- Email: [email protected]
Construction of antibiotic resistance cassettes with multiple paired restriction sites for insertional mutagenesis of Haemophilus influenzae
FEMS Microbiology Letters 158 (1998) 57^60
Construction of antibiotic resistance cassettes with multiple paired restriction sites for insertional mutagenesis of Haemophilus in£uenzae Paul W. Whitby a , Daniel J. Morton a , Terrence L. Stull a
b
a;b;
*
Department of Pediatrics, University of Oklahoma Health Sciences Center, CHO 2B300, 940 N.E. 13th Street, Oklahoma City, OK 73104, USA Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Oklahoma City OK 73104, USA Received 30 August 1997; revised 30 October 1997; accepted 30 October 1997
Abstract Insertional mutagenesis of cloned genes coupled with site specific recombination into the genome of the parent organism is an ideal method for characterizing gene function. In this paper we describe the production and utility of two antibiotic resistance cassettes for use in Haemophilus influenzae. The mutagenic elements encode resistance to chloramphenicol or spectinomycin. Multiple paired restriction enzyme sites bound both cassettes. Use of these constructs to create mutants in H. influenzae demonstrated that the cassettes are readily incorporated into the genome in single copy and allow easy detection of mutant constructs. The insertions are stable following repeated in vitro passage. In addition, the elements are compatible with each other and allow the construction of multiple mutations within a single strain. ß 1998 Published by Elsevier Science B.V. All rights reserved. Keywords : Haemophilus in£uenzae; Insertional mutagenesis
1. Introduction The generation of isogenic mutants by the site speci¢c insertion of a foreign piece of DNA is a common method used to characterize gene function in a diverse range of bacterial species [1]. To facilitate the detection of the mutant strain the inserted element usually encodes a phenotypic marker, such as an antibiotic resistance gene. Transposon Tn916, a 16.4-kb Streptococcus transposon, has been used to * Corresponding author. Tel.: +1 (405) 271-4401; Fax: +1 (405) 271-8710; E-mail: [email protected]
interrupt the genomes of both Haemophilus in£uenzae and H. parain£uenzae, although the large size of Tn916 may limit its utility [2]. Certain transposons are inherently unstable, allowing the possibility that further transpositions may occur following the initial screening [3,4]. To overcome the limitations associated with transposons, we previously constructed a small, insertable, antibiotic resistance cassette [5]. This element, TSTE, is a 2.2-kb DNA fragment containing the neo gene of Tn5 £anked by BamHI restriction enzyme sites. Following insertion into a gene and transformation into competent H. in£uenzae, the TSTE element generates isogenic mutants, is
0378-1097 / 98 / $19.00 ß 1998 Published by Elsevier Science B.V. All rights reserved. PII S 0 3 7 8 - 1 0 9 7 ( 9 7 ) 0 0 5 0 0 - 4
FEMSLE 7928 5-1-98
58
P.W. Whitby et al. / FEMS Microbiology Letters 158 (1998) 57^60
stable in the genome as a single copy, and produces a readily detectable phenotype (resistance to kanamycin or ribostamycin) [5]. While this element is useful in construction of mutants in H. in£uenzae, additional cassettes are needed to create and identify multiple mutations within the same strain. We have constructed two small resistance marker cassettes, both of which are £anked by multiple, restriction enzyme sites to increase their versatility.
