- Email: [email protected]
Context-dependent regulation of embryonic stem cell differentiation by mGlu4 metabotropic glutamate receptors
Neuropharmacology 51 (2006) 606e611 www.elsevier.com/locate/neuropharm
Context-dependent regulation of embryonic stem cell differentiation by mGlu4 metabotropic glutamate receptors Irene Cappuccio a, Roberta Verani a, Paola Spinsanti a, Cristiano Niccolini a, Roberto Gradini b,c, Santa Costantino a, Ferdinando Nicoletti a,c, Daniela Melchiorri a,* a
Departments of Human Physiology and Pharmacology, University of Rome ‘‘La Sapienza’’, Piazzale Aldo Moro 5, 00185 Rome, Italy b Department of Experimental Medicine, University of Rome ‘‘La Sapienza’’, Piazzale Aldo Moro 5, 00185 Rome, Italy c I.N.M. Neuromed, Pozzilli, Italy Received 13 December 2005; received in revised form 3 May 2006; accepted 3 May 2006
Abstract The mGlu5 receptor is the only metabotropic glutamate receptor subtype expressed by mouse embryonic stem (ES) cells grown under non-differentiating conditions [Cappuccio, I., Spinanti, P. Porcellini, A., Desiderati, F., De Vita, T., Storto, M., Capobianco, L., Battaglia, G., Nicoletti, F., Melchiorri, D., 2005. Endogenous activation of mGlu5 metabotropic glutamate receptors supports self-renewal of cultured mouse embryonic stem cells. Neuropharmacology 1, 196e205]. We now report that ES cells differentiating into embryoid bodies (EBs) progressively lose mGlu5 receptors and begin to express mGlu4 receptors at both mRNA and proteinc level. A 4-day treatment of EBs with the mGlu4 receptor agonist, L-2-amino-4-phosphonobutanoate (L-AP4), increased mRNA levels of the mesoderm marker, brachyury and the endoderm marker, H19, and decreased the expression of the transcript for the primitive ectoderm marker, fibroblast-growth factor-5 (FGF-5). These effects were prevented by the mGlu4 receptor antagonists, a-methylserine-O-phosphate (MSOP). Plating of EBs for 4 days in vitro in ITSFn medium induced cell differentiation towards a neural lineage, as reflected by the expression of the intermediate filament protein, nestin, and the homeobox protein, Dlx-2. Pharmacological activation of mGlu4 receptors during cell incubation in ITSFn medium increased the expression of both neural markers. Similar results were obtained when neural differentiation was induced by exposure of EBs to retinoic acid. These data suggest that differentiation of cultured ES cells is associated with changes in the expression pattern of mGlu receptors and that activation of mGlu4 receptors affects cell differentiation in a context-dependent manner. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Mouse embryonic stem cells; Differentiation; Metabotropic glutamate receptors subtype4; Embryoid bodies
1. Introduction Mouse embryonic stem (ES) cells derived from the inner cell mass of blastocysts undergo extended proliferation in vitro and can repopulate all cell lineages when injected into blastocyststage embryos. This pluripotency of ES cells is reproduced in vitro by a floating culture of ES aggregates termed ‘‘embryoid bodies’’ (EBs). EBs are generated by culturing ES cells in the absence of the cytokine, leukaemia inhibitory
* Corresponding author. Tel.: þ39 06 49912969; fax: þ39 06 4450307. E-mail address: [email protected] (D. Melchiorri). 0028-3908/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuropharm.2006.05.007
factor (LIF), and resemble the normal embryos at the egg cylinder stage (Doetschman et al., 1985; Robertson, 1987). Following several days in vitro (DIV), EBs consist of multiple differentiated cell types including ectodermal, mesodermal and endodermal derivatives. Specific somatic fates may be induced by factors that drive cells to differentiate towards a particular lineage or, alternatively, by plating EBs onto adhesive substrates in the presence of a medium that allows the survival of a selected population of committed cells. Although several protocols have been developed to enhance the production of specific cell phenotypes, little is known on the molecular mechanisms that drive early lineage commitment. Thus, differentiation protocols are empirical and
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
607
yield heterogeneous outcomes. Searching for additional mechanisms controlling the early phases of ES cell differentiation, we focused on metabotropic glutamate (mGlu) receptors, which are involved in the proliferation and survival of both embryonic (Cappuccio et al., 2005) and neural stem cells (Di Giorgi Gerevini et al., 2005), and are shown to influence neurogenesis in hippocampal slices (Baskys et al., 2005). mGlu receptors form a family of eight subtypes classified into three groups on the basis of sequence homology, pharmacological properties and transduction pathways. Group I includes mGlu1 and -5 receptors, which are coupled to a Gq and polyphosphoinositide hydrolysis. Groups II and III (mGlu2, -3 and mGlu4, -6, -7 and -8 receptors, respectively) are negatively coupled to adenylyl cyclase in heterologous expression systems (for a review see De Blasi et al., 2001). We have recently shown that ES cells cultured under non-differentiating conditions (i.e. in the presence of LIF) express functional mGlu5 receptors, the activation of which contributes to the maintenance of the undifferentiated state of cells (Cappuccio et al., 2005). We decided to examine whether ES cell differentiation into EBs is associated with changes in the expression pattern of mGlu receptors and whether receptor activation influences early cell commitment towards specific lineages.
