Constructs of biotin mimetic peptide with CC49 single-chain Fv designed for tumor pretargeting

Peptides 24 (2003) 353–362

Constructs of biotin mimetic peptide with CC49 single-chain Fv designed for tumor pretargeting Gabriela Pavlinkova a,∗ , Surinder K. Batra b , David Colcher c , Barbara J.M. Booth d , Janina Baranowska-Kortylewicz a a

J. Bruce Henriksen Cancer Research Laboratories, Department of Radiation Oncology, 981050 Nebraska Medical Center, University of Nebraska Medical Center, Omaha, NE 68198-1050, USA b Department of Biochemistry and Molecular Biology, 981050 Nebraska Medical Center, University of Nebraska Medical Center, Omaha, NE 68198-1050, USA c City of Hope, Duarte, CA, USA d Department of Pathology and Microbiology, 981050 Nebraska Medical Center, University of Nebraska Medical Center, Omaha, NE 68198-1050, USA Received 10 December 2002; accepted 8 January 2003

Abstract Single-chain Fv constructs comprising a biotin mimetic peptide (BMP) and scFv of CC49 monoclonal antibody were produced to improve pretargeted radioimmunotherapy. BMP units that bind streptavidin were added to the carboxyl terminus of the CC49 VH region. An engineered scFvBMP monomer and a sc(Fv)2 BMP dimer showed an excellent antigen recognition in vitro with a specific binding of 72 ± 5 and 81 ± 4%, respectively. Properties of 125 I-sc(Fv)2 BMP in mice bearing LS-174T xenografts were comparable to these of the parent 125 I-sc(Fv)2 . Complexing of scFvBMPs with streptavidin increased tumor targeting and gave exceptionally high tumor-to-blood values of 63±7 for 125 I-sc(Fv)2 BMP–streptavidin compared with 37±4 for sc(Fv)2 BMP at 72 h after administration. High tumor and negligible normal tissue levels of these novel pretargeting constructs indicate a great potential for pretargeted radioimmunotherapy. © 2003 Elsevier Science Inc. All rights reserved. Keywords: Biotin mimetic peptide; Streptavidin; Pretargeting radiotherapy; Single-chain antibody fragments

1. Introduction To overcome some of the problems hindering clinical applications of radiolabeled MAbs such as their long biological half-life, low tumor-to-background ratio, and high uptake by normal tissues, numerous multi-step tumor pretargeting strategies have been developed [14,49]. The tenet of these strategies lies in the fact that a separate administration of the targeting moiety, e.g. avidin-, streptavidin- or biotin-modified antibodies, followed by a clearing agent, and eventually radiolabeled ligand(s) leads to a higher and more selective tumor uptake with negligible non-target tissue backgrounds. Unlike directly radiolabeled antibodies, the pretargeting approach allows non-radioactive antibodies that carry specific ligand-binding moieties to firstly localize in tumor and clear from the systemic circulation. The ∗

Corresponding author. Tel.: +1-402-559-8906; fax: +1-402-559-9127. E-mail address: [email protected] (G. Pavlinkova).

radiolabeled diagnostic or therapeutic agents are administered a few hours or days later to be captured by a carrier antibody that is already accumulated at the tumor site. The administration sequence is dictated by the pharmacokinetics of the carrier antibody and the inclusion of clearing agents [17,49]. Several ligand–receptor complexes have been evaluated in various pretargeting schemes (for review see [13]). Of these, biotin–streptavidin (StAv) and biotin–avidin (Av) systems are the most attractive [3,14,15]. Their appeal is in the extraordinarily high affinity of biotin to StAv/Av and the potential of a four-fold amplification of the radioactivity at the tumor site. To date, nearly all pretargeting strategies evaluated in a mouse tumor model appear to have a considerable advantage over the direct use of radiolabeled MAbs [2,10,34,51]. These gains were also confirmed in Phase I/II clinical diagnostic and therapeutic trials [6,9,11,15,19]. By implementing a pretargeting scheme, the administration and delivery of high doses of radioactivity to tumors

0196-9781/03/$ – see front matter © 2003 Elsevier Science Inc. All rights reserved. doi:10.1016/S0196-9781(03)00049-4

354

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

was possible resulting in significantly increased therapeutic indices as compared with conventional radioimmunotherapy approaches. For example, in a clinical trial in patients with adenocarcinomas reactive to NR-LU-10 murine monoclonal antibody, the ratio of radiation doses absorbed by tumor to the bone marrow was over 60 for pretargeted radioimmunotherapy, compared with a ratio of six-to-one reported for conventional radioimmunotherapy [6,9,31]. Similar results were reported for a three-step pretargeting radioimmunoscintigraphy scheme wherein tumors were first targeted by biotinylated antibodies followed by StAv, and finally a dose of 111 In-radiolabeled biotin. In these studies, tumor-to-normal tissue ratios were approximately two-fold higher than in a conventional radioimmunoscintigraphy, even though the percent-injected dose in the tumor was similar for both methods [26]. While more effective than directly radiolabeled MAbs, the pretargeting approach has some fundamental disadvantages related to the prerequisite chemical modification of MAbs to prepare pretargeting conjugates. Chemical modifications of MAbs often damage the MAbs specificity and antigen recognition, and reduce immunoreactivity. Owing to the advances in genetic engineering, preparation of single-chain antibody fragments comprising Ig variable regions of heavy and light chains covalently connected by a flexible peptide linker is now a commonplace [5]. scFvs have several characteristics favored in radioimmunotherapy, i.e. a rapid blood clearance, excellent diffusion into the tumor from the vascular spaces, and higher tumor-to-normal tissue ratios than the corresponding IgGs [1,4,12,28,30,48]. One notable example is a series of genetically engineered scFv based on a murine MAb CC49 [4,12,33]. This MAb recognizes tumor-associated glycoprotein (TAG-72) present in a majority of human adenocarcinomas [25] and absent in most normal tissues [43]. Radiolabeled CC49 IgG has excellent tumor localization properties and was evaluated in several clinical trials [23,29,36,41,42]. However, in nearly all cases radiation doses deposited in tumors were well below the therapeutic threshold and as such the radiotherapeutic potential CC49 IgG is limited [41,42]. In this study, scFv CC49 fragments containing streptavidin-binding peptide were designed and evaluated for the pretargeting strategy to improve the in vivo performance of MAb CC49. Properties of monomeric and dimeric CC49 scFvs genetically modified with biotin mimetic peptide (BMP) were assessed in biodistribution and pharmacokinetics studies.

