Construction of Mammalian Cell Expression Vector for pAcGFP-bFADD Fusion Protein and Its Expression in CHO-K1 Cell

CHINESE JOURNAL OF BIOTECHNOLOGY Volume 24, Issue 11, November 2008 Online English edition of the Chinese language journal RESEARCH PAPER

Cite this article as: Chin J Biotech, 2008, 24(11), 1880í1887.

Construction of Mammalian Cell Expression Vector for pAcGFP-bFADD Fusion Protein and Its Expression in CHO-K1 Cell Runjun Yang1,2, Shangzhong Xu1,2, Lupei Zhang2, Junya Li2, and Xue Gao2 1

College of Animal Science and Technology, Northwest A˂F University, Yangling 712100, China

2

Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100193, China

Abstract: Fas-associated death domain (FADD) is a signal connection protein in the Fas/FasL apoptotic path, which may play a key role in apoptosis, by transferring the apoptotic signal. To reveal the intracellular signal transduction molecules involved in the procedure of follicular development in the bovine ovary, the authors cloned the FADD gene in the bovine ovary tissue with reverse transcription polymerase chain reaction (RT-PCR), deleted the termination codon in its cDNA, and directionally cloned the amplified FADD gene into eukaryotic expression vector pAcGFP-Nl, including AcGFP, and successfully constructed the fusion protein recombinant plasmid. After identifying by restrictive enzyme Bgl II/EcoR I and sequencing, the transfected pAcGFP-bFADD into CHO-K1 cell, mediated by Lipofectamine 2000, observed the expression of AcGFP and detected the transcription and expression of FADD by RT-PCR and Western blotting. The results showed that the cattle FADD was successfully cloned, the pAcGFP-bFADD fusion protein recombinant plasmid was successfully constructed by introducing Bgl II, EcoR I cloning site at the two ends of the FADD open reading frame and inserting a Kozak sequence before the start codon. AcGFP expression was detected as early as 24 h after transfection. The percentage of AcGFP positive cells reached about 65% after 24 h. A 654 bp transcription was amplified by RT-PCR, and 51.4 kD target protein was detected by Western blot. Construction of the pAcGFP-bFADD recombinant plasmid should be helpful for further understanding the mechanism and regulation of FADD on bovine oocyte formation and development. Keywords: FADD; pAcGFP-Nl; recombinant plasmid; CHO-K1 cell

Introduction The FAS-associated death domain (FADD) protein is an adapter/signaling molecule that has been shown to function in animal cells to promote apoptosis and to inhibit NF-țB activation[1].Subsequently, the researchers discovered that FADD plays a role not only in apoptosis signaling pathway, but also in the proliferation of T cells; the gametogenesis and application of gene therapy also plays an important

role[2-4]. The bovine FADD gene is located on chromosome 29, and contains two exons, which encode DED and DD protein domains, respectively. The FADD mRNA and protein are expressed extensively in the Lymphoid tissue and nonlymphoid tissues (such as liver, testis, pancreas, ovary, and other tissues) and this trend is more significant in ovary, testis, and lymphoid tissue[5]. FADD not only transferred the apoptotic signal, but

Received: May 26, 2008; Accepted: August 25, 2008 Corresponding author: Shangzhong Xu. Tel: +86-10-62816065; Fax: +86-10-62817806; E-mail: simmenta @vip.sina.com Supported by: the National High Technology Research and Development Program (863 Program, No. 2006AA107Z 197) and National Technology Supporting Scheme “Breeding Project of Animals and Plants” during the 11th Five Year Plan Period (No. 2006BAD01A10). Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.

Runjun Yang et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1880–1887

also induced cell proliferation by promoting mitosis[6].In different stages of oocyte development, FADD was involved in follicle atresia mediated apoptosis by Fas/FasL, and promoted development of oocytes, by inducing ovarian granulosa cell proliferation, with interaction in different cytoplasmic proteins, to maintain the equilibrium state of follicular development. It reveals that FADD plays an important role in the regulation of oogenesis. In this study, the authors inserted the cloned FADD gene into the eukaryotic expression vector pAcGFP-Nl, and successfully constructed fusion protein recombinant plasmid pAcGFP-bFADD, and then transfected it into the CHO-K1 cell. It could provide technical support for the basic research on the regulation of FADD on bovine oogonium development, and be important for further research.