was diluted to 100 ml with sterile, distilled water and 1 ml of cDNA was employed in each subsequent amplification. The following primers were used:
2. Materials and methods
For b-actin amplification, we used the primers described by Rolen et al. (1994), which span an intron and yield products of different sizes depending on whether cDNA or genomic DNA is used as a template (400 bp or 600 bp, respectively). Reaction conditions included an initial denaturation step (94 C/3 min) followed by 45 cycles of 94 C/30 s; 56 C/30 s (mGlu1, -5, -7) or 62 C (mGlu2, -3, -4, -6, -8); 72 C/30 s. A final extension step (72 C/10 min) concluded the reaction. PCR products (1/3 of the reaction) were analyzed electrophoretically on 2% agarose gels poured and run in 1 TAE. Real-time Quantitative PCR was performed using a 2 Supermix cocktail (Biorad) containing the double-stranded DNA binding fluorescent probe Sybr Green and all necessary components except primers. Quantitative PCR conditions included an initial denaturation step of 94 C/10 min followed by 40 cycles of 94 C/15 s and 55 C/15 s. Standards, samples, and negative controls (no template) were analyzed in triplicate. Concentrations of mRNA were calculated from serially diluted standard curves simultaneously amplified with the unknown samples and corrected for b-actin mRNA levels.
2.1. Materials a-Methylserine-O-phosphate (MSOP), L-2-amino-4-phosphonobutanoate (L-AP4), and a-cyclopropyl-4-phosphonophenylglycine (CPPG) were purchased from Tocris Cookson Ltd, UK. DMEM, DMEM-F12, KnockoutDMEM, penicillinestreptomycin, 2-mercaptoethanol, and MEM non-essential amino acid solution were purchased from GIBCO/Life Science, Milan, Italy. Rabbit polyclonal anti-mGlu2/3 antibodies were from Chemicon. Rabbit polyclonal anti-mGlu4, and -mGlu5 antibodies were from Upstate Technology, Milan, Italy. Mouse monoclonal anti-nestin antibodies and rabbit polyclonal anti-Dlx-2 antibodies were from Chemicon. Fluorescent (FITC) conjugated affinity pure anti-rabbit antibodies were from Jackson Immuno Research. The Cytotoxicity Detection Kit (LDH) was purchased from Boehringer Mannheim.
mGlu1: forward, GCTGTACCTACTATGCCTTC; reverse, AGACCATGA CACAGACTTGC; mGlu2: forward, CTACAGTGATGTCTCCATCC; reverse, AAAGCCTC AATGCCTGTCTC; mGlu3: forward, CAAGTGACTACAGAGTGCAG; reverse, CTGTCACC AATGCTCAGCCTC; mGlu4: forward: CCAACGAGGATGACATCAGG; reverse: CACAGGTC ACGGTGCATGG; mGlu5: forward: GTCCTTCTGTTGATCCTGTC; reverse: ATGCAGCAT GGCCTCCACTC; mGlu6: forward, GCCAGTCAGATGATTCCACC; reverse: GCCTGGTA CCTGGAAGATGTC; mGlu7: forward, CCAGATGTGGCAGTGTGTTC; reverse: CGAGTCTT GATGGCATACAC; mGlu8: forward, ATCACCTTCAGCCTCATCTC; reverse: TGTGACCAC AGCCTTGAAGC. FGF-5: forward, GATGCCCACTCTGCAGTACA; reverse: GCGACGTTT TCTTCGTCTTC; H19: forward, GTTCAAGGTAGGGGGAGGAG; reverse: AGAGGACAG AAGGGCAGTCA; Brachyury: forward, TTCTTTGGCATCAAGGAAGG; reverse: TCCCGA GACCCAGTTCATAG; Otx-2: forward, GAAGTTGAGCCAGCATAGCC; reverse: TCTGACCCC TTGTCCACTTC; Nestin: forward, CTACCAGGAGCGCGTGGC; reverse: TCCACAGCC AGCTGGACCTT.
