Construction of the trifunctional enzyme associating the Thermoanaerobacter ethanolicus xylosidase-arabinosidase with the Thermomyces lanuginosus xylanase for degradation of arabinoxylan

Enzyme and Microbial Technology 45 (2009) 22–27

Contents lists available at ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Construction of the trifunctional enzyme associating the Thermoanaerobacter ethanolicus xylosidase-arabinosidase with the Thermomyces lanuginosus xylanase for degradation of arabinoxylan Yemin Xue ∗ , Jingjing Peng, Ruili Wang, Xiangfei Song Nanjing Engineering and Technology Research Center for Microbiology, Jiangsu Key Lab for Biodiversity and Biotechnology, Nanjing Normal University, Nanjing 210046, PR China

a r t i c l e

i n f o

Article history: Received 18 October 2008 Received in revised form 20 February 2009 Accepted 20 March 2009 Keywords: Arabinoxylan Gene fuse Trifunctional enzyme Xylanase Xylosidase-arabinosidase

a b s t r a c t The trifunctional enzyme (XAR–XYN) associating the Thermoanaerobacter ethanolicus xylosidasearabinosidase (XAR) with the Thermomyces lanuginosus xylanase (XYN) was produced in E. coli to study the effect of the physical association of the fusion partners on the enzymatic efficiency. Recombinant XAR, XYN and XAR–XYN were purified to homogeneity and characterized. The optimal pH and temperature of the XAR–XYN were found to be similar to those of the XAR and XYN, except for less temperature optimum of ␣-arabinosidase activity. Its pH and xylanase activity exhibited more stable than those of the XAR and XYN. Finally, the XAR–XYN was tested for degradation of oat spelt xylan and wheat bran, the XAR–XYN was found to be more facile than the corresponding free enzyme degradation of wheat bran but provided little or no advantage on purified xylan. Furthermore cooperation within a trifunctional enzyme containing linker SAGSSAAGSGSG between each partner was achieved, leading to a trifunctional enzyme with enhanced enzymatic efficiency on arabinoxylan. © 2009 Elsevier Inc. All rights reserved.

1. Introduction Agricultural residues represent large renewable resources for lignocellulose bioconversion. Daily, the food industry generates significant amounts of by-products that are considered as polluting wastes to be eliminated. A great deal of research has been conducted on the utilization of these by-products in the biotechnology sector [1,2]. Among agricultural by-products, wheat brans and straw consist of predominantly arabinoxylans in the cell wall. Improved utilization of this arabinoxylan-rich residue for bioconversion to fuels or industrial chemicals is to accomplish a complete decomposition of the arabinoxylan into its monosaccharide constituents, which requires the action of several different enzymes such as endo-␤-1, 4-xylanase, ␤-d-xylosidases, ␣-l-arabinofuranosidase, and esterase [3–5]. The cooperation between these enzymes may be improved by hybrid enzyme to simplify the reactions of multi-step and multi-enzyme. It cannot only reduce the synthesis cost, but also accelerate the reaction rate and have great significance in industry [1,6,7]. The bifunctional ␤-xylosidase/␣-arabinosidase (XAR) from the thermophilic anaerobe Thermoanaerobacter ethanolicus exhibits the highest substrate affinity towards the arylxylosides with unusually high aryl-␣-arabinosidase activity [8]. We have previously

∗ Corresponding author. Tel.: +86 25 85891275; fax: +86 25 85891526. E-mail address: [email protected] (Y. Xue). 0141-0229/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.enzmictec.2009.03.010