2. Experimental 2.1. Proteins Streptavidin (MW 13.3 kDa), genetically engineered by random mutagenesis (StrepTactin; [45]; Sigma-Genosys Inc., The Woodlands, TX) was used for affinity purification, HPLC analysis, and animal studies. Bovine submaxillary mucin (BSM; Sigma, St. Louis, MO), that contains the epitope recognized by MAb CC49, was used as a surrogate for TAG-72 antigen for immunoassays [33]. 2.2. Construction of CC49 scFvs with biotin mimetic peptide CC49 scFvs were constructed as described before [4,33]. Briefly, CC49 VH and CC49 VL regions were PCR amplified from V regions of the murine MAb CC49 [35]. The final CC49 scFv cDNA (VL -Linker-VH ) was constructed by combining a NcoI–HindIII DNA fragment of VL gene and the VH region sequence (XhoI and NheI fragment) via the modified 205C linker sequence [32] LSADDAKKDAAKKDDAKKDDAKKDL, and used for scFv construction [33]. The CC49 dimeric scFv [sc(Fv)2 ] gene (VL -Linker-VH -Linker-VL -Linker-VH ) was constructed as previously described [4]. The scFv constructs were used as the template DNA for further modifications. The coding sequence of CC49 scFvs was modified in a PCR amplification for the expression of the scFvs (monovalent and divalent) in Pichia pastoris. BMP with amino acid sequence SAWRHPQFGG [37,39] was added to the carboxyl terminus of the CC49 VH region by adding nucleotide sequence shown in Fig. 1. The scFv DNA was amplified using oligonucleotide P1 (forward) with EcoRI site: CATCGGAATTCGACATTGTGATGTCACAG and P2 (reverse) with NotI site and BMP sequence (bold letters indicate BMP-encoding sequence): GCGGCCGCTTATTAACCACCGAACTGCGGGTGACGCCAAGCGGATGAGGAGACGGTGA, and cloned into vector pSE380 (Stratagene, La Jolla, CA). For amplification of the covalent dimeric scFv, the standard PCR conditions were modified by doubling the concentration of MgCl2 . PCR amplification was performed with P1 and P2 primers to introduce the BMP sequence to sc(Fv)2 . The DNA sequence of the resultant constructs was verified by DNA sequencing. The constructs were cloned into the P. pastoris expression vector, pPICZ␣A (Invitrogen, Carlsbad, CA).

Fig. 1. Nucleotide and amino acid sequences of the biotin mimetic peptide. The peptide was added to the carboxyl terminus of CC49 VH by adding nucleotide sequences in the PCR amplification of CC49 scFv DNA sequences.

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

Homologous recombination at the 5 -end of the AOX1 gene was achieved by transforming the KM71 strain (his4 arg4 aox1∆::ARG4) of P. pastoris with SacI-linearized constructs using the Pichia EasyCompTM kit (Invitrogen, Carlsbad, CA) and selected on YPDS plates with 100 ␮g/ml zeocin. Colonies were screened for protein expression levels by ELISA. 2.3. Protein expression and purification of CC49 scFvs Yeast cultures were grown at 30 ◦ C in buffered glycerol complex medium containing 100 ␮g/ml zeocin and the protein expression was induced by 0.5% methanol. A time-course analysis indicated that the protein expression peaked at 72 h [12]. The culture was centrifuged and the supernatant containing the scFv was dialyzed against 100 mM Tris (pH 8), 1 mM EDTA. Purification of scFvs was performed using affinity chromatography with StrepTactin Sepharose (IBA, Göttingen, Germany). Bound scFvs were eluted with 2.5 mM desthiobiotin (Sigma, St. Louis, MO). The eluted fractions were concentrated using centricon-30 filter units (Millipore, Bedford, MA) and applied to a size exclusion 1.6 cm × 70 cm Superdex 75 column (Pharmacia Biotech., Piscataway, NJ) for the final purification. The identity of the protein was confirmed by sodium dodecyl sulfate–polyacrylamide gel (SDS–PAGE) and by solid phase ELISA. Protein concentration of purified scFv fragments was also determined [24]. 2.4. Labeling of CC49 scFvs and streptavidin The scFv dimers, monomers and StAv were labeled with Na125 I or Na131 I using Iodogen (Pierce Chemical, Rockford, IL; [8]). The iodination protocol yielded products with specific activities of approximately 3–6 mCi/mg. 2.5. SDS–polyacrylamide gel electrophoresis The purity and integrity of CC49 scFvs was analyzed by SDS–PAGE (15%) under reducing and non-reducing conditions [22]. Molecular weights of CC49 scFvs were determined by comparison with the relative mobility values (Rf ) of known molecular weight standards (Kaleidoscope Prestained Standards; BioRad, Hercules, CA). For Western blot analysis, proteins were also separated on 15% SDS–PAGE and transferred by electrophoretic elution to Immobilon-NC membrane (Millipore, Bedford, MA). After overnight blocking in 5% BSA in PBS, the membrane was incubated with StAv-alkaline phosphatase (AP) in a dilution of 1:1000 at room temperature (RT) for 2 h. After washing with 0.1 M Tris-buffered saline (pH 7.6), the membrane was developed with AP substrate 5-bromo-4-chloro-3-indolyl-phosphate nitroblue tetrazolium (BCIP/NBT; BioRad, Hercules, CA).

