seegers, J.F.M.L., 1991. Nucleotide sequence and characterization of the broad-host range lactococcal plasmid pWV01. Plasmid 26, 55–66. Maguin, E.H., Prevost, H., 1996. Efficient insertional mutagenesis in lactococci and other Gram-positive bacteria. J. Bacteriol. 178, 931–935. McLaughlin, R.E., Ferretti, J.J., 1995. Electrotransformation of streptococci. In: Nicholoff, J.A. (Ed.), Methods in Molecular Biology: Electroporation Protocols for Microorganisms, vol. 47. Humana Press, Totowa, NJ, pp. 185–193.
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
321
Mukhtar, M., Timoney, J.F., 1988. Chemotactic response of equine polymorphonuclear leukocytes to Streptococcus equi. Res. Vet. Sci. 45, 225–229. Podbielski, A., Spellerberg, B., Woischink, M., Pohl, B., Lutticken, R., 1997. Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS). Gene 177, 137–147. Simon, D., Ferretti, J.J., 1991. Electrotransformation of Streptococcus pyogenes with plasmid and linear DNA. FEMS Microbiol. Lett. 82, 219–224. Spanier, J.G., Timoney, J.F., 1977. Bacteriophages of Streptococcus equi. J. Gen. Virol. 35, 369–375. Tao, L., LeBlanc, D.J., Ferretti, J.J., 1992. Novel streptococcal-integration shuttle vectors for gene cloning and inactivation. Gene 120, 105–110. Timoney, J.F., Gala`n, J.E., 1985. The protective response of the horse to an avirulent strain of Streptococcus equi. In: Kimura, Y., Kotami, S., Shiokowa, Y. (Eds.), Recent Advances in Streptococci and Streptococcal Diseases. Reedbooks, Bracknell, England, pp. 294–295. Zhou, L., Everest, P., Santangelo, J., O’Dwyer, C., Feldman, R., Shea, J., 1999. Insertion–duplication mutagenesis of group B Streptococcus: ScpB is not required for virulence in a neonatal mouse model of infection. In: Abstracts of XIV Lancefield International Symposium on Streptococci and Streptococcal Disease. Auckland, New Zealand.
Construction of a stable non-mucoid deletion mutant of the Streptococcus equi Pinnacle vaccine strain John A. Walker*, John F. Timoney Gluck Equine Research Centre, University of Kentucky, Lexington, KY 40546, USA Received 23 November 2001; received in revised form 5 August 2002; accepted 5 August 2002
Abstract Streptococcus equi causes equine strangles, a purulent lymphadenopathy of the head and neck. An avirulent, non-encapsulated strain (Pinnacle) has been used widely in North America as an intranasal vaccine. The aim of the study was to create a specific mutation of the hyaluronate synthase (hasA) gene in Pinnacle to permanently abolish the production of capsule and provide an easily recognisable genetic marker. An internal fragment of hasA was generated by PCR and cloned into pTW100 (Microscience, UK). An encapsulated revertant of Pinnacle was then transformed with the recombinant plasmid by electroporation and cultured under conditions to promote homologous recombination. Among 90 spectinomycin resistant transformants observed, one non-mucoid (non-encapsulated) spectinomycin resistant colony was detected. The presence of plasmid sequence within the hasA gene was confirmed by the PCR. After six passages in antibiotic-free medium, four non-mucoid spectinomycin sensitive colonies were found. Sequence analysis of one of these clones, designated Pinnacle HasNeg, revealed loss of the 30 end of the hasA and the 50 end of the hasB genes. This deletion mutant should serve as a useful candidate to replace Pinnacle since it cannot revert to a mucoid phenotype and can be distinguished genetically from wild type strains. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Streptococcus equi; Hyaluronate synthase; Capsule; Insertion–deletion mutagenesis; Pinnacle; Vaccine
1. Introduction Streptococcus equi (a Lancefield group C Streptococcus) is the cause of equine strangles, a highly contagious purulent lymphadenopathy of the head and neck. A hyaluronic acid capsule is constitutively expressed and is an important virulence factor (Chanter et al., 1994; Anzai et al., 1999). Commercial vaccines for subcutaneous or intramuscular * Corresponding author. Tel.: þ1-859-257-1669; fax: þ1-859-257-8542. E-mail address: [email protected] (J.A. Walker).