reported on overexpression of the gene encoding the bifunctional XAR from this organism [9]. The thermophilic fungus Thermomyces lanuginosus xylanase (XYN) has a small molecular weight of about 21 kDa and catalytic activity over a broad range of pH [10,11]. Therefore, trifunctional fusions of xylosidase-arabinosidase and xylanase may produce a more efficient enzyme capable of degrading xylan backbone to its monomeric constituent. Using this strategy, we focused on the construction of a trifunctional fusion enzyme with thermostable activity. We fused two target enzymes: XAR from T. ethanolicus and XYN from T. lanuginosus to obtain trifunctional enzymes XAR–XYN. Hybrid enzyme was fully characterized considering biochemical and kinetics aspects and finally used to examine for its capacity to degrade purified xylan and wheat brans. The efficiency of reducing sugar release was compared by using free or trifunctional enzymes in order to study the effect of the physical association of the fusion partners on the enzymatic efficiency for degradation of arabinoxylan-containing feedstocks. 2. Materials and methods 2.1. Bacterial strains and plasmids and culture conditions Escherichia coli JM109 (Promega, Madison, USA) was used as host for gene cloning and expression. E. coli cells were grown at 37 ◦ C in Luria-Bertani (LB) broth containing ampicillin (100 mg ml−1 ). E. coli JM109 were used for cloning purposes. E. coli JM109 (DE3) (Promega Corp., Madison, WI, USA) was used as hosts for the expression of fusion gene. They were cultured at 37 ◦ C in Luria-Bertani (LB) medium containing ampicillin (100 mg ml−1 ). After growth at37 ◦ C to mid log phase (OD600 = 0.6–0.8),

Y. Xue et al. / Enzyme and Microbial Technology 45 (2009) 22–27 expression of fusion protein was induced by adding IPTG to 0.8 mM. After incubation at 37 ◦ C for 10 h, cells were harvested. The recombinant plasmid pHsh-xyn [10] was used as the source of coding DNA sequence of xyn gene of Thermomyces lanuginosus. 2.2. Enzymes and chemicals Xylosidase, arabinobiose, oat spelt xylan (OSX) and p-nitrophenyl (pNP) glycoside substrates were purchased from Sigma Chemical (St. Louis, MO, USA). Ex-Taq polymerase, Pyrobest DNA polymerase, T4 DNA ligase, and restriction enzymes Xhol, EcoRV, Xbal were purchased from TAKARA (Dailian, China). The plasmid pET-20b was purchased from Novagen. Molecular weight markers for native gradient gel or sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) were purchased from Promega (Madison, WI, USA). QIAGEN Plasmid Kit and QIAGEN MinElute Gel Extraction Kit were obtained form Gene Company (Qiagen, USA). Chemical reagents were purchased from Sigma (St. Louis, MO), and all solutions were made with deionized water. 2.3. DNA manipulation Routine DNA manipulations were carried out essentially as described [12]. Plasmid DNA and PCR products were purified using Qiagen plasmid kit and PCR purification kit (Qiagen, USA). PCR reactions were performed in a PE Applied Biosystems 9700 thermal cycler (Foster City, CA) using standard reaction conditions. DNA modifying enzymes and polymerases were obtained from New England Biolabs (Beverly, MA) and Promega. Oligonucleotide primers were synthesized at the Biological Services Unit of Shang Hai. DNA sequencing was performed by Biological Services Unit of Shang Hai. 2.4. Construction of fusion gene Based on the DNA sequence (GenBank: accession number AF135015) of the xylosidase/arabinosidase gene xar of T.ethanolicus JW200, two synthetic oligodeoxyribonucleotides P1 and P2 were used as primers (Table 1). PCR amplification 35 cycles with Pyrobest DNA polymerase (TaKaRa, China) was carried out in a 50 ␮l reaction containing 0.2 mM dNTPs each, 20–35 pmol each primers and 0.5 ␮g chromosomal DNA template. Each cycle consisted of heating at 95 ◦ C for 5 min, 94 ◦ C for 50 s, 50 ◦ C for 40 s and 72 ◦ C for 2 min 30 s. The PCR products were purified using the QIAquick PCR purification kit and followed by digestion with Xbaland EcoRV. A band of the correct size predicted for the digested xar gene was purified by electrophoresis, and ligated into the T7 expression vector pET-20b, resulting in the plasmid pET-20b-xar. Based on plasmid pHsh-xyn harboring the coding area for T. lanuginosus xylanase as a template, three synthetic oligodeoxyribonucleotides P3, P4, and P5 (Table 1) were used as primers to prepare the xyn gene and its s-xyn fragment containing linker SAGSSAAGSGSG. The Xhol-digested PCR product was ligated to EcoRV/Xholdigested pET-20b-xar, resulting in the plasmid pET-20b-xar-xyn and pET-20b-xar-sxyn, respectively. These expression plasmids were sequenced and characterized by restriction analysis. 2.5. Purification of fusion enzyme To unambiguously characterize the activity of the fusion protein, the recombinant protein was purified to homogeneity as follows. E. coli JM109 (DE3) containing pET-20b-xar-xyn or pET-20b-xar-s-xyn was grown in LB with ampicillin (100 mg ml−1 ) at 37 ◦ C to OD600 of 0.8 and incubated further with IPTG (0.8 mM) for 10 h, the cells were harvested by centrifugation, and washed twice with water, resuspended in 20 ml of 5 mM imidazole, 0.5 mM NaCl, and 20 mM Tris–HCl buffer (pH 7.9), and French-pressured for three times. The cell extracts were heat-treated (70 ◦ C, 20 min), and then cooled in an ice bath, and centrifuged (9600 × g, 4 ◦ C, 30 min). The resulting supernatants were loaded on to an immobilized metal affinity column (Novagen), and eluted with 1 M imidazole, 0.5 M NaCl, and 20 mM Tris–HCl buffer (pH 7.9). Purity was verified by the sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) using 10% polyacrylamide running gels with 4% polyacrylamide stacking gels. The xylanase activity was detected of by XYN–SDS–PAGE [7,13,14]. Samples of the purified fusion enzymes were run through XYN–SDS–PAGE