2.2. Cell cultures The embryonic ES-D3 cell line derived from 129/Svþc/þp mouse was purchased from ATCC. ES cells were induced to differentiate by plating onto a nonadhesive substrate in the absence of the cytokine LIF. Under these conditions, cells aggregate into embryoid bodies (EBs) and begin to differentiate. Neural induction was induced (i) by re-plating EBs at 4 DIV onto gelatin-coated dishes in the presence of DMEM/F12 medium supplemented with insulin, transferrin, selenium, fibronectin (ITSFn medium); or (ii) by exposure of EB suspension to all-trans-retinoic acid (1 mM) according to the 4/4þ protocol (i.e. 4 days without and 4 days with retinoic acid), followed by plating onto gelatin-coated dishes and culturing for 4 additional days in serum-free DMEM/F12 medium supplemented with N2.
2.3. RT-PCR analysis Total RNA was extracted from the cultures with Trizol reagent (Invitrogen, Milan, Italy) and subjected to DNAseI treatment (Promega, Italy) according to manufacturer’s instructions. Two micrograms of total RNA were then employed for cDNA synthesis, using Superscript II (BRL Life Tech.) and random examers’ primers according to manufacturer’s instructions. The RT product
2.4. Western blot analysis Western blot analysis was performed as described previously (Iacovelli et al., 2004). Briefly, cells were lysed for 10 min at 4 C in Triton X-100 lysis buffer (10 mM TriseHCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 10 mg/ml leupeptin, 10 mg/ml aprotinin, 1 mM sodium orthovanadate, 50 mM sodium fluoride, and 10 mM b-glycerophosphate). All cell lysates were cleared by centrifugation (10,000 g for 10 min) and 80 mg of proteins were separated by SDS-gel electrophoresis, blotted onto nitrocellulose and probed using different commercial antibodies. Membranes were saturated for 1 h with Tris-buffered saline (TBS; 100 mM Tris, 0.9% NaCl) containing 0.05% Tween 20, 1% bovine serum albumin and 1% non-fat dry milk, and then incubated overnight with primary antibodies. Antibodies were used at the following dilutions: mouse monoclonal anti-Nestin antibodies, 1:200 (BD Bioscience, clone 25); rabbit polyclonal anti-mGlu2/3, -4, and -5 antibodies, 1:1000; rabbit polyclonal anti-Dlx-2 antibodies 1:200. Immunoreactive bands were visualized by enhanced chemiluminescence using horseradish peroxidase-linked secondary antibody. As levels of the housekeeping proteins we have tested (b-actin, GAPDH) changed substantially during differentiation of EBs, densitometric
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
608
values of nestin and Dlx-2 were normalized by the amount of proteins loaded in the gel.
2.5. Detection of cytotoxicity Cytotoxicity was assessed using a commercial kit (Roche). Briefly, about 106 cells/ml were plated in 96-well plates and incubated in ITSFn medium with or without L-AP4 (30 mM), at 37 C. After 24 h, 100 ml of the centrifuged supernatant was collected into a new plate. Following the addition of 100 ml of the reaction mixture containing the catalyst (NADþ is reduced to NADH/Hþ by LDH) and tetrazolium salts, the probe was incubated for additional 30 min at room temperature. The absorbance of the samples was measured at 495 nm using a microplate reader. To determine the percentage of cytotoxicity, the average absorbance values of the probes were calculated and the background control (ITSFn medium without cells) was subtracted; whereby the resulting values were set into the following equation:
Cytotoxicity ð%Þ ¼
experimental sample low control 100 ; high control low control
where low control ¼ LDH activity in the medium of untreated cells (spontaneous LDH release); high control ¼ maximum releasable LDH activity after treating the cultures with 2% Triton X-100 (maximum LDH release). Each assay was performed in triplicate and repeated twice.
2.6. Immunocytochemistry Dissected EBs (18 mm thick slices) were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 5 min. Sections were incubated with blocking buffer (TBS, 0.1% Triton X-100, and 2% normal goat serum) for 30 min followed by incubation with rabbit polyclonal anti-mGlu4 antibody (1:100) in blocking buffer overnight at 4 C. After washing with PBS, the sections were incubated with a fluorescein isothiocynate (FITC)-labeled secondary antibody (goat anti-rabbit IgG1, 1:200). Sections were washed three times with PBS, mounted with mounting media and examined under a confocal microscope (Zeiss, LSM510 laser scanner microscope; Oberkochen, Germany).
