Construction of plasmid vectors with unique PstI cloning sites in a signal sequence coding region

Gene, 12 (1980) 235-241 © Elsevier/North-Holland Biomedical Press

235

C o n s t r u c t i o n o f plasmid vectors with unique PstI cloning sites in a signal sequence coding region (Recombinant DNA; pBR322; mutagenic elimination of restriction sites; protein secretion; BAL 31 exonuclease; DNA linkers; DNA sequencing)

Karen Talmadge and Walter Gilbert Department of Biochemistry and Molecular Biology, Harvard University, Cambridge, MA 02138 (U.S.A.) (Received August 15th, 1980) (Accepted September 22nd, 1980)

SUMMARY

We have constructed a series of plasmids with unique PstI restriction sites within or near the pre-penicillinase signal sequence for protein secretion. To do this, we devised a rapid, simple method to eliminate undesirable unique restriction sites within plasmids while maintaining antibiotic resistance. We thus obtained a plasmid with a conveniently located, unique HinclI site in the penicillinase gene of plasmid pBR322 which was used to generate, with BAL 31 exonuclease, deletions extending into the region encoding the signal sequence. DNA inserted into these plasmids can be translated in all three reading frames both including signal sequence, or starting immediately beyond it.

INTRODUCTION

One of the goals of recombinant DNA technology is the production of eukaryotic proteins in bacteria. The detection and purification of these proteins is simpler if they are secreted from the bacterial cell. Secreted proteins, both eukaryotic and prokaryotic, contain an amino-terminal extension that is removed sometime during transport (see Blobel et al., 1979, for a review). The signal hypothesis (Milstein et al., 1972; Blobel and Dobberstein, 1975) states that these amino-terminal extensions (presequences or signal sequences) serve to bind the protein to the membrane and then to lead the protein through. Abbreviations: bp, base pairs; DTT, dithiothreitol, UV, ultraviolet.

The small plasmid pBR322 codes for the genes for penicillinase and tetracycline resistance (Bolivar et al., 1977). Villa-Komaroff et al. (1978) cloned a cDNA copy of rat proinsulin into the PstI restriction site of pBR322; the PstI site encodes amino acids 181-182 of pre-penicillinase, a secreted protein with a signal sequence of 23 amino acids (Ambler and Scott, 1978; Sutcliffe, 1978). When the proinsulin gene was inserted into thePstI site,Villa-Komaroff et al. (1978) were able to detect rat proinsulin antigen, fused to peniciUinase antigen, in the bacterial periplasmic space. In this paper we describe the construction of a set of cloning vehicles, derived from pBR322, designed both to take advantage of the signal sequence in prorein secretion and to study its role in this process. Our goal was to move the unique PstI restriction site

236 from the last third of the pre-penicillinase gene to within or near the DNA region encoding the prepenicillinase signal sequence.

for 24-72 h. N-methyl-N'-nitro-N-nitrosoguanidine is a mutagen (see Miller, 1972, for its handling and hazards). (e) Hasmid preparations

MATERIALSAND METHODS (a) Enzymes Restriction enzymes and DNA polymerase I (Klenow fragment) were purchased from New England BioLabs; the restriction enzymes were used in the buffers and under the conditions recommended. Polynucleotide kinase was purchased from Boehfinger-Mannheim. BAL 31 was from Horace Gray; its units of activity are deffmed in Gray et al. (1975). T4 DNA ligase was from A. Poteete; one unit will ligate HaeIII-cut phage X DNA (1/lg) to large multimers in one hour at room temperature in 20/A 25 mM Tris-HC1, pH 7.6, 10mM MgC12, 10mM DTT, 100/.tM ATP.

(b) Bacteria and DNA

Escherichia coli K-12 strain MM294 (hrs-, hrm ÷, thi-, endoI-) was obtained from Matthew Meselson. pBR322 (Bolivar et al., 1977) was obtained from Herbert Boyer. PstI linker, whose sequence is 5'GCTGCAGC-3', where CTGCAG defines the PstI cutting site, was purchased from Collaborative Research. (c) Transformations Transformations were done under standard conditions (Mandell and Higa, 1970). Transformed cells were selected as single colonies by growth on 2YT (Miller, 1972) plates supplemented with 20#g/ml tetracycline or as bulk transformants in 2YT liquid medium containing 20/ag/ml tetracycline.