1

Materials and methods

1.1 Materials 1.1.1 Bacterial strains, plasmids, and cell: E. coli DH5D was obtained from the laboratory. PMD19-T Simple vector and cDNA synthesis reverse transcription kit were purchased from Takara Corporation. pAcGFP-Nl plasmid was purchased from Clontech Corporation. Trizol kit was purchased from Clontech Introvege Corporation. CHO-K1 cell was obtained from the Cell Center of Chinese Academy of Medical Sciences. 1.1.2 Enzymes and reagents: All kinds of restriction endonucleases and modifying enzymes used in this study were purchased from TaKaRa Biotechnology Co. Ltd. (Dalian, China). Agarose gel DNA Purification Kit, TIANprep Mini Plasmid Kit, and DNA marker were purchased from Tiangen Biotech Co. Ltd. Dulbecco’s Modified Eagle Media, Fetal Bovine Serum, Neomycin (G418), liposome Lipofectamine 2000, and Opti-MEM serum-free media were purchased from Invitrogen Corporation. Rabbit anti-bovine FADD polyclonal antibody was obtained from Santa Cruz Biotechnology Inc. Rabbit antiperoxidase antibody was purchased from Golden Bridge biotech (BEIJING) Co. Ltd. Super ECL Plus Detection Reagent, Developing Agent, and Fixing Agent were purchased from Applygen Technologies Inc. 1.2 Methods 1.2.1 Extraction of total RNA and cDNA synthesis: Ovaries were removed and preserved in Liquid Nitrogen, and then brought back to the laboratory. Total DNA was extracted from the bovine ovary using the Trizol method, OD values were measured by UV spectrophotometer, and the RNA (OD260/OD280>1.8) was chosen and then reverse-transcribed using the cDNA synthesis reverse transcription kit to synthesize the cDNA. 1.2.2 Gene cloning and sequence analysis: According to the FADD gene total length sequence (GenBank Accession

No. NM_001007816) a pair of primers was designed: forward, 5c-CATGGACCCGTTCCTGGTGC-3c; and reverse, 5c-CACAGCCACCTCCCTGAGTCTTC-3c. PCR amplification cycles was performed as follows: 94oC for 90 s; 35 cycles of 94oC for 30 s, 65oC for 30 s, and 72oC for 1 min; and a final extension period at 72oC for 10 min. PCR products were analyzed by electrophores in 1.5% (W/V) agarose gel and stained with ethidium bromide. Next the PCR products were purified and recovered using the agarose gel DNA recovery kit. The purified FADD genes were ligated with pMD19-T vector and then were transformed into the competent cell of DH5D. The positive clones were picked out and shaken overnight at 37oC, and then a random analysis of 10 clones with PCR and sequencing analysis was conducted. 1.2.3 Construction of mammalian cell expression vector for pAcGFP-FADD fusion protein: According to the Restriction Enzyme Mapping of ORF fragments of bovine FADD and multiple cloning sites of pAcGFP-N1 vector, BglĊ, EcoRĉ were chosen as clone sites. The authors designed primers at two ends of the FADD open reading frame, and inserted Bgl Ċ Restriction Enzyme site in the upstream prime and four protective bases before ATG, meanwhile they inserted a Kozak sequence, which could increase inserted gene expression level, in the eukaryotic cell. Forward primer was designed as follows: 5c-ACTAAGATCTGCCACCATGGACCCGTTCCTGGT-3c (underline part is Bgl II Enzyme site, waveline part is Kozak). When the authors designed the reverse primer, the stop codon TGA was deleted, meanwhile behind it the C base and EcoR I Restriction Enzyme site were inserted. The FADD open reading frame should be consistent with the downstream AcGFP gene sequence to ensure co-expression with the fusion protein. The reverse primer was designed as follows: 5c-ACTAGAATTCC ˊGGA GGCTCCCGGGGCAG CG-3c(underline part is EcoR I Enzyme site). In order to improve the amplification efficiency, the full-length encoding region of the bovine FADD gene was amplified by TD-PCR from the plasmid template. PCR cycles were performed as follows: 94oC for 90 s; 5 cycles of 94oC for 30 s, 70oC for 30 s, and 72oC for 1 min; 5 cycles of 94oC for 30 s, 68oC for 30 s, and 72oC for 1 min; 28 cycles of 94oC for 30 s, 66oC for 30 s, and 72oC for 1 min; and a final extension period at 72oC for 10 min. The PCR product was recovered and cloned into pMD19-T Simple vector, and then it was transformed into the competent cell of DH5D. The positive clones were picked out and shaken overnight at 37oC. Plasmids were extracted from sense clones and digested with Bgl II and EcoR I enzymes. A cDNA fragment of 654 bp was recovered and directly ligated to the AcGFPN1 eukaryotic expression vector that was digested with BglII and EcoR I enzymes, and transformed to competent cell DH5D. The positive clones were picked out and shaken