Table 1 Nucleotide sequences of used primer. Primer

Nucleotide sequence (5 -3 )

P1

CCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAGCCATTATATTTAGAT CCCGATATCTTTATTCTCTACCCTTACTTCC CCCGATATCATGCAGACTACCCCGA CCGCTCGAGGCCAACGTCAGCAACA CCCGATATCAGCGCGGGCAGCAGCGCGGCGGGCAGCGGCAGCGGCATGCAGACTACCCCGAAC

P2 P3 P4 P5

The overstriking nucleotides in the parentheses represented nucleotides of linker SAGSSAAGSGSG.

23

[10% polyacrylamide co-polymerized with 0.5% (w/v) xylan]. The gel was cut off after electrophoresis, one (containing the molecular weight standards, XYN and XAR–XYN) was stained with 0.025% Coomassie blue R-250, 40% methanol and 7% acetic acid for several hours and destained with 50% methanol, 10% acetic acid for several hours; Another (containing XYN and XAR–XYN) was washed four times for 30 min at 4 ◦ C in the buffer of 0.1 mM phthalate-imidole buffer (PIB, pH 5.8) with gentle shaking. The first two washes were conducted with 25% (v/v) isopropanol. The gels with the renatured protein were further incubated for 30 min in the same buffer at 37 ◦ C, soaked in 0.1% (w/v) Congo red for 15 min at room temperature and subsequently washed with 1 M NaCl until excessive dye was removed from the active bands. The resultant bands became clear zones after 0.5% (v/v) acetic acid was added to the gel. 2.6. Enzyme assay ␣ -l-arabinosidase and ␤-xylosidase activity was determined by assaying the amount of p-nitrophenyl (pNP) released from the substrates p-nitrophenyl ␣-larabinofuranoside (pNPAF) (Sigma, N3641) and p-nitrophenyl ␤-d-xylopyranoside (pNPX) (Sigma, N2132), respectively. The reaction was initiated by adding 10 ␮l 20 mM pNPX or pNPAF in 180 ␮l 50 mM PIB, which was pre-incubated at the respective temperature, followed by addition of 10 ␮l purified enzyme. After 10 min, the reaction was stopped, the color was developed by the addition of 0.6 ml of 1 M Na2 CO3 , and the A405 was read. A standard curve was prepared by using pNP. An enzyme unit was defined as the amount of enzyme producing 1 ␮mol pNP per min [15]. Xylanase activity was determined by the 4-hydroxybenzoic acid hydrazide method [16]. OSX (Sigma X0627) was used as the substrate. The reaction mixture containing 100 ␮l 0.5% (w/v) OSX in water, 90 ␮l 50 mM PIB (pH 6.0) and 10 ␮l diluted enzyme was incubated at 65 ◦ C for 10 min. Reducing sugars were assayed by adding 600 ␮l of 4-hydroxybenzoic acid hydrazide, boiling for 10 min, cooling, and measuring the absorbance at 410 nm. One unit of xylanase activity was defined as the amount of enzyme releasing 1 ␮mol reducing sugar per min. Protein concentrations were determined by using an extinction coefficient at 280 nm based upon the amino acid composition of the enzyme. All assays were performed by using blanks to correct any backgrounds in enzyme and substrate samples. For determinations of the kinetic parameters, the purified enzymes were assayed at