(d) Plasmid mutagenesis

Cells bearing plasmids were grown in 2YT medium supplemented with 20/ag/ml tetracycline and treated with chloramphenicol to amplify the plasmid (Clewell, 1972). Plasmid from 1-25 ml of culture was prepared by a combination of the methods of Clewell (1972) and Zasloff et al. (1978) as follows. Harvested cells were resuspended in 100/11 of 100 mM Tris. HC1, pH 8, 25% sucrose, incubated 15 min on ice with 50/A of 5 mg/ml lysozyme in 20 mM EDTA, pH 8, and lysed with 850/A 0.3% Triton X-IO0, 0.2 M EDTA, 150 mM Tris • HC1, pH 8 in the presence of 100/ag/ml RNase. The supernatant from a 1 h centrifugation at 16 500 rev./min in a Sorvall SA-600 rotor was made 2 M in ammonium acetate and extracted 2 - 3 times with one-half volume phenol equilibrated with 10 mM Tris.HC1, pH 8, 1 mM EDTA. The aqueous phase was adjusted to 50 mM in sodium acetate, pH 4, extracted 2 times with onehalf volume phenol equilibrated with 50 mM sodium acetate, p H 4, ether extracted and ethanol precipitated. (f) Gel electrophoresis Polyacrylamide gel electrophoresis was done as described by Maxam and Gilbert (1980). Agarose gel electrophoresis was done as described by Helling et al. (1974).

(g) Exonuelease BAL 31 treatment The ends of HinclI-cut pKT41 were digested with the double-stranded exonuclease BAL 31 as follows: 0.2/ag DNA, 2 units of BAL 31 in 20 ttl of 20 mM Tris • HC1, pH 8, 12.5 mM MgSO4, 12.5 mM CaC12, 0.2 M NaC1, 1 mM EDTA (Legerski et al., 1978) for 5 min at 15°C. Under these conditions, about 45 bp were removed per minute.

One liter of MM294/pBR322 was grown to an

Asso of about i in 2YT at 34°C with shaking. N-

(h) Isolation of restriction fragments

methyl-N'-nitro-N-nitrosoguanidine (25 mg solid, Sigma) and 3.4 ml chloramphenicol (50 mg/ml in .95% v/v ethanol, Sigma) were added; shaking continued

Unlabeled restriction fragments were identified on polyacrylamide and agarose gels by UV shadowing

237 against Polygram CEL 300 UV PEI plates (Brinkmann Industries). Gels containing end-labeled fragments were autoradiographed as described in the figure legends. The fragments were eluted from gel slices as described for polyacrylamide gel elution (Maxam and Gilbert, 1980).

(i) Ligations 0.2/~g of the pKT21 4000 bp EcoRI-BamHI fragment was polymerized with 0.2/lg of the pKT30 380 bp EcoRI-BamHI fragment by one unit T4 DNA ligase in 5/al of ligation buffer (25 mM Tris-HC1, pH 7.6, 10 mM MgC12, 10 mM DTT, 100/aM ATP) for 2 h at room temperature. The plasmids were recircularized by dilution to 50/al with ligation buffer, addition of 2 units of polynucleotide kinase, and incubation for 5 h at room temperature. 0.2/~g HinclI-cut, BAL 31-digested pKT41 was polymerized and circularized with kinased PstI linker in a 1000fold excess of linker ends as described above. 0.2/lg of the 3600 bp pBR322 EcoRI-PstI fragment was polymerized and circularized with 0.2/ag of 150-300 bp EcoRI-PstI fragments cut from the BAL 31digested plasmids (ligated with J°stI linkers) as above.