Runjun Yang et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1880–1887

overnight at 37oC. 1.2.4 Identification of recombinant plasmid pAcGFPbFADD: After random analysis of 20 clones with PCR, plasmids were extracted from sense clones and digested with Bgl II and EcoR I enzymes to confirm the expression of the bovine FADD. The DNA sequence of the ORF was determined using an automatic DNA sequencer (ABI Prism 310; PE Applied Biosystems). All these procedures were performed according to the manufacturer’s instructions. The Recombinant Plasmid (pAcGFP-bFADD) was amplified in DH5D, and then the EndoFree Plasmid was extracted from the sense clones using the EndoFree Plasmid Kit. It was stored at 20oC. 1.2.5 G418 cytotoxicity test for CHO-K1: CHO-K1 Cells plated on 24-well culture plates (Falcon, Franklin Lakes, NJ, USA) were incubated in a CO2 incubator at 37oC for 24 h (5% CO2 in air; Thermo, USA). After 24 h of culture, the complete medium was replaced by the DMEM medium containing different concentrations of G418 (100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 microgram/mL). Cells were incubated at 37oC, 5% CO2 condition, then replaced every 72 h for two weeks of observation. The optimum concentration of G418, as a selection agent for CHO-K1 cell was of the lowest concentration, under which all the cells were killed 10–14 d after culture in DMEM with G418. 1.2.6 Transfection and fluorescence observation of fusion protein: One day before transfection, plated 0.5h1052h105 cells in 500 L of growth medium without antibiotics per well of a 24-well culture plate. When the cells reached more than 90% confluency, the growth medium was replaced by Opti-MEM serum-free media. For transfection, DNA was diluted in 100 PL Opti-MEM serum-free media, and then mixed with Lipofectamine™ 2000 gently before use, and the appropriate amount was diluted in 50 PL of Opti-MEM serum-free media, incubated for 5 min at room temperature. After 5 min of incubation, the diluted DNA was combined with diluted Lipofectamine™ 2000 (total volume = 100 PL). It was mixed gently and incubated for 20 min at room temperature. DNA-Lipofectamine 2000 mixture of 100 PL was added to each well containing the cells and medium. The cells were incubated at 37°C in a CO2 incubator for 4–6 h, and then the medium was changed to growth medium. The cells were put in a 1:10 or higher dilution of fresh growth medium 24 h after transfection. The positive cell clones were screened by G418. Twelve hours later, the expression of AcGFP in the cells was observed under a fluorescence microscope, and the number of positive expression cells in every 24 h, under high power field (400×), were counted. 1.2.7 Analysis of FADD by RT-PCR and Western-blotting: To confirm the insertion of a bovine FADD open reading frame, after stable transfection screening with G418, the

cells were harvested. mRNA was extracted from one part of the cells using the Quickprep Micro mRNA Purification Kit (Invitrogen, USA), and then it was reverse-transcribed to synthesize the cDNA. The primer for amplification of partial cDNA sequence of bovine FADD was designed as follows: forward, 5c-ACTA AGATCTGCCACCATGGACCC GTTCCTGGT-3c; reverse, 5c-ACTAGAATTCCGGAGGCTCC CGGGGCAGCG-3c. PCR cycles were performed as follows: 94oC for 90 s; 5 cycles of 94oC for 30 s, 70oC for 30 s, and 72oC for 1 min; 5 cycles of 94oC for 30 s, 68oC for 30 s, and 72oC for 1 min; 28 cycles of 94oC for 30 s, 66oC for 30 s, and 72oC for 1 min; and a final extension period at 72oC for 10 min. The other cells were washed twice with phosphatebuffered saline (PBS; pH 7.4), treated with 10% (V/V) trichloro acid (TCA; Wako Pure Chemicals, Japan) at 4oC for 30 min, and scraped off. These cells were then suspended in a UTD buffer [9 mol/L Urea (Wako), 2% (V/V) Triton X-100 (Sigma), and 1% (W/V) (±)-Dithiothreitol (DTT; Wako)] and 2% (W/V) lithium dodecyl sulfate (Wako). The whole cell lysate was separated by 15% (W/V) gradient sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene difluoride (PVDF) membranes. The PVDF membranes were stained with a 0.2% (W/V) Ponceau-S solution at 25oC for 1 min and then immersed in blocking solution [20 mmol/L Tris·HCl (pH 7.6), 137 mmol/L NaCl, and 0.1% (V/V) Tween-20 containing 5% (W/V) skim milk (Sigma)] for 30 min. They were then incubated with rabbit anti-bovine FADD polyclonal antibody (diluted 1:1000 with blocking solution) at 4oC for 12 h. After a wash with the blocking solution, they were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody (diluted 1:3000 with blocking solution) at 25oC for 1 h. Chemiluminescence was visualized using an ECL system (GE Healthcare Bio-Sciences) according to the manufacturer’s direction.