3. Results D3 ES cells were plated onto a non-adhering substrate with a serum-containing medium devoid of LIF. Under these conditions, cells aggregated into EBs and started to express specific markers of the three germ layers (see below). Analysis of the transcripts for each mGlu receptor subtype by qualitative RTPCR showed that EBs at 4 DIV expressed mGlu3 and mGlu4 mRNAs, whereas the transcripts of all other receptor subtype were undetectable (Fig. 1A). The absence of mGlu5 mRNA was unexpected because mGlu5 is the only mGlu receptor subtype expressed by undifferentiated ES cells (Cappuccio et al., 2005). We therefore examined the expression kinetics of mGlu receptor proteins in EBs at different DIVs. Levels of mGlu5 receptor protein were still substantial in EBs at 1 DIV, but then progressively decreased and became undetectable at 4 DIV (Fig. 1B). In contrast, expression of mGlu4 receptors increased from 1 to 2 DIV and then remained constant up to 4 DIV (Fig. 1C). The mGlu2/3 receptor protein was undetectable in cultured EBs up to 4 DIV (Fig. 1D). The presence of mGlu4 receptors in EBs was confirmed by immunofluorescence staining with a confocal microscope (Fig. 1E). To unravel the role of mGlu4 receptors in the differentiation program of EB cells, we used the group-III receptor agonist, L-AP4. We adopted this strategy because (i) no other groupIII mGlu receptor subtypes (i.e. mGlu6, -7 or -8) are expressed by EBs; and (ii) the only mGlu4 selective drug available (i.e. PHCCC) could not be used for the effect of the lipid solvent on cell differentiation. We carried out a quantitative analysis of the mRNA of the following molecular markers of the three germ layers: the mesoderm marker, brachyury; the endoderm marker, H19; the primitive ectoderm marker, FGF-5; and the early neuroectoderm marker, Otx-2. A 4-day treatment of EBs with L-AP4 (30 mM, applied every day) increased the
Fig. 1. RT-PCR analysis of mGlu receptor subtypes in cultured EBs at 4 DIV is shown in (A). Mouse cerebral cortex (CTX) and cerebellum (CBL) are used as positive controls; Western blot analysis of mGlu5, mGlu4, and mGlu2/3 receptors is shown in (B), (C), and (D), respectively. Protein lysates from the cerebral cortex (CTX) of wild type (þ/þ) or mGlu5 knockout mice (/) or from the mouse cerebellum (CBL) were also loaded as positive controls. Confocal, immunofluorescence analysis of mGlu4 receptors in EBs at 4 DIV is shown in (E).
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
609
Fig. 2. Real-time PCR analysis of the transcripts for the mesoderm marker, brachyury (Brachy), the endoderm marker H19, the primitive ectoderm marker FGF-5, and the neuroectoderm marker Otx-2 in cultured EBs exposed for 4 days to L-AP4 (30 mM) and/or MSOP (200 mM) is shown. Note that activation of mGlu4 receptors increased the expression of Brachyury and H19 mRNA, and decreased the expression of FGF-5 mRNA. Data are means SEM of 6 determinations from two independent experiments. p < 0.05 vs. controls (CTRL) (One-Way ANOVA þTurkey’s t test).