~j) DNA end-labeling Plasmid prepared from 2.5 ml of cells was cut with AvalI and 3' end-labeled in 20/al 10 mM Tris • HC1,

pH 7.6, 5 mM MgSO4, 1 mM DTT by the addition of 0.5 units DNA polymerase I (Klenow fragment), 100pM [a-32P] dATPand 1/.aM dGTP for 4 h at 15°C. The labeled fragments were extracted once with an equal volume of phenol equilibrated with 10 mM Tris -HC1, pH 8.0, 1 mNl EDTA, pH 8.0, and once with an equal volume of ether, then diluted to 100 /al with 100 mM Tris" HC1, pH 7.6, 50 mM NaC1, 0.15% Triton X-100. The labeled fragments were cut with EcoRI, ethanol precipitated and electrophoresed on a 5% polyacrylamide gel.

(k) DNA sequencing Labeled fragments were sequenced as described by Maxam and Gilbert (1980).

RESULTS For convenience, we removed some of the restriction cuts in the tetracycline resistance gene of pBR322, in order to make the HinclI site in the peniciUinase gene unique while maintaining tetracycline resistance (see Fig. 1 for a simplified pBR322 restriction map showing the relevant restriction sites, according to Bolivar et al., 1977). To do this, we mutagenized the plasmid during amplification, cut the isolated plasmid exhaustively with the appropriate enzyme, transformed E. coli K-12 strain MM294, selected for tetracycline resistance with 20/ag/ml tetracycline in liquid culture, and reisolated the plasmids. After one or two cycles of cutting and transformation, an enzyme-resistant, supercoiled plasmid fraction could be seen by electrophoresis in 0.7% agarose; single colonies were then picked and analysed. In this way, the BamHI (pKT19), HindlII (pKT30), and HinclI-SalI (pKT21) sites were removed. We recombined the small EcoRI-BamHI fragment from pKT30 with the large EcoRI-BamHI fragment from pKT21 to make pKT41 (the BamHI site is between the EcoRI and HinclI-SalI sites) (step A in Fig. 1). Fig. 2 shows a HinclI-HindlII double digest of pBR322 (left lane) and pKT21 (right lane). Fig. 1 shows the scheme by which we moved the unique PstI restriction site to a series of locations either within or downstream from the DNA encoding the pre-penicillinase signal sequence. When pKT41 is cut at its unique HinclI site, the last codon of the penicillinase signal sequence is 177 base pairs from one HinclI end (Fig. 1B). We used the double-stranded exonuclease, BAL 31 (Gray et al., 1975), to chew back the ends of HinclI-cut pKT41 (Fig. 1B). Fig. 3 shows a 5 min (lane c) and a 15 min (lane b) BAL 31 digestion of HinclI-cut pKT41, run on 0.7% agarose with 3900 bp (lane a) and 4360 bp (lane d) markers and uncleaved plasmid (lane c). We blunt-end ligated the shortened molecules from the 5-rnin fraction to an excess of PstI linker, transformed MM294 and prepared plasmid DNA from cells selected for tetracycline resistance in liquid culture (Fig. 1C). We digested the heterogeneous plasmid population with both EcoRI and PstI, isolated DNA fragments from a 5% polyacrylamide gel in the size range of 150-300 base pairs (Fig. 1D), and then cloned these sized fragments back into pBR322, using the 3613 bp EcoRI-

238 EcoRl

EcoRI

i-SolI ~ B

pBR3,22

Hin n

EcoRl

."-~a ~

l°st Hln]]

......................

T V

c .

pKT41

, EcoRl

EcoRI

GPstCjs~--

GP~=

EcoRl

G~=

R ~ .

G

m

I

EcoRI pKTI70*287

Fig. 1. Scheme by which signal sequence plasmids were constructed. Each step is described in the text. Pst = PstI, HinlI = HinclI, HinlIl = HindlII, G Pst C = an inserted PstI linker, whose sequence is 5'-GCTGCAGC-3', where CTGCAG defines the Pstl restriction site. Certain gene regions are represented as follows: pre-penicilinase signal sequence, shaded; mature peniciUinase, black; tetracycline resistance, dotted.