355

2.6. Solid phase immunoassays ELISA was used to detect the scFv forms at various steps in the purification process. Ninety-six-well plates were coated with 50 ng BSM per well (Sigma, St. Louis, MO) as described previously [33]. Test samples were added to prepared plates in three-fold serial dilutions and incubated for 2 h at RT. After washing with PBS, plates were incubated with AP-conjugated streptavidin at 1:1000 dilution (Jackson ImmunoResearch Lab., West Grove, PA) for 1.5 h, washed with PBS, and developed with p-nitrophenyl phosphate substrate. The optical density was measured using a Dynatech MR 5000 automatic 96-well microtiter reader. Competitive ELISA was set up as described above but all tested scFvs were mixed with three-fold serial dilutions of CC49 IgG as a competitor. Percent of binding inhibition was calculated from optical density measurements for each tested scFv. The immunoreactivity of radiolabeled CC49 scFv forms was assessed using an antibody capture assay with BSM as a surrogate for TAG-72 antigen and BSA as a negative control [33]. BSM (specific binding) or BSA (non-specific control) was attached to a solid phase matrix (Reacti-Gel HW-65F; Pierce, Rockford, IL; [33]). Following 1 h incubation at RT, the unbound radiolabeled scFvs were removed by washing with 1% BSA in PBS and the pellet-associated radioactivity was counted for 1 min in a gamma scintillation counter. 2.7. High performance liquid chromatography (HPLC) analysis Samples were injected onto TSK G2000SW and TSK G3000SW (Toso Haas, Japan) size exclusion columns connected in series and eluted with 0.067 M phosphate and 0.1 M KCl buffer (pH 6.8) at a flow rate of 0.5 ml/min. The elution of proteins was monitored by UV absorption at 280 nm and/or by determining the radioactivity in the eluted fractions. 2.8. Preparation of complexes of CC49 scFvs with streptavidin Streptavidin was added to scFvBMP or sc(Fv)2 BMP at a molar ratio of 10:1 and incubated for 1 h at RT before an application. The formation of complexes was verified using size-exclusion HPLC as described above. 2.9. Biodistribution studies Female athymic mice (nu/nu) obtained from Charles River (Wilmington, MA) at 4–6 weeks of age, were injected subcutaneously on the back with 4 × 106 human colon carcinoma cells (LS-174T). Radiolabeled proteins were injected i.v. via the tail vein. Biodistribution studies of 125 I-sc(Fv)2 BMP (10 ␮Ci per mouse) and 125 I-sc(Fv)2 BMP premixed with streptavidin (10 ␮Ci per mouse) were performed. At designated times, mice (n = 6) were euthanized, selected

356

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

tissues were dissected, weighed, and their radioactive content determined in a gamma scintillation counter. To analyze and compare pharmacokinetics of sc(Fv)2 BMP with the streptavidin–sc(Fv)2 BMP complex, a two-way ANOVA was used. The P-values determined by two-way ANOVA are presented in Sections 3 and 4. Where significant differences were detected the data for each time point were further compared using the t-test (P < 0.05 significance level). The GraphPad Prism software (GraphPad Software Inc., San Diego, CA) was used for these analyses.

3. Results 3.1. Characterization of modified CC49 scFvs Biotin mimetic peptide-containing CC49 scFv constructs (Fig. 1) were expressed in P. pastoris KM71 cells as soluble proteins and isolated from growth media using the affinity chromatography with streptavidin. Fractions were eluted with 2.5 mM desthiobiotin and further purified on a gel filtration column to give a homogenous, >99% pure monomer scFvBMP (Fig. 2, gel A), and covalent dimer sc(Fv)2 BMP (Fig. 2, gel B) as indicated by SDS–PAGE. The amino acid composition, molecular weight and binding properties of both ends, i.e. the antigen binding and streptavidin binding were also assessed. The streptavidin binding function of scFv constructs was analyzed by the Western blot (Fig. 2, gel C) and ELISA (Fig. 3) using streptavidin-conjugated alkaline phosphatase (Fig. 3). The antigen recognition was tested using ELISA. scFvBMPs effectively competed for the binding with CC49 IgG in the competition ELISA (Fig. 3). Ninety percent of monomer binding to the antigen

Fig. 3. Competition ELISA with CC49 IgG. Three-fold serial dilutions of CC49 IgG were added to the plates coated with 50 ng per well of BSM to compete with CC49 scFvBMPs. After incubation overnight, the plates were washed and streptavidin conjugate with AP was added for detection of bound scFvBMPs.

was inhibited with 530 ng of CC49 IgG, whereas only 70% of the dimer binding was inhibited with the same amount of CC49 IgG. Purified scFvBMPs were radiolabeled with Na125 I to evaluate the effect of labeling on the immunoreactivity and the stability of these new molecules. Radioiodinated products were analyzed by the size-exclusion HPLC (Fig. 4). Both 125 I-scFvBMP (Fig. 4A) and 125 I-sc(Fv) BMP (Fig. 4B) 2 eluted as single peaks with retention times of 36 and 29 min, respectively, comparable to these observed for non-radiolabeled constructs (data not shown). The absence of any

Fig. 2. SDS–PAGE analysis of purified CC49 scFvBMP fragments. Coumassie blue-stained 15% SDS–PAGE of scFvBMP (A) and sc(Fv)2 BMP (B) under reducing conditions. Western blot analysis (C) of scFvBMP, Lane 1, and sc(Fv)2 BMP, Lane 2. The scFv proteins were separated under non-reducing conditions on 10% SDS–PAGE, transferred onto nitrocellulose membrane and incubated with streptavidin conjugate with AP followed by substrate for AP. Positions of the molecular weight marker proteins are indicated.

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

357

tavidin was also evidenced for sc(Fv)2 BMP in a similar HPLC analysis (Fig. 4B). The immunoreactivity of 125 I-scFvBMPs was determined in a solid phase radioimmunoassay using BSM covalently attached to Reacti-Gel beads. The monomeric scFvBMP showed 72 ± 5% specific binding to BSM with only 1.2–3% non-specific binding to BSA. This specific binding is virtually identical to values found for CC49 scFv [33]. A covalent dimer, i.e. sc(Fv)2 BMP had a somewhat higher specific binding to BSM of 81±4%, which was also similar to values (80–90%) previously reported for CC49 sc(Fv)2 , as well as for the intact IgG form of this antibody and for an antibody fragment with divalent binding, i.e. F(ab )2 [12,33]. 3.2. Biodistribution, pharmacokinetics, and tumor targeting studies