substrate concentrations ranging from 0.02 to 0.38 mM for pNPX, and from 0.15 to 1.5 mM for pNPAF, and from 0.25 to 5.0 mg ml−1 for OSX. Kinetic parameters, Km and Vmax , were determined by the Lineweaver–Burk representation of the Michaelis–Menten model. Each experiment was done in duplicate, and measurements were made in triplicate. The standard deviation was recorded to <2% for the mean for arabinofuranosidase and xylosidase activity and <5% for xylanase activity. 2.7. Enzymatic hydrolysis of xylan and wheat brans Wheat bran (WB) was destarched and provided by ARDC (Agro-Industries Development Corporation, Nanjing, China). The substrate was subjected to heat treatment at 121 ◦ C for 30 min, and washed three times with water and air-dried. WB (200 mg) or OSX (400 mg) were incubated with the purified XAR, XYN, XAR–XYN and XAR–S–XYN in 0.1 M potassium phosphate buffer (PPB) at pH 6.0 in a thermostatically controlled incubator at 65 ◦ C, independently, in a final volume of 5 ml. The enzyme concentrations for trifunctional and free enzyme were 13 U of xylanase and 4.5 U of xylosidase activity per 200 mg of WB, and were 5.3 U of xylanase and 2.4 U of xylosidase activity per 400 mg of OSX for each assay. All enzyme activity was determined in 50 mM PPB of pH 6.0 at 65 ◦ C as described under Section 2.6. The reducing sugar content of the supernatant was determined by the DNS (3,5-dinitrosalicylic acid) method with xylose as the standard [17]. Each assay was done in duplicate, and the standard deviation was <5% from the mean of the value for WB and OSX.

3. Results 3.1. Construction of trifunctional enzyme To study the effect of the physical association of the fusion partners on these properties in enzymatic saccharification, the expression plasmids pET-20b-xar-xyn and pET-20b-xar-s-xyn encoding in-frame fusions of the structural genes of XAR and XYN without (pET-20b-xar-xyn) and with (pET-20b-xar-s-xyn) the linker SAGSSAAGSGSG, were constructed (Fig. 1) and identified by sequencing and restriction analysis for expressing trifunctional enzymes. 3.2. Characteristics of trifunctional enzyme The free and trifunctional enzymes producing catalytically active forms, XAR, XYN, and XAR–XYN were expressed in E. coli

24

Y. Xue et al. / Enzyme and Microbial Technology 45 (2009) 22–27 Table 2 Kinetic parameters of free and trifunctional enzymes. Enzyme

Substrate

Km a

Vmax b

XYN XAR

OSX pNPX pNPAF

5.7 0.36 2.7

15.7 16.8 48.0

XAR–XYN

OSX pNPX pNPAF

7.3a 0.35 3.5

102.2 16.1 41.0

The kinetic parameters were determined at their optimal pH and temperature for the XAR, the XYN and the XAR–XYN enzymes, respectively. a Km are expressed in millimolar amounts for ␤-xylosidase and ␣-arabinosidase activity and in milligrams per milliliter for xylanase activity. b Vmax are expressed in U per nmol of protein in order to facilitate comparison between free and bifunctional proteins.