PstI tetracycline gene fragment. These derivative plasmids are tetracycline-resistant and ampiciUin-sensitive since large deletions in the penicillinase gene have m o v e d the unique PstI site f r o m the last one-third o f the gene up t o the signal sequence region (Fig. 1E).

'XC

Fig. 2. HinclI and HindlII digest of pBR322 (left lane) and pKT21 (right lane). Ethanol-precipitated fragments were resuspended in 10 ~ of loading buffer (Maxam and Gilbert, 1980) and electrophoresed on a 0.7% agarose gel at 250 V for 4 h. The gel was soaked in 0.5 gg/ml ethidium bromide for 5 min and photographed by a Polaroid MP-4 camera with a Wratten gelatin later orange-red number 23A using Type 667 film and a short-wave UV transiUuminator. XC marks the dye, xylene cyanol, which electrophoreses with a mobility of about 250 bp.

Fig. 3. BAL 31 digestion of pKT41. Lane (a) EcoRl+HinclIcut pKT41 (the large, 3900 bp fragment); (b) 15 min digestion; (c) 5 min digestion; ( d) HinelI-cut pKT41; (e) uncut pKT41. Ethanol-precipitated fragments were resuspended in 10 #1 loading buffer (Helling et al., 1974) and electrophoresed at 80 V for 4 h. The gel was stained and photographed as described for Fig. 2. O marks the origin of DNA application.

239 To determine the exact location o f the recreated

cally and are part o f pBR322. One band changes size

PstI site, we isolated plasmid from a 2.5 ml culture o f

(indicated in Fig. 4 b y the arrows); its size reflects

cells grown from a randomly picked, tetracyclineresistant single colony. There is a convenient Avail site at the 3'-end of the pre-peniciUinase gene. The plasmid was cut with Avail, 3'-end-labeled, phenolextracted, cut with EcoRI and loaded onto a 5% polyacrylamide gel. Fig. 4 is an autoradiogram of two independent isolates. Most o f the bands run identi-

the deletions caused b y BAL 31 digestion. Each variable fragment was eluted and sequenced across the PstI site b y the method o f Maxam and Gilbert (1980). Fig. 5 shows the sequence o f one isolate o f pKT241; Fig. 6 shows a restriction map o f the nine plasmids isolated and the sequences of seven o f these plasmids with unique PstI restriction sites within or downstream from the DNA encoding the signal sequence.

DISCUSSION We have created a series o f plasmids derived from pBR322 with unique PstI restriction sites within or

G

l

G+A C÷T

C

C C C T T A T T C C G

1 C A A T

Fig. 4. Autoradiogam of 3t-end-labeled plasmid isolated from randomly picked, tetracycline-resistant colonies. The ethanol-precipitated, labeled fragments were loaded and electrophoresed on a 5% polyacrylamide gel as described in Fig. 2. The gel was exposed on Kodak XR-5 f'flm at room temperature for 10 min. The arrows mark the fragments to be sequenced, as explained in the text. An independent isolate of pKT241 is in the left lane, an independent isolate of pKT280 is in the right lane.

Fig. 5. Autoradiogram of Maxam-Gilbert (1980) sequencing reactions performed on a fragment isolated as described in the text. Kodak XR-5 film was pre-flashed twice at 60 cm wRh a Honeywell Stroblite 210 flash unR f'dterexl with a Wratten gelatin filter No. 96 to make a total neutral density of 5.3. The gel was then exposed on the pro-flashed film for 12h at -70°C. Because the DNA is 3'-end-labeled, the sequencing ladder is read from top to bottom for the 5' direction. The bracketed bases are the recreated PstI restriction site, 5'-CTGCAG-3'. The sequence is for one isolate of pKT 241.

240 171 190

pKTI71 pKTIgO pKT218 pKT226 pKT234 pKT241

218

1:2' ~1254

:112,, III v Ill I IIII

279

pKT279

;2eO

IIKTZeO pKT287

"i II I

II I iii

!, ~11~ .~llllll/,......

t©on!