Fig. 4. HPLC size-exclusion profiles of the radiolabeled CC49 scFvBMP (A) and sc(Fv)2 BMP (B). After radiolabeling 125 I-scFvs were analyzed using TSK G3000SW and TSK G2000SW size exclusion columns connected in series. The CC49 scFvBMP (䊏) and sc(Fv)2 BMP (䉬) were eluted as single peaks of approximately 30 and 60 kDa. The formation of complexes after binding of streptavidin to scFvBMPs is indicated by a peak shift to a higher molecular weight.

detectable aggregates or breakdown products indicates that iodination does not alter the structure of scFv constructs. The streptavidin-binding of 125 I-scFvBMP and 125 I-sc(Fv)2 BMP was also corroborated by the size exclusion HPLC (Fig. 4). The formation of 125 I-scFvBMP–streptavidin complex was demonstrated by the delayed elution at 33 min corresponding to the retention time expected for a protein with a molecular weight of 90 kDa and suggesting a one-to-one molar binding ratio, i.e. one molecule of streptavidin per each 125 I-scFvBMP construct (Fig. 4A). A analogous shift in molecular weight from 60 to 120 kDa after binding to strep-

Biodistribution of 125 I-sc(Fv)2 BMP was evaluated at 4, 24, and 72 h after administration in mice bearing xenografts of human colorectal adenocarcinoma LS-174T. At designated times after injection, blood, tumor and normal organs were harvested and their radioactive content was determined (Table 1). The tumor localization of 8.44%ID/g at 4 h post-injection, as well as the blood clearance rate, k = 0.207 ± 0.021 h−1 , and normal tissue biodistribution of 125 I-sc(Fv)2 BMP are similar to the values reported for dimeric CC49 125 I-sc(Fv)2 (data not shown; [12]). Co-localization of streptavidin complexed with 125 Isc(Fv)2 BMP was also verified in vivo. The tissue and tumor distribution of 125 I-sc(Fv)2 BMP bound to streptavidin was compared with the distribution of 125 I-sc(Fv)2 BMP in the same tumor model. Statistically significant differences in blood clearance rates of the complex as compared with 125 I-sc(Fv)2 BMP alone were detected. The 125 I-sc(Fv) BMP–streptavidin complex cleared slower from 2 the circulation than 125 I-sc(Fv)2 BMP, with the clearance rate of 0.175 ± 0.0095 h−1 for the complex compared with 0.207 ± 0.021 h−1 for 125 I-sc(Fv)2 BMP (0.001 < P < 0.01 at 0.05 level of significance by t-test). Significant differences in the tumor uptake were noted as well (P < 0.01). Appreciably higher levels of tumor uptake at all time points were observed for the complex of streptavidin with 125 I-sc(Fv)2 BMP than for 125 I-sc(Fv)2 BMP alone. Percent-injected dose per gram tumor (%ID/g) values were 2.53 ± 0.25 and 1.47 ± 0.09 at 72 h, respectively (t-test P < 0.008). The tumor residence time (TR ) of the 125 I-sc(Fv) BMP–streptavidin complex was statistically 2 different when compared with TR of 125 I-sc(Fv)2 BMP (TR = 31.8 and 26.4 h, respectively; t-test P < 0.05; Fig. 5). The uptake of 125 I-sc(Fv)2 BMP–streptavidin was elevated in well-vascularized normal tissues, particularly liver and spleen, in comparison to 125 I-sc(Fv)2 BMP alone (P = 0.004 for liver; P = 0.06 for spleen). At 24 h, the retention of the 125 I-sc(Fv) BMP–streptavidin complex was approximately 2 6- and 10-fold higher than 125 I-sc(Fv)2 BMP in liver and

358 Table 1 Distribution of

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

125 I-CC49

sc(Fv)2 BMP and

125 I-sc(Fv)

Blood∗∗ Liver∗∗ Spleen Kidneys Heart Lungs

8.44 5.68 5.65 6.89 2.83 1.42 2.97

sc(Fv)2 BMP bound to streptavidin in athymic mice bearing LS-174T xenografts 125 I-sc(Fv)

2 BMP

4h Tumor∗∗

125 I-CC49

24 h ± ± ± ± ± ± ±

0.68∗ 0.23 1.06 1.25 0.18 0.11 0.24

5.81 0.09 0.42 0.35 0.15 0.04 0.09

72 h ± ± ± ± ± ± ±

0.67 0.01 0.06 0.04 0.02 0.00 0.01

1.47 0.04 0.14 0.15 0.10 0.02 0.06

2 BMP

4h ± ± ± ± ± ± ±

0.09 0.01 0.03 0.03 0.01 0.00 0.02

10.58 6.98 7.19 8.32 2.82 1.61 3.39

+ streptavidin 24 h

± ± ± ± ± ± ±

1.47 0.56 0.95 1.07 0.2 0.08 0.04

8.48 0.21 2.66 3.66 0.21 0.07 0.18

72 h ± ± ± ± ± ± ±

1.2 0.02 0.86 1.29 0.02 0.01 0.02

2.53 0.04 0.10 0.10 0.08 0.02 0.06

± ± ± ± ± ± ±

0.25 0.01 0.01 0.01 0.01 0.00 0.01

∗ Values

shown are average percentage injected dose/g ± S.D.; 125 I-CC49 sc(Fv)2 BMP and 125 I-CC49 sc(Fv)2 BMP bound to streptavidin were injected i.v. via a tail vein into athymic mice bearing LS-174T xenografts. Mice were sacrificed at the indicated times and %ID/g for each organ was determined. n = 6 for each time point. ∗∗ The significant differences were detected using two-way ANOVA in the tumor (P = 0.019), blood (P = 0.026), and liver (P = 0.0035).

spleen, respectively. Levels of radioactivity in other normal organs reflected the concentration of radioactivity in blood (Table 1). When comparing tumor-targeting radiotherapeutics, an important parameter is the radiolocalization index (RI: ratio of the %ID/g in tumor to the %ID/g in normal tissue). The RI values for the complex of 125 I-sc(Fv)2 BMP with streptavidin were markedly higher than for 125 I-sc(Fv)2 BMP (Fig. 6). The tumor-to-blood, tumor-to-liver, and tumor-to-spleen RIs were 63, 25, and 25 for the 125 I-sc(Fv)2 BMP–streptavidin complex and 37, 11, and 10 for 125 I-sc(Fv)2 BMP at 72 h after administration (Fig. 6). The tissue-to-blood ratios were also calculated (Fig. 7) to further examine differences in the tissue disposition of the 125 I-sc(Fv)2 BMP–streptavidin complex as compared with 125 I-sc(Fv)2 BMP. In all cases tissue- and