Fig. 1. Construction of the expression plasmid pET-20b-xar-s-xyn encoding in-frame fusions of the structural genes of XAR and XYN with the linker SAGSSAAGSGSG. The sequence of oligonucleotides and corresponding amino acids of the linker regions between the fused structural are presented.

and purified to homogeneity. The purity of the three enzymes was established by SDS–PAGE analysis, which produced single bands (Fig. 2A, lanes 5, 6, and 7). Active band of the purified XAR–XYN and XYN was determined by XYN–SDS–PAGE (Fig. 2B, lanes 8 and 9). The optimal pH and temperature of free and trifunctional enzyme are shown in Fig. 3. The optimal pH and temperature for the XAR were observed at pH 5.8 and 90 ◦ C for xylosidase and at pH 6.2 and 75 ◦ C for arabinofranosidase, respectively. The XYN had a maximum activity at pH 5.8 and 65 ◦ C, and exhibited broader pH range and less temperature optimum than the XAR (Fig. 3a, c). The XAR–XYN displayed optimal xylanase activity at pH 5.8 and 65 ◦ C, optimal ␤-xylosidase at pH 5.8 and 90 ◦ C, and optimal ␣-arabinosidase activity at pH 6.2 and 70 ◦ C (Fig. 3b, d), which is similar to the corresponding free enzyme except for less temperature optimum of ␣-arabinosidase activity. The pH stability profiles of free and trifunctional enzyme are shown in Fig. 4. These pH stability experiments reveal that the XAR–XYN was found to lie in the range from pH 4.6 to 8.2, which is more stable than that of the free XAR (Fig. 4b, c). Correlations between heat stability and enzyme activity for the free and trifunc-

tional enzymes are shown in Fig. 5. The thermostability of XAR–XYN for arabinosidase-xylosidase activity is similar to the corresponding free XAR (Fig. 5b, c). However, the XAR–XYN for xylanase retained about 58% of its maximum activity at 65 ◦ C for 2 h, and was more stable compared with that free XYN retained about 51% of its maximum activity at 60 ◦ C for 2 h (Fig. 5a). The kinetic parameters of the free and trifunctional enzymes were investigated. The observed Km and Vm values of each enzyme for OSX, pNPX, and pNPAF are summarized in Table 2. The Km and Vm values obtained of the XAR–XYN for OSX were higher than that observed for the XYN, and those for pNPX were unchanged. In comparison, the observed Km value of the XAR–XYN for pNPAF was higher than that for the XAR, but its Vm value was lower than those obtained for the XAR. 3.3. Enzymatic release of reducing sugar from xylan and wheat brans In order to study the synergistic effect generated by the physical proximity of two enzymes into the trifunctional proteins, the influence of the XAR–XYN or XAR–S–XYN were compared to the free enzymes XAR, XYN, and their mixture (free XAR + XYN) for reducing sugar (RS) release efficiency (Fig. 6). All enzymes were purified to homogeneity and incubated with WB or OSX. Using OSX as substrate, the amount of RS was found to be 7.1 mg/ml after 12 h by using free XYN, these contents were significantly

Fig. 2. SDS–PAGE profiles (A) and detection of xylanase activity by XYN–SDS–PAGE (B). The plasmid pET-20b-xar, plasmid pET-20b-xyn, pET-20b-xar-xyn were transformed into JM109 (DE3). Addition of IPTG to 0.8 mM when cell was growth at 37 ◦ C to mid log phase (OD600 0.6), the expression of xar, xyn, xar-xyn were induced by addition of IPTG to 0.8 mM. After incubation at 37 ◦ C for 10 h, cells were harvested. The XAR, XYN, and XAR–XYN were purified by heat treatment followed by nickel affinity chromatography. Active band of the purified XAR–XYN was determined by XYN–SDS–PAGE. After electrophoresis, the lane M of the gel containing the protein standards, the XYN and XAR–XYN served as the positive control. Another half of the gel was renatured, was stained with 0.5% (w/v) congo red for 15 min, and was destained in a 0.5%NaCl solution revealing a yellow halo demonstrating xylan degradation. Lane M: molecular weight standards; Lane 1: total cell proteins of E. coli JM109 (DE3) containing pET-20b; Lane 2: total cell proteins of E. coli JM109 (DE3) containing pET-20b-xar; Lane 3: total cell proteins of E. coli JM109 (DE3) containing pET-20b-xyn; Lane 4: total cell proteins of E. coli JM109 (DE3) containing pET-20b-xar-xyn; Lane 5: purified recombinant XAR; Lane 6: purified recombinant XYN; Lane7: purified recombinant XAR–XYN. Lane 8:XYN of T. lanuginosus (21 kD); Lane 9: fused protein XAR–XYN (110 kD).