2. Materials and methods 2.1. Bacterial strains H. in£uenzae type b strain HI689 has been previously described [6] and was routinely maintained on brain heart infusion (BHI) agar (Difco, Detroit, MI) supplemented with 10 Wg ml31 of both hemin and LNAD (supplemented BHI; sBHI). Escherichia coli strains were maintained on Luria-Bertani (LB) agar. E. coli harboring plasmids were maintained on LB supplemented with 150 Wg ml31 spectinomycin (SP), or 50 Wg ml31 chloramphenicol (CM) as appropriate. 2.2. Construction of antibiotic resistance cassettes DNA encoding the individual antibiotic resistance markers was ampli¢ed in the PCR using oligonucleotide primers designed from the published DNA sequences of pACYC184 and pSF148 [7,8]. The primers incorporated various restriction enzyme sites at the 5P end of the oligonucleotide, and are listed in Table 1. The primer pair designed for the CM resistance markers was optimized in a PCR containing 200 ng template, 100 ng each primer, 2 mM MgCl2 , 2 units Taq DNA polymerase (Gibco-BRL, Gaithersburg, MD), 200 WM each dNTP in 50 Wl 1UTaq DNA polymerase bu¡er, to yield a single product of the anticipated size. The primers Cmr1 and Cmr2 ampli¢ed a band of approximately 1300 bp from pACYC184 [8]. The 1300-bp product from the PCR using primers Cmr1 and Cmr2 was ligated directly to the AT cloning vector pCR2.1 (Invitrogen, Carlsbad, CA), transformed into competent E. coli InvKFP (Invitrogen), and selected on LB agar containing CM. Resistant colonies were identi¢ed
and plasmids were isolated and analyzed by restriction digestion to identify correct constructs. A plasmid of the correct construct was designated pCMR. Using the primer pair Spcr1 and Spcr2, an approximately 1200-bp product was ampli¢ed from pSF148 in a PCR containing 200 ng template, 100 ng each primer, 2 mM MgCl2 , 2 units Pfu DNA polymerase (Stratagene, La Jolla, CA), 200 WM each dNTP in 50 Wl 1UPfu DNA polymerase bu¡er. The ampli¢ed SP resistance marker was cloned into the vector pCR-Blunt (Invitrogen). Following ligation the construct was transformed into competent E. coli TOP10 (Invitrogen), and transformants were selected on LB agar containing SP. A plasmid of the correct construct was identi¢ed and termed pSPECR. 2.3. Insertional mutagenesis To ensure correct function of the antibiotic resistance cassettes in single copy in the genome of H. in£uenzae, insertional mutants of H. in£uenzae HI689 were constructed using both of the cassettes. Each cassette was excised from the vector and inserted by ligation into di¡erent pieces of H. in£uenzae genomic DNA which had been previously cloned in E. coli. The resulting mutagenic construct was con¢rmed by enzyme restriction and subsequently transformed into competent H. in£uenzae [9]. Mutant H. in£uenzae were selected on sBHI under antibiotic selection as described below. 2.4. Characterization of insertional mutants Single H. in£uenzae mutant colonies were selected and replated on sBHI agar with the appropriate antibiotic. Following overnight growth several isolates of each mutant were grown in sBHI broth and the genomic DNA isolated using the DNA Now reagent (Biogentex, Seabrook, TX). Insertion of the cassette as a single copy and at the correct loci was con¢rmed by Southern analyses [10] using probes prepared from the mutagenized DNA fragment and the individual antibiotic resistance cassettes, labeled using the ECL Random Prime Kit (Amersham, Arlington Heights, IL). Southern blots were developed using the ECL detection reagents (Amersham) followed by exposure to X-ray ¢lm as required.
FEMSLE 7928 5-1-98
P.W. Whitby et al. / FEMS Microbiology Letters 158 (1998) 57^60
59
Fig. 1. Arrangement of the restriction enzyme sites £anking the chloramphenicol and spectinomycin resistance cassettes in the plasmids pCMR and pSPECR respectively. E, EcoRI; K, KpnI; X, XmaI; S, SmaI; N, NarI; Sa, SacII; P, PstI; Bg, BglII; B, BamHI; Ev, EcoRV; Pv, PvuI; C, ClaI.