Fig. 5. Comparison of tumor uptake of 125 I-sc(Fv) BMP with streptavidin. 2

125 I-sc(Fv)

2 BMP

and complex of

tumor-to-blood ratios increased over time. The maximum of tumor-to-blood ratio of 65 for 125 I-sc(Fv)2 BMP was reached 24 h after administration. At 72 h, the specific accumulation of radioactivity in tumors remained at a plateau whereas the radioactive concentration in normal tissues was significantly decreased. Only the spleen and liver showed higher accumulation of the 125 I-sc(Fv)2 BMP–streptavidin complex at 24 h with liver-to-blood and spleen-to-blood ratios of 13 and 17, respectively, compared with 5 and 4 for 125 Isc(Fv)2 BMP.

Fig. 6. Comparative biodistribution studies of 125 I-sc(Fv)2 BMP and complex of 125 I-sc(Fv)2 BMP with streptavidin (RI: %ID/g of tumor divided by %ID/g of normal tissue) at 72 h after administration. CC49 125 I-sc(Fv) BMP and complex of 125 I-sc(Fv) BMP with streptavidin were 2 2 injected into athymic mice (n = 6) bearing LS-174T xenografts. The mice were sacrificed at indicated times and RI for each organ was determined.

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

Fig. 7. Tissue-to-blood ratios for CC49 xenografts.

125 I-sc(Fv)

2 BMP

and

125 I-sc(Fv)

4. Discussion Most pretargeting strategies use biotin or streptavidin conjugates with the intact IgG-sized antibodies. The blood and whole body clearance of such conjugates is slow resulting in the increased radiation exposure of normal tissues. This restricts the dose of radiolabeled anti-tumor antibody that can be safely administered. Furthermore, the unfavorable pharmacokinetics of IgG necessitates prolonged waiting periods before the administration of the radiolabeled targeting agent. To remedy this latter problem, various clearing agents have been developed and introduced as an additional step in the pretargeting scheme, and to all intents and purposes, proved to be effective [20,21,27,50]. However, clearing agents introduce an additional impediment in an already complicated scheme, i.e. they increase the immunogenicity of the pretargeting treatment [27]. Genetically engineered scFv antibody fragments afford a practical solution to these problems. In contrast to IgGs, in vivo properties of scFv include a rapid clearance from systemic circulation, noticeably more uniform penetration into the tumor mass, and comparatively low non-specific retention in normal tissues. Still the use of low molecular weight fragments has its own downside: the absolute amount of antibody that localizes in the tumor is insufficient to achieve therapeutic levels of radiation [3,30,33,46,51]. For example, in a recent Phase I/II study, 10 patients were treated with iodine-131-labeled humanized anti-CEA A5B7 antibody fragments. Although, high tumor to blood ratios were achieved, the dosimetry calculations indicated that the delivery of therapeutic doses to tumor might not be possible [7].

2 BMP–streptavidin

359

complexes in athymic mice (n = 6) bearing LS-174T

Multi-step pretargeting systems effectively amplify radioactivity localized in tumors even when the antibody fragments are employed [18,40,46,51]. This approach partially resolves some of the mentioned above problems but one major difficulty remains. The requisite chemical modification of antibody fragments to prepare either biotin or (strept)avidin conjugates is usually random, may lead to considerable modifications of the antigen-binding site, and ultimately decreases and in some instances abolishes the target antigen recognition. Proteins typically have multiple amino acid residues such as lysine that are utilized in the preparation of conjugates, therefore chemical methods of the biotin or (strept)avidin attachment result in products that have a high degree of variability in the site of modification. Oftentimes a ligand reacts in a position that blocks the binding site or sites and may hinder the binding of the conjugate to the targeting moiety. Unlike chemically generated conjugates, genetically engineered constructs are well defined and homogenous. Methods of their production assure unprecedented consistency of the quality and structure as shown here for genetically engineered constructs that comprise a biotin mimetic peptide and CC49 scFv. Through the genetic alteration of CC49 scFv, BMP was reproducibly inserted at a single, strictly defined site, i.e. the carboxyl terminus of scFv. The immunoreactivity of BMP-containing constructs was unchanged compared with values previously reported for CC49 scFvs [4,12,33]. Fusion proteins of scFv that bind to antigen CA125 linked to biotin mimetic peptide were described in the context of radio- and immunoassays [16,37]. This paper describes the first application of tumor-seeking scFv fusion with BMP