0378-1135/02/$ – see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 1 3 5 ( 0 2 ) 0 0 2 0 5 - 5
312
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
administration, rich in M-like and other proteins, although potent, have lacked efficacy in the field. Based on the premise that nasopharyngeal, mucosal antibody contributes to the immunity to reinfection characteristic of convalescence (Gala`n and Timoney, 1985; Hamlen et al., 1994), an intranasal vaccine consisting of a non-encapsulated, attenuated mutant 707-27, of S. equi CF32 was evaluated for safety and efficacy in experimental ponies. Strain 707-27 stimulated a significant level of resistance to experimental challenge (Timoney and Gala`n, 1985). A derivative (Pinnacle, Fort Dodge Laboratories, Fort Dodge, Iowa) of this attenuated strain has been used since 1998 as an intranasal strangles vaccine in North America. Although readily recognised by its small dry colony, cultures of Pinnacle sometimes show reversion to mucoidiness and cannot be distinguished from wild strains of S. equi. Moreover, the attenuating mutations in Pinnacle have not been defined and so there is no reliable genetic method of distinguishing vaccine from wild strains. There are very few reports of successful genetic manipulation of S. equi. One of two lysogenic bacteriophage has been used to introduce a gene for hyaluronidase synthesis (Spanier and Timoney, 1977). Transposon mutagenesis with Tn916 was used to inactivate streptolysin synthesis (Mukhtar and Timoney, 1988; Flanagan et al., 1998). Obstacles to transformation include absence of natural competence for uptake of DNA (Ha˚ varstein et al., 1997), the hyaluronic acid capsule, the thick cell wall, and the presence of high endonuclease activity (McLaughlin and Ferretti, 1995). Solutions to these problems include the use of glycine in the culture medium to weaken the cell wall, hyaluronidase to remove hyaluronic acid, and a pulse of high voltage electric current to force DNA through the cell wall (reviewed by Simon and Ferretti, 1991; McLaughlin and Ferretti, 1995). The construction of plasmid vectors that can be used in site-directed mutagenesis of streptococci has also been widely investigated. Shuttle plasmids that replicate in both E. coli and streptococci include pDL276 (Dunny et al., 1991) and pWV01 (Leenhouts et al., 1991). Many of these plasmids have multiple cloning sites to allow targeting of a specific gene sequence in the transformed streptococcus. Later modifications of these vectors included inactivation or temperature control of plasmid replication in streptococci, such as the pSF and pFW series derived from pDL276 (Tao et al., 1992; Podbielski et al., 1997) and the pGþhost series from pWV01 (Maguin and Prevost, 1996; Biswas et al., 1993). Inability to replicate in streptococci following transformation favours selection of clones in which integration of sequences in the genome has occurred. pTW100 (Microscience, London, UK) contains a temperature-sensitive origin of replication that permits replication at 30 8C but not at 37 8C and has been shown to be efficient for mutagenesis of group B streptococci (Shea, J., Personal communication). Capsule synthesis in the pyogenic streptococci is directed by genes of the hyaluronic acid synthesis (has) operon and has been extensively studied in S. pyogenes (Dougherty and van de Rijn, 1992; Dougherty and van de Rijn, 1993; Dougherty and van de Rijn, 1994). The operon is comprised of three genes: hyaluronate synthase (hasA); UDP-glucose dehydrogenase (hasB); and UDP-glucose pyrophosphorylase (hasC). Only hasA and hasB appear essential for capsule production in S. pyogenes (Ashbaugh et al., 1998). Deletion of one or more of the genes of the has operon eliminates the possibility of reversion to a mucoid phenotype, and the resulting mutant would be phenotypically and genotypically distinguishable from encapsulated wild strains of S. equi.
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
313
The aim of this study was to inactivate capsule synthesis in Pinnacle by integrating a recombinant pTW100 plasmid into the hasA sequence and then screen for additional mutants from which the plasmid sequence had excised imprecisely, giving rise to antibiotic sensitive and capsule negative mutants.