3. Results and discussion Since the chloramphenicol acetyltransferase gene of pACYC184 is known to function in H. in£uenzae [8,11], this plasmid was selected as the source of the CM resistance marker. To determine if the spectinomycin adenyltransferase AAD(9) gene on pSF148 [12] was functional in H. in£uenzae, competent H. in£uenzae strain HI689 [9] was transformed with pSF148 DNA, and transformants were selected on sBHI containing SP. Transformants were selectable on concentrations of SP ranging from 100 Wg ml31 to 500 Wg ml31 . PCRs using the primer pairs (Table 1) with the appropriate template plasmid yielded a single band of the anticipated size (data not shown). The PCR products were successfully cloned into either the TA cloning pCR2.1 or the blunt ended cloning vector pCR-Blunt as appropriate. Miniprep analysis of the plasmid constructs indicated that for each construct: (1) an insert of the correct size was present, and (2) excision of the cassette could be achieved with all the enzymes incorporated in to the PCR primers (data not shown). The arrangement of these restriction sites is shown in Fig. 1. In addition to the incorporated enzymes, the insert of pSPECR could be ex-
cised using EcoRI. Although the insert of pCMR is £anked by EcoRI sites, the utility of these sites to excise the cassette is limited by the presence of an EcoRI site in the middle of the CM resistance gene. To demonstrate the utility of these antibiotic resistance markers in construction of isogenic mutants in H. in£uenzae, the cassettes were inserted into fragments of H. in£uenzae DNA previously cloned in E. coli. The plasmid construct was con¢rmed by restriction analysis and then used to transform competent H. in£uenzae HI689 with selection on the appropriate antibiotic. Chloramphenicol resistant transformants were selected on 3 Wg ml31 CM, and SP resistant transformants were selected on 200 Wg ml31 SP. In addition to strain HI689 the SP resistance cassette has been successfully used to generate mutants in two other H. in£uenzae strains, Rd KW20 (ATCC 51907) and the nontypeable strain HI1388. In vitro passage of resistant colonies indicated that the observed antibiotic resistance was stable. Southern analysis of several recombinant genomes of each H. in£uenzae mutant indicated that each genome contained a single copy of the mutagenic element in the expected locus (data not shown). To assess the ability of these constructs to create multiple mutations in one strain, H. in£uenzae was
Table 1 Sequence of primers used to amplify the chloramphenicol and spectinomycin resistance markers Primer
Sequence (5P-3P)
Cmr1 Cmr2
GGTACCCGGGCGCCGCGGCTGCAGATCTCCTCCACGGGGAGAGCCTGA ATATCTGCAGGCGCCCGGGTACCGCGGCCACCCCGTCAGTAGCTGAACAGGAGGG
Spcr1 Spcr2
GGATCCCGGGATATCTGCAGCTGTACAGATCTATCGATTTTCGTTCGTGAATACATG CCCGGGATCCAGCTGCAGATCTGTACATCGATATCATATGCAAGGGTTTATTGTTTTCTAA
FEMSLE 7928 5-1-98
60
P.W. Whitby et al. / FEMS Microbiology Letters 158 (1998) 57^60
transformed with DNA from the single mutants. Double mutants were constructed and analyzed as above. The results indicated that the cassettes were stable in the presence of each other. In addition we have used the SP resistance cassette in conjunction with a ribostamycin (RB) resistance cassette (15 Wg ml31 RB), and a tetracycline (TC) resistance cassette (3 Wg ml31 TC), both previously constructed in this laboratory [5,13], to construct a multiple mutant (data not shown). Following transformation of the SP resistance marker into a RB/TC resistant HI689 derivative, eight SP resistant colonies were characterized. The eight SP resistant colonies were resistant to SP, RB and TC, and Southern analyses demonstrated that the three antibiotic resistance markers were present in the genome in single copy and were inserted in the anticipated loci (data not shown). Triple mutants have similarly been constructed using strains Rd KW20 and HI1388. In this study we constructed two new cassettes, £anked by a total of 12 di¡erent restriction sites, one of which is blunt ended. We have reported the construction of two other antibiotic cassettes encoding ribostamycin resistance, TSTE, and tetracycline resistance, GESY, which were successfully used to construct mutants in H. in£uenzae [5,13]. The four resistance cassettes constructed in this laboratory function in H. in£uenzae and thus provide valuable genetic tools to advance the study of this organism through construction of multiple mutations in a given strain. These cassettes may also prove useful in construction of mutations in other organisms.
Acknowledgments This work was supported by Public Health Service Grant AI29611 from the National Institute of Allergy and Infectious Disease to T.L.S. and by Health Research Contract HN5-055 from The Oklahoma Center for the Advancement of Science to D.J.M.