360

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

for pretargeted radioimmunotherapy. BMP is a decapeptide, SerAlaTrpArgHisProGlnPheGlyGly (SAWRHPQFGG), resistant to biotinidase that cleaves biotin from biotinylated proteins in serum [46]. It binds specifically to streptavidin and occupies the same pocket where biotin is normally complexed [37,38]. Fusion BMP with scFv did not affect the ability of scFv to recognize TAG-72 antigen in vivo or its surrogate antigen, BSM, in vitro. Similarly, the streptavidin-binding property was not impaired in the fusion protein. The constructs were fully bifunctional. Radiolabeling with Na125 I damaged neither the immunoreactivity nor the streptavidin-binding properties of scFvBMPs. The evidence of bifunctionality was also apparent in animal studies. Because previously published reports demonstrated improved tumor targeting with CC49 sc(Fv)2 dimers as compared with the monomeric scFv [4,33] and indicated that dimeric constructs are better candidates for radioimmunotherapy, all in vivo studies were done with the dimeric sc(Fv)2 BMP. BMP does not appear to influence properties governed by scFv such as biodistribution, blood clearance, and tumor localization. 125 I-sc(Fv)2 BMP had a blood clearance rate similar to 125 I-sc(Fv)2 . The uptake by normal organs was only non-specific and low while the tumor accretion was rapid and specific. These genetically engineered constructs were also more stable in the systemic circulation compared with their chemically generated biotinylated conjugates. Because the intention of this study was to demonstrate the potential of sc(Fv)2 BMP for pretargeting applications, one concern was a relatively low affinity of BMP to streptavidin. The apparent dissociation constant for BMP is 1 × 10−8 M [45], a value seven-fold lower than for the biotin–streptavidin complex. Therefore, it was important to demonstrate that complexes of sc(Fv)2 BMP with streptavidin are stable in vivo and that such complexes are able to specifically target TAG-72 in tumor xenografts. Theoretically, the dimeric sc(Fv)2 BMP can react with streptavidin at 4:1 molar ratio yielding complexes with up to eight potential antigen-binding sites (four sc(Fv)2 units). However, in these studies formation of multiple sc(Fv)2 complexes was avoided by using an excess of streptavidin to obtain homogenous population of one sc(Fv)2 bound to one molecule of streptavidin for all in vivo analysis. The sc(Fv)2 BMP–streptavidin complexes cleared from the blood at the rates expected for 120-kDa proteins, much slower than rates measured for uncomplexed 125 I-sc(Fv)2 BMP. The targeting of LS-174T xenografts by 125 I-sc(Fv)2 BMP–streptavidin (8.48 ± 1.2%ID/g at 24 h) was at levels significantly higher than 125 I-sc(Fv)2 BMP (5.81 ± 0.67%ID/g at 24 h; t-test P < 0.001). The complex was also retained 24 h after injection in liver and spleen at levels 6.3 ± 2.2 and 10.5 ± 3.9 times higher than 125 I-sc(Fv)2 BMP. Other pretargeting studies also comment on a similarly elevated liver uptake compared with the uptake of directly radiolabeled antibodies. The precise reason for this increase is not fully defined. The interaction of biotin

Table 2 Distribution of xenografts

125 I-streptavidin

in athymic mice bearing LS-174T

125 I-streptavidin

4h Tumor Blood Liver Spleen Kidneys Heart Lungs

1.55 2.05 1.49 1.07 65.38 0.68 1.22

24 h ± ± ± ± ± ± ±

0.20∗ 0.09 0.04 0.06 4.55 0.02 0.12

0.24 0.28 0.64 0.34 1.51 0.06 0.18

± ± ± ± ± ± ±

0.06 0.02 0.05 0.02 0.08 0.00 0.02

∗ Values shown are average % injected dose/g ± S.D.; 125 I-streptavidin was injected i.v. via a tail vein into athymic mice bearing LS-174T xenografts. Mice were sacrificed at the indicated times and %ID/g for each organ was determined. n = 6 for each time point.

or in this case BMP, with a specific biotin receptor on hepatocytes [44] or the aggregation and trapping of the 125 I-scFvBMP–streptavidin complexes by Kupffer cells are some of the possibilities. It is apparent that this uptake is not related to biological processing of streptavidin. In control experiments in which directly radioiodinated 125 I-streptavidin was injected into xenograft-bearing mice, a rapid renal clearance of radioactivity was observed. There was no significant uptake of 125 I-streptavidin in tumor and other normal tissues including liver (Table 2). This is in line with previous reports indicating that streptavidin does not accumulate in any tissue other than kidneys [18,40,47]. Values reported for the kidney uptake vary widely from 1 to >100%ID/g [47]. All pretargeting schemes allow time for a full clearance of the pretargeting protein, usually aided by clearing agents. Levels of radioactivity measured in normal tissues for 125 I-sc(Fv)2 BMP as soon as 24 h after administration (Table 1) indicate that these constructs are excellent candidates for pretargeted radioimmunotherapy. In fact, a fusion of BMP with CC49 scFv appears to be superior to recently engineered pretargeting fusion protein that consists of streptavidin and CD20-specific scFv [40]. Several noteworthy differences important in the pretargeting schemes were apparent. 125 I-sc(Fv)2 BMP had the blood clearance half-life of 3.35 ± 0.34 h compared with 16 h reported for the streptavidin fusion protein. Moreover, there was a >three-fold higher uptake of 125 I-sc(Fv)2 BMP in LS-1274T xenografts (8.5%ID/g) than liver (2.7%ID/g) compared with nearly a four times higher uptake in liver compared with tumor in the case of scFv–streptavidin fusion protein [40]. An efficient delivery of pretargeting sc(Fv)2 BMP to tumor and a rapid blood clearance may permit a two-step pretargeting approach, i.e. it appears that the inclusion of a clearing agent may not be necessary prior to the administration of the radiotherapeutic targeting moiety. In summary, BMP-modified CC49 monomeric and dimeric scFvs were constructed for pretargeting approaches.

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

Their biological function was maintained at the levels of the parent structures as verified by the binding of scFvBMP constructs to streptavidin and TAG-72. The fusion of CC49 scFv with BMP did not alter the biodistribution and excellent tumor targeting by these constructs. Ongoing studies will examine the potential of these new constructs in the full pretargeting protocol using two approaches: pretargeting of sc(Fv)2 BMP to tumor followed by the administration of radiolabeled streptavidin, and pretargeting of sc(Fv)2 BMP–streptavidin in tumor followed by radiolabeled biotin.

Acknowledgments We thank Ms. K. Devish, and Mr. J. Jokerst for their expert technical assistance. We acknowledge the Molecular Biology Core Lab for sequencing studies and the Monoclonal Antibody Core Facility for their expertise. Grants from the American Cancer Society Institutional Research Grant (WBS 36-5301-2069-001) and the United States Department of Energy (DE-FG02-95ER62024) supported these studies.