2

Results

2.1 Bovine FADD gene cloning and sequence analysis The optical density ratio of total RNA in the bovine ovary was 1.96. The result of gel electrophoresis detection showed that 5S mRNA was small and run up to the gelatin boundary, its banding was visible, but weak. The banding of 18S and 28S mRNA were bright, and 28S mRNA bandings were approximately two times larger than that of the 18S mRNA, which indicated that total RNA was not broken down and the purity was good (Fig. 1). The experimental results showed that a gene fragment with molecular size of about 730 bp was obtained by RT-PCR amplification (Fig. 2), which was consistent with the expected and it contained 630 bp coding region sequences.

Runjun Yang et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1880–1887

Fig. 1

Gel electrophoresis showing total RNA from bovine ovary

Fig. 3

Construction and identification of pT-bFADD

The pMD19 T-FADD plasmid acted as template, specificity primers were used to amplify the FADD coding region with BglII/EcoRI site. A 654 bp fragment was detected by electrophoresis. The FADD coding region was cloned into the pMD19-T Simple vector, then transformed into DH5Į, the plasmids were extracted from positive clones and digested with BglIIand EcoRI enzyme (TaKaRa) for 6 hours at 37oC following the supplier’s direction. A: result of bovin FADD gene with BglII, EcoRIcloning sites by PCR (M: DNA marker DL 1500; 1, 2: cattle FADD); B: identification of pT-bFADD (M: DNA marker DL 5000; 1: pT-bFADD plasmid digestion by restrictive enzyme BglII/EcoRI; 2: pT-bFADD plasmid)

Fig. 2

Products of bovin FADD gene

Using T/A cloning and choosing positive clones randomly, the double strand cDNAs were sequenced. The length of one sequence was 730 bp, which contained ORF of 630 bp (209 amino acids: aa). The aligned results showed that the sequence for bovine FADD had 100% homology with Gene Bank (NCBI). 2.2 Construction and Identification of Eukaryotic Expressing Vector of fusion gene bFADD -pAcGFP The 654 bp encoding region of the FADD gene was amplified from pT-bFADD plasmid with specific primers by touchdown PCR (TD-PCR, lane 1,2, Fig. 3A). The expected fragments were obtained by complete digestion of PMD19-T-FADD plasmid, which was extracted from the transformed positive clones with Bgl II and EcoR I (Fig. 3B, lane 1). The target gene fragment was successfully connected to the 5c end of the AcGFP cDNA, which had guaranteed that the FADD reading frame was consistent with AcGFP. The 654 bp fragments were obtained by complete digestion of the recombinant plasmid pAcGFP-bFADD, which was extracted from the transformed positive clones, with Bgl Ċ and EcoRĉ. The sequence analysis showed that the bovine FADD gene was successfully cloned into the Bgl Ċ/EcoRĉ site of the pAcGFP-N1 vector. We made sure that the FADD coding region sequence and AcGFP gene sequence (Fig. 4).