References [1] Hensel, M. and Holden, D.W. (1996) Molecular genetic approaches for the study of virulence in both pathogenic bacteria and fungi. Microbiology 142, 1049^1058. [2] Kauc, L. and Goodgal, S.H. (1989) Introduction of transposon Tn916 DNA into Haemophilus in£uenzae and Haemophilus parain£uenzae. J. Bacteriol. 171, 6625^6628. [3] Bukhari, A.I. (1976) Bacteriophage mu as a transposition element. Annu. Rev. Genet. 10, 389^412. [4] LiPuma, J.J., Richman, H. and Stull, T.L. (1990) Haemocin, the bacteriocin produced by Haemophilus in£uenzae : species distribution and role in colonization. Infect. Immun. 58, 1600^ 1605. [5] Sharetzsky, C., Edlind, T.D., LiPuma, J.J. and Stull, T.L. (1991) A novel approach to insertional mutagenesis of Haemophilus in£uenzae. J. Bacteriol. 173, 1561^1564. [6] Morton, D.J., Musser, J.M. and Stull, T.L. (1993) Expression of the Haemophilus in£uenzae transferrin receptor is repressible by hemin but not elemental iron alone. Infect. Immun. 61, 4033^4037. [7] LeBlanc, D.J., Lee, L.N. and Inamine, J.M. (1991) Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis. Antimicrob. Agents Chemother. 35, 1804^1810. [8] Rose, R.E. (1988) The nucleotide sequence of pACYC184. Nucleic Acids Res. 16, 355. [9] Spenser, H.T. and Herriott, R.M. (1965) Development of competence in Haemophilus in£uenzae. J. Bacteriol. 90, 911^ 920. [10] Sambrook, T., Fritsch, E.F. and Maniatis, T. (1989) in: Molecular Cloning : A Laboratory Manual (Nolan, C., Ed.). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [11] Chang, A.C. and Cohen, S.N. (1978) Construction and characterization of ampli¢able multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134, 1141^1156. [12] Tao, L., LeBlanc, D.J. and Ferretti, J.J. (1992) Novel streptococcal-integration shuttle vectors for gene cloning and inactivation. Gene 120, 105^110. [13] Ren, Z., Jin, H., Morton, D.J. and Stull, T.L. (1997) Cloning of hgpB, a gene encoding a second hemoglobin binding protein of Haemophilus in£uenzae. Abstracts of the 97th General Meeting of the American Society for Microbiology, Miami Beach, FL, Abstract B-227.
FEMSLE 7928 5-1-98
Construction of antibiotic resistance cassettes with multiple paired restriction sites for insertional mutagenesis of Haemophilus in£uenzae Paul W. Whitby a , Daniel J. Morton a , Terrence L. Stull a
b
a;b;
*
Department of Pediatrics, University of Oklahoma Health Sciences Center, CHO 2B300, 940 N.E. 13th Street, Oklahoma City, OK 73104, USA Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Oklahoma City OK 73104, USA Received 30 August 1997; revised 30 October 1997; accepted 30 October 1997
Abstract Insertional mutagenesis of cloned genes coupled with site specific recombination into the genome of the parent organism is an ideal method for characterizing gene function. In this paper we describe the production and utility of two antibiotic resistance cassettes for use in Haemophilus influenzae. The mutagenic elements encode resistance to chloramphenicol or spectinomycin. Multiple paired restriction enzyme sites bound both cassettes. Use of these constructs to create mutants in H. influenzae demonstrated that the cassettes are readily incorporated into the genome in single copy and allow easy detection of mutant constructs. The insertions are stable following repeated in vitro passage. In addition, the elements are compatible with each other and allow the construction of multiple mutations within a single strain. ß 1998 Published by Elsevier Science B.V. All rights reserved. Keywords : Haemophilus in£uenzae; Insertional mutagenesis
1. Introduction The generation of isogenic mutants by the site speci¢c insertion of a foreign piece of DNA is a common method used to characterize gene function in a diverse range of bacterial species [1]. To facilitate the detection of the mutant strain the inserted element usually encodes a phenotypic marker, such as an antibiotic resistance gene. Transposon Tn916, a 16.4-kb Streptococcus transposon, has been used to * Corresponding author. Tel.: +1 (405) 271-4401; Fax: +1 (405) 271-8710; E-mail: [email protected]
interrupt the genomes of both Haemophilus in£uenzae and H. parain£uenzae, although the large size of Tn916 may limit its utility [2]. Certain transposons are inherently unstable, allowing the possibility that further transpositions may occur following the initial screening [3,4]. To overcome the limitations associated with transposons, we previously constructed a small, insertable, antibiotic resistance cassette [5]. This element, TSTE, is a 2.2-kb DNA fragment containing the neo gene of Tn5 £anked by BamHI restriction enzyme sites. Following insertion into a gene and transformation into competent H. in£uenzae, the TSTE element generates isogenic mutants, is
0378-1097 / 98 / $19.00 ß 1998 Published by Elsevier Science B.V. All rights reserved. PII S 0 3 7 8 - 1 0 9 7 ( 9 7 ) 0 0 5 0 0 - 4
FEMSLE 7928 5-1-98
58
P.W. Whitby et al. / FEMS Microbiology Letters 158 (1998) 57^60
stable in the genome as a single copy, and produces a readily detectable phenotype (resistance to kanamycin or ribostamycin) [5]. While this element is useful in construction of mutants in H. in£uenzae, additional cassettes are needed to create and identify multiple mutations within the same strain. We have constructed two small resistance marker cassettes, both of which are £anked by multiple, restriction enzyme sites to increase their versatility.