expression of brachyury and H19 mRNA, and decreased the expression of FGF-5 mRNA. No significant changes in Otx2 mRNA were induced by L-AP4 (Fig. 2). These effects were prevented by the mGlu4 receptor antagonists, MSOP (200 mM), which was inactive by itself (Fig. 2). We next examined whether activation of mGlu4 receptors could affect lineage commitment under conditions that favour differentiation towards a neural phenotype. We selected two models of neural induction: (i) plating of EBs at 4 DIV onto gelatincoated dishes in the presence of the ITSFn medium, which is known to select nestin-positive cells from differentiating EBs (Okabe et al., 1996; Lee et al., 2000); and (ii) exposure of EBs to a 4/4þ day treatment with all-trans-retinoic acid (1 mM) followed by plating onto an adhesive substrate and culturing in DMEM/F12 supplemented with N2 (Bain et al., 1996; Okada et al., 2004). In the first model of neural induction, EB cells cultured for 4 days in ITSFn medium expressed the homeobox Dlx-2 and the intermediate filament protein nestin, which are both markers of neural precursor cells (Fig. 3A, B). A daily addition of L-AP4 (30 mM) for 8 days (4 days without and 4 days with the ITSFn medium), induced a 3-fold increase in
the levels of nestin and Dlx-2 proteins (Fig. 3A, B). This increase was reduced by co-application of the group-III mGlu receptor antagonists, CPPG (100 nM) (Fig. 3A, B). To define the temporal window of the effect of L-AP4, we applied the drug either during the 4 days preceding neural induction or during the 4 days in which cells were incubated with the ITSFn medium. L-AP4 amplified Dlx-2 expression only when combined with the ITSFn medium (Fig. 4). Incubation in ITSFn medium enriches EB cultures of neural precursor cells by providing a non-permissive environment for the survival of nestin-negative cells (Okabe et al., 1996). We therefore wondered whether the L-AP4-induced increase in the expression of nestin and Dlx-2 was a consequence of an increased cell survival. We assessed cell damage by monitoring the release of LDH in cultures exposed to L-AP4 during the incubation in ITSFn medium, a condition in which the increase in nestin and Dlx-2 levels was apparent. There was no change in LDH release when L-AP4 was applied during the 4 days of incubation in ITSFn medium or during the 4 preceding days (86 2 or 85 4% of control LDH release, respectively; means S.E.M.; n ¼ 4) in spite of the different effect of these treatments on neural differentiation (see
Fig. 3. Expression of the early neural markers, Dlx-2 (A) and Nestin (B), in cultured EBs at 4 DIV shifted into ITSFn medium for 4 more days. Cultures were treated with daily with L-AP4 (30 mM) and/or CPPG (100 nM) during the total incubation time (8 days). Representative immunoblots of Dxl-2 and Nestin are shown in the upper part of (A) and (B). Normalized values (see Methods) are expressed as per cent of controls (means SEM) and were calculated from 6 determinations from 3 independent experiments. p < 0.05 vs. controls (CTRL) or L-AP4 alone (#) (One-Way ANOVA þTurkey’s t test).
610
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
4. Discussion
Fig. 4. Same as in Fig. 3, but with L-AP4 being applied during the 4 days preceding the inductive cue (pre-L-AP4) or during the following days of incubation in ITSFn medium (co-L-AP4). Values were calculated from 6 determinations from 2 independent experiments. *p < 0.05 vs. controls (CTRL) (One-Way ANOVA þTurkey’s t test).
above). As a second model of neural induction, we exposed EBs to 4/4þ retinoic acid. Following retinoic acid treatment, cells were cultured for additional 4 days onto an adhesive substrate in the presence of DMEM/F12 medium supplemented with N2. A 12-day treatment with L-AP4 (30 mM), since the first day of EB formation, amplified the expression of Dlx-2. Co-treatment with the mGlu4 antagonist CPPG (100 nM) reduced this effect (Fig. 5A). The same pro-neural effect was observed when L-AP4 was added to the cultures during the 4-day treatment with retinoic acid (Fig. 5B, C). However, L-AP4 had no effect when applied to the cultures before retinoic acid treatment (Fig. 5B).
Differentiation of ES cells into EBs was associated with a switch in the expression of mGlu receptors, characterized by a progressive loss of mGlu5 receptors and the acquisition of mGlu4 receptors. These receptor subtypes are different in terms of G protein coupling, synaptic localization, and transduction pathways. While activation of mGlu5 receptors stimulates polyphosphoinositide hydrolysis with an ensuing oscillatory increase in intracellular Ca2þ (Kawabata et al., 1996), activation of mGlu4 receptors induces pleiotropic effects including inhibition of adenylyl cyclase and activation of the phosphoatidylinositol-3-kinase pathway (Iacovelli et al., 2004). Both pathways are widely implicated in processes of cell proliferation and differentiation. The presence of mGlu4 receptors in differentiating EBs provides one of the few examples of a non-neuronal expression of this particular receptor subtype. Interestingly, mGlu4 receptors are also expressed by P19 embryocarcinoma cells (Heck et al., 1997), which can be considered as a pathological counterpart of EBs. Our data suggest that activation of mGlu4 receptors affects cell fate in a context-dependent manner. Pharmacological activation of mGlu4 receptors in EBs spontaneously differentiating into cells of the three germ layers, drives cell differentiation towards mesoderm and endoderm lineages. In contrast, activation of mGlu4 receptors in EBs exposed to inductive neural cues (i.e. ITSFn medium or retinoic acid) amplifies cells’ commitment towards a neural phenotype. This is reminiscent of data obtained with cerebellar granule cell neuroprogenitors in culture, where pharmacological activation of mGlu4 receptors reduces cell proliferation and promotes cell differentiation into mature neurons (Canudas et al.,
Fig. 5. Expression of Dlx-2 and nestin in cultured EBs at 4 DIV treated for 4 days with 1 mM retinoic acid (RA) and then plated into DMEM/F12 þ N2 medium for 4 more days. In (A) L-AP4 and/or CPPG were applied to the cultures during the whole incubation time (12 days). In (B) L-AP4 was applied either during the 4 initial days (pre-L-AP4) or during the following 4 days in which RA was present (co-L-AP4). In (C) L-AP4 and/or CPPG were applied to the cultures during the 4 days of RA treatment. Values were calculated from 6e9 determinations from 3 independent experiments. p < 0.05 vs. the respective controls (CTRL) (*) or vs. RA alone (#) (One-Way ANOVA þTurkey’s t test).