Fig. 4

Identification of recombinant plasmid

pAcGFP-bFADD by restriction enzyme digestion The restriction fragments of Bgl II/EcoR I was cloned into the pAcGFP-N1 vector then transformed into DH5Į, the plasmids were extracted from positive clones and digested with BglII and EcoRI enzyme (TaKaRa) for 6 hours at 37oC following the supplier’s direction. M: DNA marker DL 5000; 1: pAcGFP-bFADD recombinant plasmid; 2, 3: pAcGFP-bFADD digestion by restrictive enzyme BglII/EcoR I

had the same reading frame, through deleting the stop codon TGA and inserting the C base, so the target gene and fusion protein gene could express at the same time. The reconstructed plasmid was named the pAcGFP-N1 vector (Fig. 5).

Runjun Yang et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1880–1887

Fig. 5 Sequence of recombinant expression vector pAcGFP-bFADD The pAcGFP-bFADD plasmids were extracted from positive clones and sequenced by SinoGeneMax Company Limited. A: FADD ORF sequence of pAcGFP-bFADD, digestion sites with Bgl Ċand EcoRĉ, Kozak sequence (digestion sites are in the box, underline part is Kozak Sequence, dotted line arrow direction is FADD ORF); B: AcGFP sequence of pAcGFP-bFADD recombinant (dotted line arrow direction on the right)

Table 1 Cytotoxicity test of G418 to cultured CHO-K1 cells for 12 d G418 concentration (g/mL)

100

200

300

400

500

600

700

800

900

1000

Survival rate (%)

+++

++

++

+

+











+++: survival rate of 80%; ++: survival rate of 50%; +: survival rate of 30%; : survival rate of 0%

2.3 Determine the minimum dose of G418 for CHO-K1 cell After three days' selection with different concentrations of G418, the cells were in different degrees of death, and the number of suspending and breaking of cells was increasing in the treatments, supplemented with higher than 600 microgram/mL. Its peak mortality was in the eighth to tenth day duration, and the cells of the treatments supplemented with 600 microgram/ml and over 600 microgram/mL were dead on the tenth day. The concentration of microgram/mL was considered as the minimum dose of G418 for CHO-K1 cell (Table 1). 2.4 Transfection of CHO-K1 cells with pAcGFP-bFADD plasmid and G418 selection of resistant cell strain Cells transfected with the pAcGFP-bFADD plasmid by Lipofectamine 2000 were screened with G418 up to the fourteenth day. The negative control cells were all dead. There were cell clones formed in other dishes. Subsequently, the maintaining dose of G418 was used to the 18th day when all cell degeneration and necrosis disappeared and the resistant cells formed positive clones and gradually grew up. The expression of AcGFP located in the plasma and nucleus under the inverted fluorescent microscopy (Fig. 6). The observation result of green fluorescence in the cells showed that the untransfected cells were not observed under microscope fluorescent, and AcGFP could be observed around the lateral region of the nucleus in the CHO-K1 cells transfected with pAcGFP-bFADD, and uniform distribution throughout the whole cell in the pAcGFP-N1 transfection

group (Fig.7) 2.5 RT-PCR analysis of monoclonal cell strain after being selected by G418 The RNA of the monoclonal cells screened by G418 was extracted using Trizol. A 654 bp strap was amplified in the

Fig. 6

Green fluorescence positive cells after transfected with pAcGFP-bFADD plasmid

The pAcGFP-bFADD plasmid was transfected into CHO-K1 cell mediated by Lipofectamine 2000. After transfection, green fluorescent was observed by fluorescent microscopy. The expression rates of green fluorescence in CHO-K1 cell was 65% at 24 h after transfection. A: transfected CHO-K1 cell by pAcGFP-bFADD under fluorescent microscope; B: transfected CHO-K1 cell by pAcGFP-bFADD under visible light The pAcGFP-bFADD plasmid was transfected into the CHO-K1 cell mediated by Lipofectamine 2000. After transfection, green fluorescence was observed by fluorescent microscopy. The expression rates of green fluorescence in CHO-K1 cell was 65% at 24 h after transfection. A: transfected CHO-K1 cell by pAcGFP-bFADD under fluorescent microscope; B: transfected CHO-K1 cell by pAcGFP-bFADD under visible light

Runjun Yang et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1880–1887

Fig. 9 SDS-PAGE analysis and Western blotting identification of expression in CHO-K1 cell of bovin FADD fusion protein Protein sample were loaded onto 12% SDS-PAGE to separate protein and transferred to nylon cellulose membrane. The membrane was