2. Materials and methods 2.1. Bacterial strains H. in£uenzae type b strain HI689 has been previously described [6] and was routinely maintained on brain heart infusion (BHI) agar (Difco, Detroit, MI) supplemented with 10 Wg ml31 of both hemin and LNAD (supplemented BHI; sBHI). Escherichia coli strains were maintained on Luria-Bertani (LB) agar. E. coli harboring plasmids were maintained on LB supplemented with 150 Wg ml31 spectinomycin (SP), or 50 Wg ml31 chloramphenicol (CM) as appropriate. 2.2. Construction of antibiotic resistance cassettes DNA encoding the individual antibiotic resistance markers was ampli¢ed in the PCR using oligonucleotide primers designed from the published DNA sequences of pACYC184 and pSF148 [7,8]. The primers incorporated various restriction enzyme sites at the 5P end of the oligonucleotide, and are listed in Table 1. The primer pair designed for the CM resistance markers was optimized in a PCR containing 200 ng template, 100 ng each primer, 2 mM MgCl2 , 2 units Taq DNA polymerase (Gibco-BRL, Gaithersburg, MD), 200 WM each dNTP in 50 Wl 1UTaq DNA polymerase bu¡er, to yield a single product of the anticipated size. The primers Cmr1 and Cmr2 ampli¢ed a band of approximately 1300 bp from pACYC184 [8]. The 1300-bp product from the PCR using primers Cmr1 and Cmr2 was ligated directly to the AT cloning vector pCR2.1 (Invitrogen, Carlsbad, CA), transformed into competent E. coli InvKFP (Invitrogen), and selected on LB agar containing CM. Resistant colonies were identi¢ed
and plasmids were isolated and analyzed by restriction digestion to identify correct constructs. A plasmid of the correct construct was designated pCMR. Using the primer pair Spcr1 and Spcr2, an approximately 1200-bp product was ampli¢ed from pSF148 in a PCR containing 200 ng template, 100 ng each primer, 2 mM MgCl2 , 2 units Pfu DNA polymerase (Stratagene, La Jolla, CA), 200 WM each dNTP in 50 Wl 1UPfu DNA polymerase bu¡er. The ampli¢ed SP resistance marker was cloned into the vector pCR-Blunt (Invitrogen). Following ligation the construct was transformed into competent E. coli TOP10 (Invitrogen), and transformants were selected on LB agar containing SP. A plasmid of the correct construct was identi¢ed and termed pSPECR. 2.3. Insertional mutagenesis To ensure correct function of the antibiotic resistance cassettes in single copy in the genome of H. in£uenzae, insertional mutants of H. in£uenzae HI689 were constructed using both of the cassettes. Each cassette was excised from the vector and inserted by ligation into di¡erent pieces of H. in£uenzae genomic DNA which had been previously cloned in E. coli. The resulting mutagenic construct was con¢rmed by enzyme restriction and subsequently transformed into competent H. in£uenzae [9]. Mutant H. in£uenzae were selected on sBHI under antibiotic selection as described below. 2.4. Characterization of insertional mutants Single H. in£uenzae mutant colonies were selected and replated on sBHI agar with the appropriate antibiotic. Following overnight growth several isolates of each mutant were grown in sBHI broth and the genomic DNA isolated using the DNA Now reagent (Biogentex, Seabrook, TX). Insertion of the cassette as a single copy and at the correct loci was con¢rmed by Southern analyses [10] using probes prepared from the mutagenized DNA fragment and the individual antibiotic resistance cassettes, labeled using the ECL Random Prime Kit (Amersham, Arlington Heights, IL). Southern blots were developed using the ECL detection reagents (Amersham) followed by exposure to X-ray ¢lm as required.