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
2004). Our results support the emerging idea that the function of mGlu receptors extends beyond the regulation of synaptic transmission and involves basic processes of cell biology, such as proliferation and differentiation of stem/progenitor cells (Canudas et al., 2004; Yoshimizu and Chaki, 2004; Di Giorgi Gerevini et al., 2005; Baskys et al., 2005; Castiglione et al., 2005). Subtype-selective ligands of mGlu receptors might be successfully used for the optimization of protocols aimed at sustaining self-renewal of stem/progenitor cells or implementing the number of cells differentiating towards a specific lineage. To what extent mGlu4 receptors regulate the fate of embryonic stem cells in the early phases of ontogenesis and how they are activated in vivo are unknown. The use of conditional knockout mice or the administration of mGlu4 receptor ligands during restricted time windows in the early pregnancy may help to unravel the physiological role of mGlu4 receptors in embryonic development. References Bain, G., Ray, W.J., Yao, M., Gottlieb, D.I., 1996. Retinoic acid promotes neural and represses mesodermal gene expression in mouse embryonic stem cells in culture. Biochem. Biophys. Res. Commun. 223, 691e694. Baskys, A., Bayazitov, I., Fang, L., Blaabjerg, M., Rom Poulsen, F., Zimmer, J., 2005. Group I metabotropic glutamate receptors reduce excitotoxic injury and may facilitate neurogenesis. Neuropharmacology 49, 146e156. Canudas, A.M., Di Giorni Gerevini, V., Iacovelli, L., Nano, G., D’Onofrio, M., Arcella, A., Giangaspero, F., Buscati, C., Ricci-Vitiani, L., Battaglia, G., Nicoletti, F., Melchiorri, D., 2004. PHCCC, a specific enhancer of type 4 metabotropic glutamate receptors, reduces proliferation and promotes differentiation of cerebellar granule cell neuroprecursors. J. Neurosci. 24, 10343e10352. Cappuccio, I., Spinanti, P., Porcellini, A., Desiderati, F., De Vita, T., Storto, M., Capobianco, L., Battaglia, G., Nicoletti, F., Melchiorri, D., 2005. Endogenous activation of mGlu5 metabotropic glutamate receptors supports self-renewal of cultured mouse embryonic stem cells. Neuropharmacology 1, 196e205. Castiglione, M., Calafiore, M., Blanco, E., Nicoletti, F., Copani, A., 2005. mGlu1 receptor regulates the proliferation rate of adult mouse svz neural
611
progenitor cells growing in culture. Abstract/Neuropharmacology 49, 231e279. De Blasi, A., Conn, P.J., Pin, J., Nicoletti, F., 2001. Molecular determinants of metabotropic glutamate receptor signaling. Trends Pharmacol. Sci. 22, 114e120. Di Giorgi Gerevini, V., Melchiorri, D., Battaglia, G., Ricci-Vitiani, L., Ciceroni, C., Buscati, C.L., Biagioni, F., Iacovelli, L., Canudas, A.M., Parati, E., De Maria, R., Nicoletti, F., 2005. Cell Death Differ. 12, 1124e1133. Doetschman, T.C., Eistetter, H., Katz, M., Schmidt, W., Kemler, R., 1985. J. Embryol. Exp. Morphol. 87, 27e45. Iacovelli, L., Capobianco, L., Iula, M., Di Giorgi Gerevini, V., Picascia, A., Blahos, J., Melchiorri, D., Nicoletti, F., De Blasi, A., 2004. Regulation of mGlu4 metabotropic glutamate receptor signaling by type-2 G-protein coupled receptor kinase (GRK2). Mol. Pharmacol. 65, 1103e1110. Lee, S.H., Lumelsky, N., Studer, L., Auerbach, J.M., McKay, R.D., 2000. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat. Biotechnol. 18, 675e679. Heck, S., Enz, R., Richter-Landsberg, C., Blohm, D.H., 1997. Expression of eight metabotropic glutamate receptor subtypes during neuronal differentiation of P19 embryocarcinoma cells: a study by RT-PCR and in situ hybridization. Brain Res. Dev. Brain Res. 101, 85e91. Kawabata, S., Tsutsumi, R., Kohara, A., Yamaguchi, T., Nakanishi, S., Okada, M., 1996. Control of calcium oscillations by phosphorylation of metabotropic glutamate receptors. Nature 383, 89e92. Okabe, S., Forsberg-Nilsson, K., Spiro, A.C., Segal, M., McKay, R.D.G., 1996. Development of neuronal precursors cells and functional post-mitotic neurons from embryonic stem cells in vitro. Mech. Dev. 59, 89e102. Okada, Y., Shimazaki, T., Sobue, G., Okano, H., 2004. Retinoic acidconcentration-dependent