Fig. 7 Expression of AcGFP-bFADD fusion protein and AcGFP protein in CHO-K1 cell after transfection After transfection, the green fluorescence could be detected in CHO-K1 cell transfected by pAcGFP-bFADD and pAcGFP-N1 plasmid, while there was no AcGFP expression in CHO-K1 cells untransfected by any plasmid. AcGFP could be observed around lateral region of nucleus in pAcGFP-bFADD

transfection

group

and

uniform

distribution

throughout on whole cell in pAcGFP-N1 transfection group. A, B, C: transfected CHO-K1 cell under fluorescent microscope; D, E, F: transfected CHO-K1 cell under visible light. A, D: control group; B, E: pAcGFP-bFADD transfection group; C, F: pAcGFP-N1 transfection group

probed with anti-FADD polyclonal antibody and then was probed with peroxidase-conjugated goat anti-rabbit polyclonal antibody as the second antibody. Bound antibodies were detected with the ECL. A: M: protein molecular weight marker (MW marker); 1: cell lysate of CHO-K1 cell of control group; 2: cell lysate of CHO-K1 cell of pAcGFP-N1 transfection group; 3, 4: cell lysate of CHO-K1 cell of pAcGFP -bFADD transfection group; B: 1: Western blotting analysis of pAcGFP-N1 transfection group; 2: Western blotting analysis of pAcGFP-bFADD transfection group

CHO-K1 cell successfully. 2.6 Evaluation of expressive product by SDS-PAGE electrophoresis and Western blotting analysis SDS-PAGE analysis indicated that the fusion protein of pAcGFP-bFADD was expressed in pAcGFP-N1 transfected cells and its molecular weight was about 51.4 kD (Fig. 9A, lanes 3 and 4), but there was no expression in the pAcGFP-N1 transfected cells and the negative control cells (Fig. 9A, lane 1, 2). It was preliminarily confirmed that CHO-K1 cells transfected with AcGFP expression vectors of the bovine FADD gene expressed fusion target proteins. The expressed fusion protein showed specificities of FADD polyclonal antibody as proved by Western blotting and further proved to be an immunocompetence protein (Fig. 9B).

Fig. 8 Expression of bovine FADD mRNA on CHO-K1 cell determined RT-PCR Total RNA was extracted from CHO-K1 cell and cDNA was prepared using universal primer. Specificity primers were used to amplify the FADD sequence, a 654 bp fragment was detected by electrophoresis on 1.2% agarose gel in pAcGFP-bFADD transfection group. M: DNA marker DL 5000; 1: control group; 2: pAcGFP-N1 transfection group; 3, 4: pAcGFP- bFADD transfection group

pAcGFP-bFADD transfected cells by RT-PCR, but there was no special strip amplified in pAcGFP-N1 transfected cells and the negative control cells (Fig. 8). The result showed that there was no FADD mRNA expression in the vacant carrier AcGFP transfected cells, but there was mRNA expression in the pAcGFP-bFADD transfected cells. It could be considered that the pAcGFP-bFADD had transfected the

3

Discussion

Apoptosis is an important phenomenon involved in cell survival and death during differentiation and development. The death ligand and receptor systems are considered to be apoptosis-inducing factors[7]. An adaptor protein, such as the Fas-associating death domain protein (FADD), which has a DD in the C-terminal region and a death effector domain (DED) in the N-terminal region, is recruited when each specific ligand binds to its receptor. FADD, in turn, can recruit procaspase-8 via protein–protein interactions of death effector domains (DED) contained within both proteins. FADD recruitment of the pro-caspase-8 molecules enables activation of these proenzymes into fully functional proteases resulting in the