2. Materials and methods 2.1. Bacterial strains, plasmids and media Streptococcus equi (Pinnacle vaccine; Lot # 139115B, Fort Dodge Laboratories, Fort Dodge, Iowa) was cultured in Todd Hewitt Broth ðTHBÞ þ 2% yeast extract or Columbia CNA agar amended with 5% horse blood (CNA) and grown at either 30 or 37 8C. E. coli strain JM101 was maintained on Luria media. pTW100 is a temperature-sensitive shuttle plasmid which contains a gene for spectinomycin resistance and was obtained from Microscience (London, UK). Spectinomycin (100 mg/ml) was used to select for transformed E. coli and S. equi. Electroporation of E. coli was carried out as described (Ausbusal et al., 1992). 2.2. Recombinant DNA DNA was isolated from a 50 ml THB overnight culture of Pinnacle suspended in 10 mM Tris pH 8.0, and stored at 4 8C (Gala`n and Timoney, 1985). Oligonucleotide primers were obtained from Integrated DNATechnologies (Coralville, IA, USA), resuspended at 200 nm and stored at 20 8C (Table 1). Polymerase chain reactions were performed in a PCT-200 thermocycler (MJ Research Inc., Watertown, MA, USA) under the following conditions; 92 8C for 2 min, 30 cycles of 92 8C for 30 s, annealing for 1 min 30 s, extension at 72 8C for up to 3 min, 72 8C for 5 min, hold at 4 8C. The annealing temperatures varied depending on the Tm of the primers and the times for extension depended on the length of PCR fragment expected assuming 1 min/kb of DNA. Plasmid and amplified DNA were Table 1 Oligonucleotide primers used in the construction of mutants and in determination of DNA sequence Primer
#
Sequence 50 -30
Origin
Gene
Location
hasdelF hasdelR hasA261 hasA849 hasF spec479 158R3132 15R2577 repA436 hasR ptw258 ptw3927
1 2 3 4 5 6 7 8 9 10
GGAATTCTTTGCTGCGACGGGTCACCTT AGGATCCCCAGCGGTTTTGCTGCTTCAA TGTCATTGTTCATCGGTCAGA CCATAGGGCTACAAAAGGATTG CCGTTGACTCAGATACTTATATC TTCTGATGTGAGAAGAGCCATT TCATCACAGCAATCGTTGAGG GACATCTCTCGTGTAAACCTTG ACACTTGATGAACGCCAAAAA Degenerate primer CTCTCCAAGATAACTACGAACTG CCAGCTTTTGTTCCCTTTAGTGA
S. equi S. equi S. equi S. equi S. equi pTW100 S. equi S. equi pTW100 S. equi PTW100 pTW100
hasA hasA hasA hasA hasA aad9 hasC hasB/C repA hasA Vector Vector
425> <778 261> <849 353> <479 <3132 <2577 436> <1119 258> 3927>
314
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
purified using Quiagen columns (Quiagen, Valencia, CA, USA). DNA sequencing was determined using Dye Terminator Cycle Sequencing on an ABI310 automated sequencer (Applied Biosystems, Foster City, CA, USA) under standard conditions. All restriction and modifying enzymes were used according to the manufacturer’s instructions. 2.3. Electroporation of pinnacle Twenty millilitres of THB þ 90 mM glycine was inoculated with 200 ml of a log phase culture of a mucoid (encapsulated) revertant of Pinnacle and incubated with slight agitation overnight at 37 8C. 400 ml of THB þ 90 mM glycine were then inoculated with this overnight culture, to an OD of 0.05 and incubated at 37 8C for 2 h. Eight milligrams of hyaluronidase was added and incubation continued until the culture was approximately 0.2 OD at 600 nm. Following centrifugation at 4 8C (10,000 rpm, 10 min), the cells were washed twice in electroporation buffer (625 mM sucrose), and resuspended in 1 ml of electroporation buffer. One microgram of plasmid DNA was added to 200 ml of cells and electroporated in a prechilled 1mm electroporation cuvette (25 mF; 400 O; 2500 kV) with a time constant of greater than 5.0. The cells were then transferred to 1 ml of THB and incubated at 30 8C for 1 h, quickly pelleted, resuspended in 200 ml fresh THB, and plated onto CNA with 100 mg/ml spectinomycin and incubated at 30 8C for 24–48 h. 2.4. Selection of transformants Following electroporation and culture for 48 h at 30 8C, colonies were picked into 200 ml THB in a 96 well microtiter plate, incubated at 30 8C to an OD of 0.1, and then shifted to 37 8C for 3 h. Five microlitres aliquots were transferred to a fresh plate containing 200 ml THB þ spectinomycin and cultured overnight at 37 8C. The 37 8C overnight culture was then streaked onto CNA þ spectinomycin and incubated at 37 8C. Non-mucoid colonies were then serially passaged at 37 8C under antibiotic selection. A stable non-mucoid clone, Pinnacle HasSpec, was passaged in THB without spectinomycin at 30 8C, and then screened for loss of spectinomycin resistance. A clone, Pinnacle HasNeg, that maintained a non-mucoid phenotype and was spectinomycin sensitive was selected and subjected to PCR and sequence analysis to determine the changes in hasA (Table 2). Table 2 Amplicon sizes expected and observed following PCR of genomic DNA with primers from the has operon and pTW100 vector Primer pair