acquisition of neural cell identity during in vitro differentiation of mouse embryonic stem cells. Dev. Biol. 275, 124e142. Robertson, E.J., 1987. Embryo-derived stem cell lines. In: Robertson, E.J. (Ed.), Teratocarcinoma and Embryonic Stem Cells: A Practical Approach. IRL Press, Washington, D.C., pp. 71e112. Rolen, B.A., Lin, H.Y., Knezevic, V., Freund, E., Mummery, C.L., 1994. Expression of TGF-b and their receptors during implantation and organogenesis of the mouse embryo. Dev. Biol. 166, 716e728. Yoshimizu, T., Chaki, S., 2004. Increased cell proliferation in the adult mouse hippocampus following chronic administration of group-II metabotropic glutamate receptor antagonist, MGS0039. Biochem. Biophys. Res. Commun. 315, 493e496.
Context-dependent regulation of embryonic stem cell differentiation by mGlu4 metabotropic glutamate receptors Irene Cappuccio a, Roberta Verani a, Paola Spinsanti a, Cristiano Niccolini a, Roberto Gradini b,c, Santa Costantino a, Ferdinando Nicoletti a,c, Daniela Melchiorri a,* a
Departments of Human Physiology and Pharmacology, University of Rome ‘‘La Sapienza’’, Piazzale Aldo Moro 5, 00185 Rome, Italy b Department of Experimental Medicine, University of Rome ‘‘La Sapienza’’, Piazzale Aldo Moro 5, 00185 Rome, Italy c I.N.M. Neuromed, Pozzilli, Italy Received 13 December 2005; received in revised form 3 May 2006; accepted 3 May 2006
Abstract The mGlu5 receptor is the only metabotropic glutamate receptor subtype expressed by mouse embryonic stem (ES) cells grown under non-differentiating conditions [Cappuccio, I., Spinanti, P. Porcellini, A., Desiderati, F., De Vita, T., Storto, M., Capobianco, L., Battaglia, G., Nicoletti, F., Melchiorri, D., 2005. Endogenous activation of mGlu5 metabotropic glutamate receptors supports self-renewal of cultured mouse embryonic stem cells. Neuropharmacology 1, 196e205]. We now report that ES cells differentiating into embryoid bodies (EBs) progressively lose mGlu5 receptors and begin to express mGlu4 receptors at both mRNA and proteinc level. A 4-day treatment of EBs with the mGlu4 receptor agonist, L-2-amino-4-phosphonobutanoate (L-AP4), increased mRNA levels of the mesoderm marker, brachyury and the endoderm marker, H19, and decreased the expression of the transcript for the primitive ectoderm marker, fibroblast-growth factor-5 (FGF-5). These effects were prevented by the mGlu4 receptor antagonists, a-methylserine-O-phosphate (MSOP). Plating of EBs for 4 days in vitro in ITSFn medium induced cell differentiation towards a neural lineage, as reflected by the expression of the intermediate filament protein, nestin, and the homeobox protein, Dlx-2. Pharmacological activation of mGlu4 receptors during cell incubation in ITSFn medium increased the expression of both neural markers. Similar results were obtained when neural differentiation was induced by exposure of EBs to retinoic acid. These data suggest that differentiation of cultured ES cells is associated with changes in the expression pattern of mGlu receptors and that activation of mGlu4 receptors affects cell differentiation in a context-dependent manner. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Mouse embryonic stem cells; Differentiation; Metabotropic glutamate receptors subtype4; Embryoid bodies
1. Introduction Mouse embryonic stem (ES) cells derived from the inner cell mass of blastocysts undergo extended proliferation in vitro and can repopulate all cell lineages when injected into blastocyststage embryos. This pluripotency of ES cells is reproduced in vitro by a floating culture of ES aggregates termed ‘‘embryoid bodies’’ (EBs). EBs are generated by culturing ES cells in the absence of the cytokine, leukaemia inhibitory
* Corresponding author. Tel.: þ39 06 49912969; fax: þ39 06 4450307. E-mail address: [email protected] (D. Melchiorri). 0028-3908/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuropharm.2006.05.007