Runjun Yang et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1880–1887

onset of apoptosis. FADD binds with procaspase-8, which composes the death-inducing signaling complex (DISC). As a result of the proteolytic autoactivation of procaspase-8, subunit protein 18 (p18) and 11 (p11) are released into the cytoplasm and reform a proteolytic component that cleaves many substrate proteins, such as, downstream caspase, procaspase-3, and mitochondrion stimulator Bid. Thus, FADD is a key molecule in the intracellular apoptosis signal-inducing system[8,9]. A previous study about an analyzing expression map in the laboratory suggested mRNA of the bovine FADD, highly expressed in lymphoid tissue, ovary, and testis, whereas, less expressed in other tissues. This indicated that FADD in the lymphoid tissue played an important role in keeping the bovine immune environment stable. The FAS in testicular germ cells and ovary oocytes and FasL in sertoli cells and follicular granulosa cells interacted, which could keep the spermatogenesis and oogenesis balanced, through regulating the FADD expression level. Gene mutation or abnormal expression of FADD in the reproductive system, leading to internal environment disorder and abnormal spermatogenesis and oogenesis, could cause bull’s oligzoospermous or aspermia and reduce a cow’s ovulation rate and conception rate[10,11]. When the authors constructed the eukaryotic expression vector for the pAcGFP-bFADD fusion protein, the authors took advantage of directional cloning, introduced BglĊ(AGATCT) and EcoRĉ(GAATTC), two sites in the upstream primer and downstream primer, respectively. These two restriction enzymes produced different 3c cohesive ends, which could realize that the target gene was directionally connected to the vector. The following were virtues of this method: 1) The vector fragment could not be cyclized, so there were few false positive recombinant clones, because the vector’s two cohesive ends did not complement each other. 2) Because the foreign bovine FADD gene was inserted into recombinant plasmid in one direction, it was not necessary to screen for right connection. 3) Restriction enzyme sites were preserved, which was beneficial for further identification. In 2003, Kozak analyzed the relationship between sequence of mRNA 5c end and translation efficiency in the eucaryotic expression gene and found that 5cG/N-C/N-C/NANNATGG-3c sequence could improve transcription and translation efficiency, especially A in í3 site and G in +4 site were important to improve the translation efficiency[12]. Therefore, the Kozak sequence was introduced after upstream primer’s Bgl Ċsite, to make sure that the FADD gene was highly expressed in the recombinant plasmid. In addition, FADD and pAcGFP-N1 were mixed in the proportion of 8:1(mole number) and connected under 16oC, which could not only improve efficiency but also further reduce the probability of vector cyclization itself.

G418 is one of the aminoglycoside antibiotics, which is toxic to both prokaryotic cells and eukaryotic cells. It is usually utilized to resist screening of transfection. When a neo gene was inserted into the genome of eukaryotic cells, a sequence coded by the neo gene started to transcribe into mRNA, and then amino glycoside phosphotransferase was highly expressed, a resistant production, which made cells grow up in a selective medium, including G418[13]. First, the authors should select the correct G418 screening concentration because sensitivities of different cells to G418 were different and the activities of G418 from different factories were different although they were of the same concentration. In this experiment, all the cells died in the 600 Pg/mL concentration group on the twelfth day, so the authors chose the 600 Pg/mL as the best screening concentration. During the screening, the authors first selected 600 Pg/mL of G418, when clones appeared. Then they selected 200 Pg/mL of G418 instead of 600 Pg/mL of G418. In this condition, the cells grew rapidly, when the cells spread out fully, reselected positive clones again by 600 Pg/mL of G418. Finally, the authors acquired cell clones which could stably express the bovine FADD gene. pAcGFP-bFADD was transfected into CHO-K1 cell mediated by LipofectamiTM 2000 with transfection efficiency reaching 65%. After sreenia for two weeks by 600 Pg/mL G418, positive clones could emit fluorescence light. This indicated that the bovine FADD gene was completely inserted into the CHO-K1 cell genome and the fusion protein was stably expressed. Green fluorescence protein (AcGFP-bFADD) was observed in the cell cytoplasm around the nucleus, in the shape of a loop, under a high power fluoroscope. It was close to the report that was made by foreign researchers who observed that FADD lay in the cell cytoplasm. As a signal protein, it connected the death receptor and cytoplasm, which could transfer extracellular apoptosis signal into the cytoplasm, to activate enzyme-related apoptosis and induce apoptosis[13]. But because the authors took the widely expressed CMV as AcGFP-N1’s promoter, they were not sure FADD was localized in the cytoplasm, it needed to be studied further. Molecular weight of green fluorescent protein was 28 kD, bovine FADD’s molecular weight was 23 kD, so the fusion protein’s molecular weight was about 51 kD, which was consistent with the detection result by SDS-PAGE electrophoresis and Western blotting, and, FADD’s antibody binding to the NC membrane showed a specific reaction with the fusion protein. It indicated that transfected CHO-K1 cells by pAcGFP-bFADD, greatly expressed immunocompetent FADD protein. In addition, the background color of the protein immunoblotting ECL was dark because the concentration of the horseradish peroxidase labeled second antibody was a bit high, it was rinsed insufficiently, and exposure time was longer.