[

4oo HInU

~0

p,t

CO0

IO0o

II

pBR322

lo 20 1 M e tS e r IleGlnHisPheArgValAlaLeuIleProPhePheAlaAlaPheCysLeuProValPheAlaHisProGluThrLeu...~e~ProAlaAlaMet.. ATGAGTATTCAACATTTCCGTGTCGCCCTTATIX2CCT ~T*-i GCGGCA L-L-I"I'GCCTIX:CTGiTI"I-I'GCTCACCCAGAAACGCTG... ATGCCTGCAGCAATG Pst

pKT218

M e t S e r I l e G l ~ Z~zAIaAIaMet... ATGAGTATTCAAC~TC47A GCAATG... Pst

pKT226

MetSerIleGlnHisPheArg/~uGZnG~n... ATGAGTATTCAACATTTCCGGCTC.CA GCAATG... Pst

pKT234

9 MetSerIleGlnHisPheArgValAlaAP~ICy8Ser'Asn... ATGAGTATTCAACATTTCCGTGTCGCCCGCTGCAGCAATG... Pst

pKT241

12 MetSerIleGlnHisPheArgVa!AlaLeuIleProf~uCZnG~n... ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCKTTGCA GCAATG... Pst

pKT279

MetSerI~eG~nHisPheArgVa~A~aLeuI~ePr~he~heA~aA~aPhecysLeuPr~Va~PheA~a~2~PgCy8Se~A8n~.. ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCC i.L-i-1-1~1~GCGGCA~.~Tl~GCCTTCC~,Tl-1-~-i G C T C A C C G C T G C A GCAATG... Pst

pKT280

25 C . MetSer~eG~nHisPheArgValA~aLeuI~e~r~hePheA~aA~aPheCysLeu~r~Va~PheA~a~isPr~LeuJ~nGZn. ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCC~1-l~*-l.x.*GCCGCAT~F~TGCCTTCCTG~i.L.1-1.~GCTCACCCGCTGCAGCAATG. Pst

pKT287

7 MetSerI•eG•nHisPheArg•a•A•aLeuI•ePr•PhePheA•aA•aPheCysLeuPr•va•PheA•a-HisPr•G•uT5rAZaAlaAlaMet... ATC~GTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGC~ATTTTGCCTTCCTG~"~-~-FTGCTCA~CCAGAAACGGCT~AGCAATG. .. Pst

7

.

..

Fig. 6. Deletion map of nine pre~penicillinasegene deletions and sequences of seven plasmids derived from pBR322 with unique PstI restriction sites within or downstream from the DNA encoding the signal sequence. Certain gene regions are represented as

follows: pre-penicillinase signal sequence, shaded; mature penicillinase, black. The arrows indicate the site of cleavage for the maturation of pre-penicillinase to penicillinase. The derivative plasmid deletions extended from the pBR322 PstI site to the signal sequence coding region. The PstI site was recreated by the insertion of a PstI linker, whose sequence is 5 '-GCTGCAGC-Y,where CTGCAG defines the PstI restriction site and is underlined. The bases in italics were added by the insertion of the PstI linker. The amino acids in italics are encoded by the inserted PstI linker. Each plasmid is numbered according to the number of bases from the middle of the EcoRI site to the last wild-type base before the inserted PstI linker. The number of independent isolates of each plasmid is as follows: pKT171, pKT190, pKT218, pKT234, pKT279=l; pKT226=2; pKT287=3; pKT280=4; pKT241=6.

near the DNA encoding the pre-penicillinase signal sequence. DNA inserted into these plasmids can be read in all three frames both within and immediately after the pre-peniciUinase signal sequence. We have used these plasmids to study protein secretion in bacteria, where we found that the hydrophobic core of a eukaryotic signal sequence directs secretion in

bacteria (Talmadge et al., 1980) and the bacterial signal peptidase correctly processes the eukaryotic signal sequence clipping site (Talmadge et al., 1980). We have also used these plasmids to map penicillinase mutations (D. Koshland, K. Talmadge and D. Botstein, manuscript in preparation).