Y. Xue et al. / Enzyme and Microbial Technology 45 (2009) 22–27

25

Fig. 3. The optimal pH (a, b) and temperature (c, d) of free (a, c) or trifunctional enzyme (b, d) activity against pNPX( ), pNPAF() and oat spelt xylan () To determine optimal temperature under the conditions used, aliquots of purified recombinant proteins were incubated at various temperatures (45–95 ◦ C), and xylosidase, arabinosidases, and xylanase activities were assayed. Optimal pH was determined by using PIB (pH 4.6 to 8.2) using standard conditions. The highest residual activity was defined as 100%.

Fig. 4. pH stability profiles of free ( : XYN, : XAR) and trifunctional (: XAR–XYN) enzyme on xylanase (a) xylosidase (b) and arabinosidase (c) activity, respectively. The purified free or trifunctional enzymes were perincubated in 0.1 M PIB from pH 4.6 to 8.2 for 1 h, then aliquots were transferred in standard reaction mixture to determine the amount of remaining activity. The activity determined prior to the preincubations was taken as 100%.

increased to 8.1 mg/ml by adding free XAR. However, the amount of RS obtained for the XAR–XYN was 6.8 mg/ml, which is lower than those obtained for the free XAR + XYN and XYN (e.g: 8.1 mg/ml and 7.1 mg/ml) (Fig. 6A, 12 h). In comparison, the XAR–XYN exhibited relatively higher levels of enhanced synergy than their free states (XAR + XYN) in the degradation of WB (conjugated xylan) (Fig. 6 B). Subsequently, the insertion of the linker SAGSSAAGSGSG between XAR and XYN were used comparing to the XAR–XYN for the RS release efficiency. As shown in Fig. 6 B, the amount of RS obtained for the XAR–S–XYN containing linker SAGSSAAGSGSG were higher than those obtained for the XAR–XYN. While the linker SAGSSAAGSGSG in this work also indicated that the linker regions were stable against proteolytic attack and enhance solubility (data not show).

4. Discussion To develop new enzyme tools to decompose of the arabinoxylan from agricultural by-products (wheat bran and corn bran) into its monosaccharide constituents, thermophilic enzymes such as T. ethanolicus bifunctional xylosidase/arabinosidase and T. lanuginosus xylanase for construction of industrially useful fusion proteins were targeted. We fused T. ethanolicus XAR and T. lanuginosus XYN to obtain trifunctional XAR–XYN. The experimental results revealed that the XAR–XYN exhibited ␤-xylosidase, ␣-arabinosidase and xylanase activities when XYN was fused downstream of XAR (stop codon removed). The main physicochemical and kinetic properties of the trifunctional enzymes were determined and compared with the recombinant XAR and XYN

26

Y. Xue et al. / Enzyme and Microbial Technology 45 (2009) 22–27

Fig. 5. The thermostability of the free (- - -) or trifunctional enzyme (—) on xylanase (a), xylosidase (b) and arabinosidase (c) activity, respectively. The purified free or trifunctional enzymes in its optimal pH was perincubated for various times at 60 ◦ C (), 65 ◦ C (), 70 ◦ C ( ), 75 ◦ C (×) and 80 ◦ C () in the absence of substrate, respectively, and these enzyme activities were then assayed as previously indicated in optimal conditions after cooling at 0 ◦ C. The activity of the enzyme without preincubation was defined as 100%.

for subsequent application tests. Properties corresponding to the temperature, pH optima, thermostability, and stability to the pH were found to be similar to those for free XAR and XYN, except for less temperature optimum of ␣-arabinosidase and more stable xylanase activity. Similarly, in some study on improving enzymatic properties by construction of chimeras between mesophilic and

Fig. 6. Comparison of the reducing sugar release efficiency from OSX (A) and WB (B) by the free or trifunctional enzymes. RS release was determined by the DNS method. The standard deviation was less than 5% from the mean of the value for OSX and WB.