FEMSLE 7928 5-1-98
P.W. Whitby et al. / FEMS Microbiology Letters 158 (1998) 57^60
59
Fig. 1. Arrangement of the restriction enzyme sites £anking the chloramphenicol and spectinomycin resistance cassettes in the plasmids pCMR and pSPECR respectively. E, EcoRI; K, KpnI; X, XmaI; S, SmaI; N, NarI; Sa, SacII; P, PstI; Bg, BglII; B, BamHI; Ev, EcoRV; Pv, PvuI; C, ClaI.
3. Results and discussion Since the chloramphenicol acetyltransferase gene of pACYC184 is known to function in H. in£uenzae [8,11], this plasmid was selected as the source of the CM resistance marker. To determine if the spectinomycin adenyltransferase AAD(9) gene on pSF148 [12] was functional in H. in£uenzae, competent H. in£uenzae strain HI689 [9] was transformed with pSF148 DNA, and transformants were selected on sBHI containing SP. Transformants were selectable on concentrations of SP ranging from 100 Wg ml31 to 500 Wg ml31 . PCRs using the primer pairs (Table 1) with the appropriate template plasmid yielded a single band of the anticipated size (data not shown). The PCR products were successfully cloned into either the TA cloning pCR2.1 or the blunt ended cloning vector pCR-Blunt as appropriate. Miniprep analysis of the plasmid constructs indicated that for each construct: (1) an insert of the correct size was present, and (2) excision of the cassette could be achieved with all the enzymes incorporated in to the PCR primers (data not shown). The arrangement of these restriction sites is shown in Fig. 1. In addition to the incorporated enzymes, the insert of pSPECR could be ex-
cised using EcoRI. Although the insert of pCMR is £anked by EcoRI sites, the utility of these sites to excise the cassette is limited by the presence of an EcoRI site in the middle of the CM resistance gene. To demonstrate the utility of these antibiotic resistance markers in construction of isogenic mutants in H. in£uenzae, the cassettes were inserted into fragments of H. in£uenzae DNA previously cloned in E. coli. The plasmid construct was con¢rmed by restriction analysis and then used to transform competent H. in£uenzae HI689 with selection on the appropriate antibiotic. Chloramphenicol resistant transformants were selected on 3 Wg ml31 CM, and SP resistant transformants were selected on 200 Wg ml31 SP. In addition to strain HI689 the SP resistance cassette has been successfully used to generate mutants in two other H. in£uenzae strains, Rd KW20 (ATCC 51907) and the nontypeable strain HI1388. In vitro passage of resistant colonies indicated that the observed antibiotic resistance was stable. Southern analysis of several recombinant genomes of each H. in£uenzae mutant indicated that each genome contained a single copy of the mutagenic element in the expected locus (data not shown). To assess the ability of these constructs to create multiple mutations in one strain, H. in£uenzae was
Table 1 Sequence of primers used to amplify the chloramphenicol and spectinomycin resistance markers Primer
Sequence (5P-3P)
Cmr1 Cmr2
GGTACCCGGGCGCCGCGGCTGCAGATCTCCTCCACGGGGAGAGCCTGA ATATCTGCAGGCGCCCGGGTACCGCGGCCACCCCGTCAGTAGCTGAACAGGAGGG
Spcr1 Spcr2
GGATCCCGGGATATCTGCAGCTGTACAGATCTATCGATTTTCGTTCGTGAATACATG CCCGGGATCCAGCTGCAGATCTGTACATCGATATCATATGCAAGGGTTTATTGTTTTCTAA
FEMSLE 7928 5-1-98
60
P.W. Whitby et al. / FEMS Microbiology Letters 158 (1998) 57^60