References [1] Adams GP, Schier R, Marshall K, Wolf EJ, McCall AM, Marks JD, et al. Increased affinity leads to improved selective tumor delivery of single-chain Fv antibodies. Cancer Res 1998;58:485–90. [2] Axworthy DB, Reno JM, Hylarides MD, Mallett RW, Theodore LJ, Gustavson LM, et al. Cure of human carcinoma xenografts by a single dose of pretargeted yttrium-90 with negligible toxicity. Proc Natl Acad Sci USA 2000;97:1802–7. [3] Barbet J, Kraeber-Bodere F, Vuillez JP, Gautherot E, Rouvier E, Chatal JF. Pretargeting with the affinity enhancement system for radioimmunotherapy. Cancer Biother Radiopharm 1999;14:153–66. [4] Beresford GW, Pavlinkova G, Booth BJ, Batra SK, Colcher D. Binding characteristics and tumor targeting of a covalently linked divalent CC49 single-chain antibody. Int J Cancer 1999;81:911–7. [5] Bird RE, Hardman KD, Jacobson JW, Johnson S, Kaufman BM, Lee SM, et al. Single-chain antigen-binding proteins. Science 1988;242:423–6. [6] Breitz HB, Weiden PL, Beaumier PL, Axworthy DB, Seiler C, Su FM, et al. Clinical optimization of pretargeted radioimmunotherapy with antibody–streptavidin conjugate and 90Y-DOTA-biotin. J Nucl Med 2000;41:131–40. [7] Casey JL, Napier MP, King DJ, Pedley RB, Chaplin LC, Weir N, et al. Tumor targeting of humanised cross-linked divalent-Fab antibody fragments: a clinical phase I/II study. Br J Cancer 2002;86:1401–10. [8] Colcher D, Zalutsky M, Kaplan W, Kufe D, Austin F, Schlom J. Radiolocalization of human mammary tumors in athymic mice by a monoclonal antibody. Cancer Res 1983;43:736–42. [9] Cremonesi M, Ferrari M, Chinol M, Stabin MG, Grana C, Prisco G, et al. Three-step radioimmunotherapy with yttrium-90 biotin: dosimetry and pharmacokinetics in cancer patients. Eur J Nucl Med 1999;26:110–20. [10] Domingo RJ, Reilly RM. Pre-targeted radioimmunotherapy of human colon cancer xenografts in athymic mice using streptavidin-CC49 monoclonal antibody and 90Y-DOTA-biotin. Nucl Med Commun 2000;21:89–96.

361

[11] Dosio F, Magnani P, Paganelli G, Samuel A, Chiesa G, Fazio F. Three-step tumor pre-targeting in lung cancer immunoscintigraphy. J Nucl Biol Med 1993;37:228–32. [12] Goel A, Colcher D, Baranowska-Kortylewicz J, Augustine S, Booth BJ, Pavlinkova G, et al. Genetically engineered tetravalent single-chain Fv of the pancarcinoma monoclonal antibody CC49: improved biodistribution and potential for therapeutic application. Cancer Res 2000;60:6964–71. [13] Goldenberg DM. Targeted therapy of cancer with radiolabeled antibodies. J Nucl Med 2002;43:693–713. [14] Goodwin DA, Meares CF. Pretargeting: general principles. Cancer 1997;80:2675–80. [15] Grana C, Chinol M, Robertson C, Mazzetta C, Bartolomei M, De Cicco C, et al. Pretargeted adjuvant radioimmunotherapy with yttrium-90-biotin in malignant glioma patients: a pilot study. Br J Cancer 2002;86:207–12. [16] Gregory KJ, Bachas LG. Use of a biomimetic peptide in the design of a competitive binding assay for biotin and biotin analogues. Anal Biochem 2001;289:82–8. [17] Karacay H, Sharkey RM, McBride WJ, Griffiths GL, Qu Z, Chang K, et al. Pretargeting for cancer radioimmunotherapy with bispecific antibodies: role of the bispecific antibody’s valency for the tumor target antigen. Bioconjug Chem 2002;13:1054–70. [18] Kassis AI, Jones PL, Matalka KZ, Adelstein SJ. Antibody-dependent signal amplification in tumor xenografts after pretreatment with biotinylated monoclonal antibody and avidin or streptavidin. J Nucl Med 1996;37:343–52. [19] Knox SJ, Goris ML, Tempero M, Weiden PL, Gentner L, Breitz H, et al. Phase II trial of yttrium-90-DOTA-biotin pretargeted by NR-LU-10 antibody/streptavidin in patients with metastatic colon cancer. Clin Cancer Res 2000;6:406–14. [20] Kobayashi H, Sakahara H, Endo K, Hosono M, Yao ZS, Toyama S, et al. Comparison of the chase effects of avidin, streptavidin, neutravidin, and avidin–ferritin on a radiolabeled biotinylated anti-tumor monoclonal antibody. Jpn J Cancer Res 1995;86:310–4. [21] Kobayashi H, Sakahara H, Endo K, Yao ZS, Toyama S, Konishi J. Repeating the avidin “chase” markedly improved the biodistribution of radiolabelled biotinylated antibodies and promoted the excretion of additional background radioactivity. Eur J Cancer 1995;31A:1689– 96. [22] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–5. [23] Leichner PK, Akabani G, Colcher D, Harrison KA, Hawkins WG, Eckblade M, et al. Patient-specific dosimetry of indium-111and yttrium-90-labeled monoclonal antibody CC49. J Nucl Med 1997;38:512–6. [24] Lowry OH, Rosenbrough NJ, Farr AL, Randall RJ. Protein measurement with Folin phenol. J Biol Chem 1951;193:265–75. [25] Lyubsky S, Madariaga J, Lozowski M, Mishriki Y, Schuss A, Chao S, et al. A tumor-associated antigen in carcinoma of the pancreas defined by monoclonal antibody B72.3. Am J Clin Pathol 1988;89:160–7. [26] Magnani P, Paganelli G, Modorati G, Zito F, Songini C, Sudati F, et al. Quantitative comparison of direct antibody labeling and tumor pretargeting in uveal melanoma. J Nucl Med 1996;37:967–71. [27] Marshall D, Pedley RB, Boden JA, Boden R, Melton RG, Begent RH. Polyethylene glycol modification of a galactosylated streptavidin clearing agent: effects on immunogenicity and clearance of a biotinylated anti-tumor antibody. Br J Cancer 1996;73:565–72. [28] Mayer A, Tsiompanou E, O’Malley D, Boxer GM, Bhatia J, Flynn AA, et al. Radioimmunoguided surgery in colorectal cancer using a genetically engineered anti-CEA single-chain Fv antibody. Clin Cancer Res 2000;6:1711–9. [29] Meredith RF, Khazaeli MB, Macey DJ, Grizzle WE, Mayo M, Schlom J, et al. Phase II study of interferon-enhanced 131I-labeled high affinity CC49 monoclonal antibody therapy in patients with metastatic prostate cancer. Clin Cancer Res 1999;5:3254s–8s.