thermophilic ␤-glucosidase, the results showed that the chimera constructed by exchanging the C-terminal residue of a thermophilic enzyme with that of a mesophilic enzyme were less thermostable [18,19]. In addition, XAR–XYN presented a lower Vm value for pNPAF than free XAR, while Km values for OSX and pNPAF were higher than free enzyme. It can therefore proposed that spatial orientation of active sites of the fusion enzyme is perturbed between fused modules, which we report herein are similar to those reported previously [7,18,19]. The efficiency of the trifunctional XAR–XYN protein was tested for RS release using WB or OSX as substrate. The XAR–XYN displayed lower enzymatic efficiency on OSX compared with the action of the corresponding free module, this corresponds to a modification of its catalytic efficiency owing to the fusion of the partners. In comparison, trifunctional XAR–XYN exhibited relatively higher levels of enhanced synergy than their free states in the degradation of WB, and displayed higher enzymatic efficiency on WB compared with OSX (purified xylan), most likely reflecting the very high accessibility of the conjugated xylan in the natural substrate. The results demonstrate that cooperation between the XAR and XYN can be promoted by their association into a conjugated xylan of WB in accord with previous studies on bi- or trifunctional complexes [1,20,21]. The introduction of linker SAGSSAAGSGSG between XAR and XYN in the fusion enzyme appeared to relax the intramolecular strain in fusion enzyme as indicated by an increase in efficiency of the XAR–S–XYN for RS release. It can be suggested that the presence of a linker SAGSSAAGSGSG might may lead to conformational flexibility between the fused modules and therefore to reduce folding interference from each other so that the two moieties of a fusion enzyme may function as independently as possible [22]. Similarly, the peptide linker (GGGGSGGGGS) of engineered chimeric glucanase-xylanase has proved critical for biological activity [14]. This study demonstrates for the first time the positive effect of conformational flexibility of linker SAGSSAAGSGSG between the fused modules. In conclusion, our application tests have demonstrated that, for WB as the substrate, trifunctional enzymes XAR–XYN and XAR–S–XYN were more efficient for the RS release compared to the corresponding free enzymes. The general enhanced synergy was suggested to be due to the physical proximity of each enzymatic partner in the trifunctional enzymes or confering conformational flexibility by inserting of the linker SAGSSAAGSGSG between the fused modules. Future works will be performed to describe and explain the observed synergy, including (1) the elucidation of the exact action of peptide linkers between the fused modules, i.e., the length and amino-acid composition of linkers, and (2) fusion of the trifunctional enzyme to the carbohydrate-binding module in order to obtain the best synergistic effect.

Y. Xue et al. / Enzyme and Microbial Technology 45 (2009) 22–27

Acknowledgements We thank Weilan Shao Prof. for providing recombinant plasmid pHsh-xyn, and Zhanglin Lin Prof. (Department of Chemical Engineering, Tsinghua University, China) for providing the nucleotide sequences of linker peptide. This work was supported by grants from NSF of Jiangsu Province of China (BK2006220), and grants from the Nanjing Normal University (2006104XYY0163). References [1] Levasseur A, Navarro D, Punt PJ, Belaı¨ch JP, Asther M, Record E. Construction of engineered bifunctional enzymes and their overproduction in Aspergillus niger for improved enzymatic tools to degrade agricultural by-products. Appl Environ Microbiol 2005;71:8132–40. [2] Beaugrand J, Chambat G, Wong V, Goubet F, Remond-Zilliox C, Paes G, et al. Impact and efficiency of GH10 and GH11 thermostable endoxylanases on wheat bran and alkali-extractable arabinoxylans. Carbohydr Res 2004;339:2529–40. [3] Sørensen HR, Pedersen S, Jørgensen CT, Meyer AS. Enzymatic hydrolysis of wheat arabinoxylan by a recombinant “Minimal” enzyme cocktail containing ␤-xylosidase and novel endo-1,4-␤-xylanase and ␣-l-arabinofuranosidase. Activities Biotechnol Prog 2007;23:100–7. [4] Søensen HR, Meyer AS, Pedersen S. Enzymatic hydrolysis of watersoluble wheat arabinoxylan: synergy between ␣-l-arabinofuranosidases, endo-1,4-beta-xylanases, and beta-xylosidase activities. Biotechnol Bioeng 2003;81:726–31. [5] Søensen HR, Pedersen S, Meyer AS. Synergistic enzyme mechanisms and effects of sequential enzyme additions on degradation of water insoluble wheat arabinoxylan. Enzyme Microb Technol 2007;40:908–18. [6] Sheng Y, Li S, Gou X, Kong X, Wang X, Sun Y, et al. The hybrid enzymes from ␣-aspartyl dipeptidase and l-aspartase. Biochem Biophys Res Commun 2005;331:107–12. [7] Lu P, Feng MG, LiWF, Hu CX. Construction and characterization of a bifunctional fusion enzyme of Bacillus-sourced ␤-glucanase and xylanase expressed in Escherichia coli. FEMS Microbiol Lett 2006;261:224–30. [8] Shao W, Wiegel J. Purification and chxarcterization of a thermostable ␤xylosidase from Thermoanaerobacter ethanolicus. J Bacteriol 1992;174:5848–53.