Pinnacle expected:observed
HasSpec expected:observed
HasNeg expected:observed
hasdelF:hasdelR hasA261:hasA849 hasR:repA436 hasF:spec479 hasA261:158R3132
353:350 588:600 None:no band None:no band 2871:2900 bp
353:350 5080:NT 1750:1700 1080:1100 7300:NT
353:350 Unknown: 2000a None:no band None:no band 1990 bpb:2000
NT: not tested. a Observed only under permissive annealing temperatures. b Based on sequence analysis.
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
315
3. Results The sequence of hasA in S. equi was identified by searching the S. equi database (http:// www.sanger.ac.uk/Projects/S_equi/blast_server.shtml) with the hasA sequence from S. equisimilis (accession number AF023876). A 350 bp fragment from S. equi was amplified by PCR using oligonucleotide primers hasdelF and hasdelR. Following digestion with BamHI and EcoRI, the amplicon was ligated into pTW100 which was then transformed into E. coli JM101. The E. coli transformants were grown at 30 8C with antibiotic selection to allow plasmid replication. Colonies were screened for the presence of the recombinant
Fig. 1. Construction of pJW901 and its use in the insertion deletion mutagenesis of the hasA gene in S. equi. (A) Structure of the has operon showing start and ending nucleotides of each gene from the genome of S. equi. Locations of primers shown by . Hasdel fragment of has gene cloned into pTW100 . (B) Ligation of hasdel fragment into the EcoRI/BamHI sites of pTW100 to produce pJW901. (C) Structure of the has operon in Pinnacle HasSpec. Note duplication of the hasdel fragment following insertion. (D) Structure of the has operon in Pinnacle HasNeg following excision of the pTW100 plasmid from the genome of Pinnacle HasSpec.
316
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
plasmid by digestion of their plasmids with HindIII. One clone, designated pJW901 (Fig. 1), was selected for further study. Following transformation of Pinnacle with pJW901, 90 spectinomycin resistant clones were isolated. Following culture at 30 8C these clones were heat shocked at 37 8C to identify clones that had undergone integration of the plasmid into the genome. Stable integrants were predicted to grow as a non-mucoid phenotype at 37 8C in the presence of spectinomycin. While the majority of colonies at 37 8C exhibited a mucoid phenotype, one clone, designated Pinnacle HasSpec, exhibited a stable non-mucoid phenotype during subsequent passages at 37 8C with spectinomycin selection. The integration of pJW901 into the hasA gene of Pinnacle was confirmed by PCR using the oligonucleotide primer pairs, spec479:hasF and repA436:hasR. Analysis of the resulting amplicons revealed that pJW901 had been inserted in the genome via a single crossover event and that duplication of the hasdel fragment had occurred (Figs. 1 and 2). Since the presence of antibiotic resistance in a vaccine strain was unacceptable, it was necessary to search for mutants in which either a portion of or all of the spectinomycin resistance gene had been excised. Pinnacle HasSpec was serially cultured in the absence of spectinomycin at 30 8C in THB to favour excision and loss of plasmid associated with spectinomycin resistance. After each passage at 30 8C, aliquots of the culture were plated on CNA without spectinomycin and incubated at 37 8C. After the fifth passage, non-
Fig. 2. Agarose gel electrophoresis of amplicons produced from S. equi Pinnacle and derived mutants. (A) Amplicons from Pinnacle HasSpec following PCR with hasF:spec479 (FS) and hasR:repA436 (RR) primer pairs. (B) Amplicons from Pinnacle mucoid revertant (Pw) and HasNeg mutant (Phm) (1 kb ¼ DNA standard markers). Sizes of amplicons are shown in bp in centre of the figure.