362

G. Pavlinkova et al. / Peptides 24 (2003) 353–362

[30] Milenic DE, Yokota T, Filpula DR, Finkelman MA, Dodd SW, Wood JF, et al. Construction, binding properties, metabolism, and tumor targeting of a single-chain Fv derived from the pancarcinoma monoclonal antibody CC49. Cancer Res 1991;51:6363–71. [31] Paganelli G, Orecchia R, Jereczek-Fossa B, Grana C, Cremonesi M, De Braud F, et al. Combined treatment of advanced oropharyngeal cancer with external radiotherapy and three-step radioimmunotherapy. Eur J Nucl Med 1998;25:1336–9. [32] Pantoliano MW, Bird RE, Johnson S, Asel ED, Dodd SW, Wood JF, et al. Conformational stability, folding, and ligand-binding affinity of single-chain Fv immunoglobulin fragments expressed in Escherichia coli. Biochemistry 1991;30:10117–25. [33] Pavlinkova G, Beresford GW, Booth BJ, Batra SK, Colcher D. Pharmacokinetics and biodistribution of engineered single-chain antibody constructs of MAb CC49 in colon carcinoma xenografts. J Nucl Med 1999;40:1536–46. [34] Press OW, Corcoran M, Subbiah K, Hamlin DK, Wilbur DS, Johnson T, et al. A comparative evaluation of conventional and pretargeted radioimmunotherapy of CD20-expressing lymphoma xenografts. Blood 2001;98:2535–43. [35] Rixon MW, Gourlie BB, Kaplan DA, Schlom J, Mezes PS. Preferential use of a H chain V region in antitumor-associated glycoprotein-72 monoclonal antibodies. J Immunol 1993;151:6559–68. [36] Rucker R, Bresler HS, Heffelfinger M, Kim JA, Martin EWJ, Triozzi PL. Low-dose monoclonal antibody CC49 administered sequentially with granulocyte–macrophage colony-stimulating factor in patients with metastatic colorectal cancer. J Immunother 1999;22:80–4. [37] Schmidt TG, Koepke J, Frank R, Skerra A. Molecular interaction between the Strep-tag affinity peptide and its cognate target, streptavidin. J Mol Biol 1996;255:753–66. [38] Schmidt TG, Skerra A. The random peptide library-assisted engineering of a C-terminal affinity peptide, useful for the detection and purification of a functional Ig Fv fragment. Protein Eng 1993;6:109–22. [39] Schmidt TG, Skerra A. One-step affinity purification of bacterially produced proteins by means of the “Strep tag” and immobilized recombinant core streptavidin. J Chromatogr A 1994;676:337–45. [40] Schultz J, Lin Y, Sanderson J, Zuo Y, Stone D, Mallett R, et al. A tetravalent single-chain antibody-streptavidin fusion protein for pretargeted lymphoma therapy. Cancer Res 2000;60:6663–9. [41] Tempero M, Leichner P, Baranowska-Kortylewicz J, Harrison K, Augustine S, Schlom J, et al. High-dose therapy with 90Yttrium-

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

labeled monoclonal antibody CC49: a phase I trial. Clin Cancer Res 2000;6:3095–102. Tempero M, Leichner P, Dalrymple G, Harrison K, Augustine S, Schlam J, et al. High-dose therapy with iodine-131-labeled monoclonal antibody CC49 in patients with gastrointestinal cancers: a phase I trial. J Clin Oncol 1997;15:1518–28. Thor A, Ohuchi N, Szpak CA, Johnston WW, Schlom J. Distribution of oncofetal antigen tumor-associated glycoprotein-72 defined by monoclonal antibody B72.3. Cancer Res 1986;46:3118–24. Vesely DL, Kemp SF, Elders MJ. Isolation of a biotin receptor from hepatic plasma membranes. Biochem Biophys Res Commun 1987;143:913–6. Voss S, Skerra A. Mutagenesis of a flexible loop in streptavidin leads to higher affinity for the Strep-tag II peptide and improved performance in recombinant protein purification. Protein Eng 1997;10:975–82. Wilbur DS, Hamlin DK, Vessella RL, Stray JE, Buhler KR, Stayton PS, et al. Antibody fragments in tumor pretargeting. Evaluation of biotinylated Fab colocalization with recombinant streptavidin and avidin. Bioconjug Chem 1996;7:689–702. Wilbur DS, Stayton PS, To R, Buhler KR, Klumb LA, Hamlin DK, et al. Streptavidin in antibody pretargeting. Comparison of a recombinant streptavidin with two streptavidin mutant proteins and two commercially available streptavidin proteins. Bioconjug Chem 1998;9:100–7. Wu AM, Chen W, Raubitschek A, Williams LE, Neumaier M, Fischer R, et al. Tumor localization of anti-CEA single-chain Fvs: improved targeting by non-covalent dimers. Immunotechnology 1996;2: 21–36. Yao Z, Zhang M, Axworthy DB, Wong KJ, Garmestani K, Park L, et al. Radioimmunotherapy of A431 xenografted mice with pretargeted B3 antibody-streptavidin and (90)Y-labeled 1,4,7,10-tetraazacyclododecane-N,N ,N ,N -tetraacetic acid (DOTA)-biotin. Cancer Res 2002;62:5755–60. Yao Z, Zhang M, Kobayashi H, Sakahara H, Nakada H, Yamashina I, et al. Improved targeting of radiolabeled streptavidin in tumors pretargeted with biotinylated monoclonal antibodies through an avidin chase. J Nucl Med 1995;36:837–41. Yao Z, Zhang M, Sakahara H, Saga T, Kobayashi H, Nakamoto Y, et al. Increased streptavidin uptake in tumors pretargeted with biotinylated antibody using a conjugate of streptavidin-fab fragment. Nucl Med Biol 1998;25:557–60.