27

[9] Xue YM, Lu C, Mao ZG, Shao WL. Cloning and expression of arabinofuranosidase/xylosidase gene of Thermoanaerobacter ethanolicus in Escherichia coli and stability of expression products. J China Agri Univ 2003;8(5):9–13. [10] Sriprang R, Asano K, Gobsuk J, Tanapongpipat S, Champreda V, Eurwilaichit L. Improvement of thermostability of fungal xylanase by using site-directed mutagenesis. J Biotechnol 2006;126:454–62. [11] Erkang Y, Yilin L, Jianjun P, Weilan S, Qiyin Y. High-level expression of the xylanase from Thermomyces lanuginosus in Escherichia coli. World J Microbiol Biotechnol 2008;24:275–80. [12] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NewYork: Cold Spring Harbor Laboratory Press; 1989. [13] Jin MA, Young KK, Woo JL, Su YH, Chang LA, Eun CS, et al. Evaluation of a novel bifunctional xylanase–cellulose constructed by gene fusion. Enzyme Microb Technol 2005;36:989–95. [14] Ping Lu, Ming-Guang Feng. Bifunctional enhancement of a ␤-glucanasexylanase fusion enzyme by optimization of peptide linkers. Appl Microbiol Biotechnol 2008;79:579–87. [15] Poutanen K, Puls J. Characteristics of Trichoderma reesei ␤- xylosidase and its use in the hydrolysis of solubilized xylans. Appl Microbiol Biotechnol 1988;28:425–32. [16] Lever M. A new reaction for colorimetric determination of carbohydrates. Anal Biochem 1972;47:273–9. [17] Miller GL. Use of dinitrosalicyclic acid reagent for determination of reducing surgars. Anal Chem 1959;31:426–8. [18] Kshamata G, Bong JK, Jong-Deog K, Yeon-Kye K, Motomitsu K, Kiyoshi H. Enhancement of transglycosylation activity by construction of chimeras between mesophilic and thermophilic ␤-glucosidase. Arch Biochem Biophy 2002;407:125–34. [19] Singh A, Kiyoshi H. Construction of Chimeric ␤-Glucosidases with Improved Enzymatic Properties. J Biological Chem 1995;270(37):21928–33. [20] Fierobe HP, Bayer EA, Tardif C, Czjzek M, Mechaly A, Belaich A, et al. Degradation of cellulose substrates by cellulosome chimeras Substrate targeting versus proximity of enzyme components. J Biol Chem 2002;277: 49621–30. [21] Hammel M, Fierobe HP, Czjzek M, Finet S, Receveur-Brechot V. Structural insights into the mechanism of formation of cellulosomes probed by small angle X-ray scattering. J Biol Chem 2004;279:55985–94. [22] Mojgan Kavoosi, Louise Creagh A, Kilburn DG, Haynes CA. Strategy for selecting and characterizing linker peptides for CBM9-tagged fusion proteins expressed in Escherichia coli. Biotechnol Bioeng 2007;98(3):559–610.