241 ACKNOWLEDGMENTS The authors gratefully acknowledge Allan Maxam, Tom Roberts, Horace Gray and Stephanie Broome for helpful discussions; Horace Gray and A. Poteete for the generous gifts of BAL 31 and T4 DNA ligase, respectively. This work was supported by NIH Grant GM-09541-17.

REFERENCES Ambler, R.P. and Scott, G.K.: Partial amino acid sequence of penicillinase coded by Escherichia coli plasmid R6K. Proc. Natl. Acad. Sci. USA 75 (1978) 3732-3736. Blobel, G. and Dobberstein, B.: Translocation of proteins across membranes, I. Presence of processed and unprocessed nascent immunoglobulin light chains on membrane-bound ribosomes of murine myelomas. J. Cell. Biol. 67 (1975) 835-851. Blobel, G., Walter, P., Change, C.N.: Goldman, B.M., Erickson, A.H. and Lingappa, V.R., Translocation of proteins across membranes. The signal hypothesis and beyond. Syrup. Soc. Exp. Biol. 33 (1979) 9-36. Bolivar, F., Rodriguez, R., Greene, P.J., Betlach, M.C. Heyneker, H.L., Boyer, H.W., Crosa, J.H. and Falkow, S.: Construction of new cloning vehicles, II. A multiple cloning system, Gene 2 (1977) 95-113. Clewell, D.B.: Nature of ColE1 plasmid replication in the presence of chloramphenieol. J. Bacteriol. 110 (1972) 667-676. Gray, Jr., H.B., Ostrander, D.A., Hodnett, J.L., Legerski, R.J. and Robberson, D.L.: Extracellular nucleases of Pseudomonas BAL 31, I. Characterization of single-strand specific deoxyriboendonuclease and double-strand deoxyribonuclease activities. Nucl. Acids Res. 2 (1975) 14591492.

Helling, R.B., Goodman, H.M. and Boyer, H.W.: Analysis of endonuclease R-EcoRI fragments of DNA from lambdoid bacteriophages and other viruses by agarose gel electrophoresis. J. Virol. 14 (1974) 1235-1244. Legerski, R.J., Hodnett, J.L. and Gray, Jr., H.B.: Extracellular nucleases of Pseudomonas BAL 31, III. Use of the double-strand deoxyriboexonuclease activity as the basis of a convenient method for the mapping of fragments of DNA produced by cleavage with restriction enzymes. Nucl. Acids Res. 5 (1978) 1445-1464. Mandell, M. and Higa, A.: Calcium-dependent bacteriophage DNA transfection. J. Mol. Biol. 53 (1970) 159-162. Maxam, A.M. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavages, in Moldave, K. and Grossman, L. (Eds.), Methods in Enzymology, Vol. 65. Academic Press, New York, 1980, 499-560. Miller, J.H.: Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY., 1972, p. 433. Milstein, C., Brownlee, G.G., Harrison, T.M. and Matthews, M.B.: A possible precursor of immunoglobulin light chains. Nature New Biol., 239 (1972) 117-120. Sutcliffe, J.G.: Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322. Proe. Nat[ Acad. Sci. USA 75 (1978) 3737-3741. Talmadge, K., Kaufman, J. and Gilbert, W. : Bacteria mature preproinsulin to proinsulin, Proc. Natl. Acad. Sci. USA 77 (1980a) 3988-3992. Talmadge, K., Stahl, S. and Gilbert, W.: Eukaryotic signal sequence transports insulin antigen in Escherichia coli. Proc. Natl. Acad. Sci. USA 77 (1980b) 3369-3372. ViUa-Komaroff, L., Efstratiadis, A., Broome, S., Lomedico, P., Tizard, R., Naber, S.P., Chick, W.L. and Gilbert, W.: A bacterial clone synthesizing proinsulin. Proc. Natl. Acad. Sci. USA 75 (1978) 3727-3731. Zasloff, M., Ginder, G.D. and Felsenfeld, G.: A new method for the purification of covalently closed circular DNA molecules. Nucl. Acids Res. 5 (1978) 1139-1151. Communicated by C. Weissmann.