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
317
Fig. 3. Sequence of the hasA:ptw100:hasB boundaries from the 2 kb amplicon produced with primers has261 and 15R2577 from Pinnacle Hasneg. The hasdel fragment sequence from hasA is underlined. The hasB sequence is double underlined. The BamHI cloning site and the stop codon of the spectinomycin resistance gene are shown in bold. The location and direction of primers are shown beneath the sequence.
318
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
mucoid colonies as well as mucoid were observed. Fifty non-mucoid colonies from the sixth serial culture were grown at 37 8C in the presence and absence of spectinomycin, to distinguish clones in which excision of pTW100 had occurred but which had retained the excised plasmid. Four non-mucoid, spectinomycin sensitive colonies were isolated. All four clones had identical PCR profiles (data not shown). One clone, designated Pinnacle HasNeg maintained a stable non-mucoid phenotype and spectinomycin sensitivity after more than 15 passages. PCR of hasA in Pinnacle HasNeg using primer pairs hasF:spec479 and hasR:repA436, resulted in no amplification, indicating that the relevant sequences had been altered or excised (data not shown). Further characterisation of the putative deletion in Pinnacle HasNeg using has261, priming upstream of hasdelF, and has849, priming downstream of hasdelR (Table1, Fig. 1) at low annealing temperatures (50 8C) and a hot start antibody polymerase mix (Clontech) resulted in production of a 2 kb amplicon (data not shown). DNA sequence was obtained from the 2 kb amplicon using the has261primer but, despite numerous attempts, never with the reverse primer has849. Additional DNA sequence of this amplicon, obtained by walking down the insert using primers ptw3971 and ptw258, showed that excision of the plasmid from Pinnacle HasNeg had occurred between base 455 of pTW100 and base 2374 in the hasB gene (Figs. 2 and 3). Since the amplicon using primers has261 and has849 was the result of non-specific annealing an attempt was made, using primers has261 and a reverse primer from the middle of hasC (158R3132), to obtain authentic amplicons and confirm the sites of plasmid excision. This PCR resulted in more than one amplicon under stringent annealing conditions of 61 8C (Fig. 2) The 2 kb amplicon of the Pinnacle HasNeg clone deemed most probably authentic was purified. DNA sequence of this amplicon using primers has261, ptw3971, ptw258, 158R3132 and 15R2577 confirmed both its authenticity and the site of excision of pTW100 plasmid sequences (Fig. 3). The GenBank accession number for the nucleotide sequence of the altered has operon of Pinnacle HasSpec is AF518732
4. Discussion A fundamental challenge to genetic manipulation of the pyogenic streptococci including S. equi has been the difficulty of introducing genetic material into the cell. This is in part due to the thick cell wall and thick outer capsule. The addition of 90 mM glycine to the culture media followed by hyaluronidase (200 mg/ml) was designed to reduce these obstacles and increase the frequency of transformation. This strategy resulted in the production of 90 transformed colonies, some of which were confirmed to contain the recombinant plasmid. Various strategies and plasmid constructs have been utilised to mutagenise streptococci based on replication failure in streptococci (Tao et al., 1992; Podbielski et al., 1997) or involving use of temperature-sensitive plasmids (Maguin and Prevost, 1996; Biswas et al., 1993; Framson et al., 1997). Inhibition of plasmid replication at 37 8C was a valuable characteristic of pTW100. Specific integration of pJW901 into the genome of Pinnacle targeted an internal sequence of hasA. Following transformation, homology between the has sequence in
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
319