transformed with DNA from the single mutants. Double mutants were constructed and analyzed as above. The results indicated that the cassettes were stable in the presence of each other. In addition we have used the SP resistance cassette in conjunction with a ribostamycin (RB) resistance cassette (15 Wg ml31 RB), and a tetracycline (TC) resistance cassette (3 Wg ml31 TC), both previously constructed in this laboratory [5,13], to construct a multiple mutant (data not shown). Following transformation of the SP resistance marker into a RB/TC resistant HI689 derivative, eight SP resistant colonies were characterized. The eight SP resistant colonies were resistant to SP, RB and TC, and Southern analyses demonstrated that the three antibiotic resistance markers were present in the genome in single copy and were inserted in the anticipated loci (data not shown). Triple mutants have similarly been constructed using strains Rd KW20 and HI1388. In this study we constructed two new cassettes, £anked by a total of 12 di¡erent restriction sites, one of which is blunt ended. We have reported the construction of two other antibiotic cassettes encoding ribostamycin resistance, TSTE, and tetracycline resistance, GESY, which were successfully used to construct mutants in H. in£uenzae [5,13]. The four resistance cassettes constructed in this laboratory function in H. in£uenzae and thus provide valuable genetic tools to advance the study of this organism through construction of multiple mutations in a given strain. These cassettes may also prove useful in construction of mutations in other organisms.
Acknowledgments This work was supported by Public Health Service Grant AI29611 from the National Institute of Allergy and Infectious Disease to T.L.S. and by Health Research Contract HN5-055 from The Oklahoma Center for the Advancement of Science to D.J.M.
References [1] Hensel, M. and Holden, D.W. (1996) Molecular genetic approaches for the study of virulence in both pathogenic bacteria and fungi. Microbiology 142, 1049^1058. [2] Kauc, L. and Goodgal, S.H. (1989) Introduction of transposon Tn916 DNA into Haemophilus in£uenzae and Haemophilus parain£uenzae. J. Bacteriol. 171, 6625^6628. [3] Bukhari, A.I. (1976) Bacteriophage mu as a transposition element. Annu. Rev. Genet. 10, 389^412. [4] LiPuma, J.J., Richman, H. and Stull, T.L. (1990) Haemocin, the bacteriocin produced by Haemophilus in£uenzae : species distribution and role in colonization. Infect. Immun. 58, 1600^ 1605. [5] Sharetzsky, C., Edlind, T.D., LiPuma, J.J. and Stull, T.L. (1991) A novel approach to insertional mutagenesis of Haemophilus in£uenzae. J. Bacteriol. 173, 1561^1564. [6] Morton, D.J., Musser, J.M. and Stull, T.L. (1993) Expression of the Haemophilus in£uenzae transferrin receptor is repressible by hemin but not elemental iron alone. Infect. Immun. 61, 4033^4037. [7] LeBlanc, D.J., Lee, L.N. and Inamine, J.M. (1991) Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis. Antimicrob. Agents Chemother. 35, 1804^1810. [8] Rose, R.E. (1988) The nucleotide sequence of pACYC184. Nucleic Acids Res. 16, 355. [9] Spenser, H.T. and Herriott, R.M. (1965) Development of competence in Haemophilus in£uenzae. J. Bacteriol. 90, 911^ 920. [10] Sambrook, T., Fritsch, E.F. and Maniatis, T. (1989) in: Molecular Cloning : A Laboratory Manual (Nolan, C., Ed.). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [11] Chang, A.C. and Cohen, S.N. (1978) Construction and characterization of ampli¢able multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134, 1141^1156. [12] Tao, L., LeBlanc, D.J. and Ferretti, J.J. (1992) Novel streptococcal-integration shuttle vectors for gene cloning and inactivation. Gene 120, 105^110. [13] Ren, Z., Jin, H., Morton, D.J. and Stull, T.L. (1997) Cloning of hgpB, a gene encoding a second hemoglobin binding protein of Haemophilus in£uenzae. Abstracts of the 97th General Meeting of the American Society for Microbiology, Miami Beach, FL, Abstract B-227.
FEMSLE 7928 5-1-98