Runjun Yang et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1880–1887

Decreasing concentration, raising time to rinse, increasing buffer volume, and shortening exposure time could improve the developmental effect. This research was prepared for the study on mechanism of bovine oogonium’s Proliferation and Differentiation. FADD was inserted into pAcGFP-N1’s N end and fusion protein was express driven by pAcGFP-N1 CMV Promoter, which could improve FADD’s expression level in eukaryotic cells and keep its structure and function unchanged. On the other hand, the AcGFP reporter gene, instead of EGFP was extracted from aequorea coerulescens. Compared to EGFP, ACGFP had an opening frame with enhanced codon, so it could improve both transformation efficiency of AcGFP mRNA and its expression level in mammalian cells and it could be detected only 8–12 h after transfection, and fluorescence detection could be carried out for a long time[14,15]. AcGFP as pAcGFP-bFADD’s reporter gene could improve transfection efficiency and reduce harm for cells. It was also beneficial for regulation environment simulation for oocyte gene expression in vivo and study regulation of FADD on differentiation and proliferation of oogonium at the gene level. Through bovine FADD gene binding to the AcGFP gene, the mammalian expression vector of the pAcGFP-bFADD fusion protein was constructed and highly expressed in CHO-K1 cells. It could provide technical support for basic research on regulation of FADD on bovine oogonium development and become important for further research.

between the death domains of CD95/Fas and FADD. Cell Death Differ, 2007, 14(9): 17171719. [4] Tomoki T, Manabu N. Modifications enhance the apoptosis-inducing activity of FADD. Mol Cancer Ther, 2007, 6(6): 17931803. [5] Carrington P, Sandu C, We Y, et al. The structure of FADD and its mode of interaction with procaspase-8. Mol Cell, 2006, 22(5): 599610. [6] Imtiyaz HZ, Zhang Y, Zhang J. Structural requirements for signal-induced target binding of FADD determined by functional reconstitution of FADD deficiency. J Biol Chem, 2005, 280(36): 3136031367. [7] Hengartner M. The biochemistry of apoptosis. Nature, 2000, 407(6805): 770776. [8] Margalit KA, Cowan RG, Harman RM, et al. Apoptosis of bovine ovarian surface epithelial cells by Fas antigen/ Fas ligand signaling. Reproduction, 2005, 130(5): 751758. [9] Skarzynski D, Shibaya M, Tasaki Y, et al. Fas-mediated apoptosis is suppressed by calf serum in cultured bovine luteal cells. Reprod Biol, 2007, 7(1): 315. [10] Porcelli F, Meggiolaro D, Carnevali A. Fas ligand in bull ejaculated spermatozoa:a quantitative immunocytochemical study. Acta Histochem, 2006, 108(4): 287292. [11] Marilyn Kozak. Binding of wheat germ ribosomes to bisulfite-modified reovirus messenger RNA: Evidence for a scanning mechanism. J Mol Biol, 1980, 144(3): 291304. [12] Magin LC, Kotzamanis G, Daiuto L, et al. Retrofitting BACs with G418 resistance, luciferase, and oriP and EBNA-1-new vectors for in vitro and in vivo delivery. BMC Biotechnol, 2003, 3(1): 210.

REFERENCES

[13] Sprick M, Weigand M, Rieser E, et al. FADD/MORT1 and caspase-8 are recruited to TRAIL receptors 1 and 2 and

[1] Arul MC, Karen OR, Muneesh T, et al. FADD, a novel death domain-containing protein, interacts with the death domain of fas and initiates apoptosis. Cell, 1995, 4(81): 505512. [2] Werner M, Wu C, Walsh C. Emerging roles for the death adaptor FADD in death receptor avidity and cell cycle regulation. Cell Cycle, 2006, 5(20): 23322328. [3] Ferguson B, Esposito D, Jovanovic J, et al. Biophysical and cell-based evidence for differential interactions

are essential for apoptosis mediated by TRAIL receptor 2. Immunity, 2000, 12(6): 599609. [14] BD Living Colors Fluorescent Protein. Clontechniques XX, 2005, 2: 1820. [15] Jakobs S, Subramaniam V, Schonle A, et al. EFGP and DsRed expressing cultures of Escherichia coli imaged by confocal, two-photon and fluorescence lifetime microscopy. FEBS Lett, 2000, 479: 131135.