pTW901 and the genome led to site-specific integration of the recombinant plasmid via a single-crossover event (Fig. 1). As expected, integration resulted in loss of hasA expression and a non-encapsulated phenotype. However, isolation of capsule negative clones of S. equi with resistance to spectinomycin was at a much lower frequency than observed using pTW100 in group B streptococci (Zhou et al., 1999). Only one clone (Pinnacle HasNeg) from 90 transformants was found to maintain a capsule negative phenotype and spectinomycin resistance at 37 8C. The most likely explanation is a low rate of integration, possibly related to an inherent deficiency in homologous recombination in S. equi. It is also possible that the responsiveness of the repA gene to temperature regulation is less precise in S. equi than in E. coli or group B streptococci resulting in extrachromosomal persistence of the plasmid (Framson et al., 1997). Other explanations include selection of spectinomycin resistant mutants or sub-inhibitory levels of spectinomycin (100 mg/ml) that allowed overgrowth of non-transformed bacteria. However, 100 mg/ml of spectinomycin was inhibitory for the parent strain of Pinnacle. Pinnacle HasNeg maintained a stable nonmucoid phenotype over many passages when grown in the presence of spectinomycin. Since strains potentially useful as vaccines should not contain genes for antibiotic resistance, it was necessary to isolate a clone of Pinnacle HasSpec that had lost the spectinomycin resistance gene. The ratio of non-mucoid mutants after growth at 37 8C to transformants (1:100) indicated either that plasmid integration was low or precise excision of plasmid without elimination of pTW100 sequences occurred at a fairly high rate, with a concomitant reversion to a capsulated phenotype. Detection of mucoid colonies following just a few rounds of subculture at 30 8C indicated that precise excision had occurred at high frequency in the absence of antibiotic selection. Since the goal was to detect a clone in which imprecise excision of plasmid had occurred, non-mucoid colonies were screened for antibiotic sensitivity. Out of 50, 4 colonies found to be spectinomycin sensitive yielded identical amplicons following PCR. This indicated that all four clones had originated from a single excision event during an earlier passage. The high frequency of precise excision events noted during a few rounds of subculture suggested that deletions in the HasNeg mutants might involve few nucleotides. However, sequence analysis of Pinnacle HasNeg revealed that deletion of genomic and integrant DNA following excision of pTW100 was more extensive than expected. Not only had most of the pTW100 insert been deleted, but a total of 1596 bp of the has operon was deleted. This deletion included the remaining 30 end of hasA, the intergenic region between hasA and hasB and the first 987 bp of hasB (Figs. 1 and 3). As expected, given the improbability of restoration of such a large portion of the has operon, the phenotype of Pinnacle HasNeg remained stable over many passages. Analysis of the has operon in S. equi indicated that hasA, hasB and hasC (Fig. 1) have sizes and organisation similar to those of S. pyogenes An interesting, and as yet unexplained finding was that of an additional copy of hasC in another region of the S. equi genome. Since hasC is not essential for capsule production in S. pyogenes, it is possible that the additional copies in S. equi are indicative of another role for the hasC gene product. Use of this has deletion mutant in place of the parent Pinnacle strain currently used in the field will permit rapid genotypic recognition of the vaccine strain by the difference in size of amplicon produced using the has261 and has158R3132 primers. The large deletion of
320
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
the has operon removes any possibility of simple reversion to a potentially more virulent encapsulated form.
Acknowledgements The authors wish to acknowledge the financial support of Fort Dodge Animal Health, Fort Dodge, Iowa. We are also indebted to Dr. Jacqui Shea of Microscience, UK, for plasmid pTW100.
References Anzai, T., Timoney, J.F., Kuwamoto, Y., Fujita, Y., Wada, R., Inoue, T., 1999. In vivo pathogenicity and resistance to phagocytosis of Streptococcus equi strains with different levels of capsule expression. Vet. Microbiol. 67, 286–377. Ashbaugh, C.D., Alberti, S., Wessels, M.R., 1998. Molecular analysis of the capsule gene region of group A Streptococcus: the hasAB genes are sufficient for capsule expression. J. Bacteriol. 190, 4955–4959. Ausbusal, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1992. Short Protocols in Molecular Biology, 2nd ed. Wiley, New York, pp. 1.26–1.27. Biswas, I., Gruss, A., Ehrlich, S.D., Maguin, E., 1993. High-efficiency gene inactivation and replacement system for Gram-positive bacteria. J. Bacteriol. 175, 3625–3628. Chanter, N., Collin, N.C., Mumford, J.A., 1994. Resistance of Streptococcus equi in vitro to equine polymorphonuclear leucocytes. In: Nakajima, H., Plowright, W. (Eds.), Equine Infectious Diseases VII. R&W Publications, Newmarket, UK, pp. 201–205. Dougherty, B.A., van de Rijn, I., 1992. Molecular characterization of a locus required for hyaluronic acid capsule production in group A streptococci. J. Exp. Med. 175, 1291–1299. Dougherty, B.A., van de Rijn, I., 1993. Molecular characterization of hasB from an operon required for hyaluronic acid synthesis in group A streptococci. J. Biol. Chem. 268 (10), 7118–7124. Dougherty, B.A., van de Rijn, I., 1994. Molecular characterization of hasA from an operon required for hyaluronic acid synthesis in group A streptococci. J. Biol. Chem. 269 (1), 169–175. Dunny, G.M., Lee, L.N., Le Blanc, D.J., 1991. Improved electroporation and cloning vector system for Grampositive bacteria. Appl. Environ. Microbiol. 57, 1194–1201. Flanagan, J., Collin, N., Timoney, J., Mitchell, T., Mumford, J.A., Chanter, N., 1998. Characterization of the haemolytic activity of Streptococcus equi. Microbial Pathol. 24, 211–221. Framson, P.E., Nittayajarn, A., Merry, J., Youngman, P., Rubens, C.E., 1997. New genetic techniques for group B streptococci: high-efficiency transformation, maintenance of temperature-sensitive pWV01 plasmids and mutagenesis with Tn917. Appl. Environ. Microbiol. 63, 3539–3547. Gala`n, J.E., Timoney, J.F., 1985. Mucosal nasopharyngeal immune response of the horse to protein antigens of Streptococcus equi. Infect. Immun. 47, 623–628. Hamlen, H.J., Timoney, J.F., Bell, R.J., 1994. Epidemiologic and immunologic characteristics of Streptococcus equi infection in foals. J. Am. Vet. Med. Assoc. 204, 768–775. Ha˚varstein, L.S., Hakenbeck, R., Gaustad, P., 1997. Natural competence in the genus Streptococcus: evidence that streptococci can change pherotype by interspecies recombinational exchanges. J. Bacteriol. 179, 6589–6594. Leenhouts, K.J., Tolner, B., Bron, S., Kok, J., Venema, G., Seegers, J.F.M.L., 1991. Nucleotide sequence and characterization of the broad-host range lactococcal plasmid pWV01. Plasmid 26, 55–66. Maguin, E.H., Prevost, H., 1996. Efficient insertional mutagenesis in lactococci and other Gram-positive bacteria. J. Bacteriol. 178, 931–935. McLaughlin, R.E., Ferretti, J.J., 1995. Electrotransformation of streptococci. In: Nicholoff, J.A. (Ed.), Methods in Molecular Biology: Electroporation Protocols for Microorganisms, vol. 47. Humana Press, Totowa, NJ, pp. 185–193.
J.A. Walker, J.F. Timoney / Veterinary Microbiology 89 (2002) 311–321
321
Mukhtar, M., Timoney, J.F., 1988. Chemotactic response of equine polymorphonuclear leukocytes to Streptococcus equi. Res. Vet. Sci. 45, 225–229. Podbielski, A., Spellerberg, B., Woischink, M., Pohl, B., Lutticken, R., 1997. Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS). Gene 177, 137–147. Simon, D., Ferretti, J.J., 1991. Electrotransformation of Streptococcus pyogenes with plasmid and linear DNA. FEMS Microbiol. Lett. 82, 219–224. Spanier, J.G., Timoney, J.F., 1977. Bacteriophages of Streptococcus equi. J. Gen. Virol. 35, 369–375. Tao, L., LeBlanc, D.J., Ferretti, J.J., 1992. Novel streptococcal-integration shuttle vectors for gene cloning and inactivation. Gene 120, 105–110. Timoney, J.F., Gala`n, J.E., 1985. The protective response of the horse to an avirulent strain of Streptococcus equi. In: Kimura, Y., Kotami, S., Shiokowa, Y. (Eds.), Recent Advances in Streptococci and Streptococcal Diseases. Reedbooks, Bracknell, England, pp. 294–295. Zhou, L., Everest, P., Santangelo, J., O’Dwyer, C., Feldman, R., Shea, J., 1999. Insertion–duplication mutagenesis of group B Streptococcus: ScpB is not required for virulence in a neonatal mouse model of infection. In: Abstracts of XIV Lancefield International Symposium on Streptococci and Streptococcal Disease. Auckland, New Zealand.