factor (LIF), and resemble the normal embryos at the egg cylinder stage (Doetschman et al., 1985; Robertson, 1987). Following several days in vitro (DIV), EBs consist of multiple differentiated cell types including ectodermal, mesodermal and endodermal derivatives. Specific somatic fates may be induced by factors that drive cells to differentiate towards a particular lineage or, alternatively, by plating EBs onto adhesive substrates in the presence of a medium that allows the survival of a selected population of committed cells. Although several protocols have been developed to enhance the production of specific cell phenotypes, little is known on the molecular mechanisms that drive early lineage commitment. Thus, differentiation protocols are empirical and
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
607
yield heterogeneous outcomes. Searching for additional mechanisms controlling the early phases of ES cell differentiation, we focused on metabotropic glutamate (mGlu) receptors, which are involved in the proliferation and survival of both embryonic (Cappuccio et al., 2005) and neural stem cells (Di Giorgi Gerevini et al., 2005), and are shown to influence neurogenesis in hippocampal slices (Baskys et al., 2005). mGlu receptors form a family of eight subtypes classified into three groups on the basis of sequence homology, pharmacological properties and transduction pathways. Group I includes mGlu1 and -5 receptors, which are coupled to a Gq and polyphosphoinositide hydrolysis. Groups II and III (mGlu2, -3 and mGlu4, -6, -7 and -8 receptors, respectively) are negatively coupled to adenylyl cyclase in heterologous expression systems (for a review see De Blasi et al., 2001). We have recently shown that ES cells cultured under non-differentiating conditions (i.e. in the presence of LIF) express functional mGlu5 receptors, the activation of which contributes to the maintenance of the undifferentiated state of cells (Cappuccio et al., 2005). We decided to examine whether ES cell differentiation into EBs is associated with changes in the expression pattern of mGlu receptors and whether receptor activation influences early cell commitment towards specific lineages.
was diluted to 100 ml with sterile, distilled water and 1 ml of cDNA was employed in each subsequent amplification. The following primers were used:
2. Materials and methods
For b-actin amplification, we used the primers described by Rolen et al. (1994), which span an intron and yield products of different sizes depending on whether cDNA or genomic DNA is used as a template (400 bp or 600 bp, respectively). Reaction conditions included an initial denaturation step (94 C/3 min) followed by 45 cycles of 94 C/30 s; 56 C/30 s (mGlu1, -5, -7) or 62 C (mGlu2, -3, -4, -6, -8); 72 C/30 s. A final extension step (72 C/10 min) concluded the reaction. PCR products (1/3 of the reaction) were analyzed electrophoretically on 2% agarose gels poured and run in 1 TAE. Real-time Quantitative PCR was performed using a 2 Supermix cocktail (Biorad) containing the double-stranded DNA binding fluorescent probe Sybr Green and all necessary components except primers. Quantitative PCR conditions included an initial denaturation step of 94 C/10 min followed by 40 cycles of 94 C/15 s and 55 C/15 s. Standards, samples, and negative controls (no template) were analyzed in triplicate. Concentrations of mRNA were calculated from serially diluted standard curves simultaneously amplified with the unknown samples and corrected for b-actin mRNA levels.
2.1. Materials a-Methylserine-O-phosphate (MSOP), L-2-amino-4-phosphonobutanoate (L-AP4), and a-cyclopropyl-4-phosphonophenylglycine (CPPG) were purchased from Tocris Cookson Ltd, UK. DMEM, DMEM-F12, KnockoutDMEM, penicillinestreptomycin, 2-mercaptoethanol, and MEM non-essential amino acid solution were purchased from GIBCO/Life Science, Milan, Italy. Rabbit polyclonal anti-mGlu2/3 antibodies were from Chemicon. Rabbit polyclonal anti-mGlu4, and -mGlu5 antibodies were from Upstate Technology, Milan, Italy. Mouse monoclonal anti-nestin antibodies and rabbit polyclonal anti-Dlx-2 antibodies were from Chemicon. Fluorescent (FITC) conjugated affinity pure anti-rabbit antibodies were from Jackson Immuno Research. The Cytotoxicity Detection Kit (LDH) was purchased from Boehringer Mannheim.
mGlu1: forward, GCTGTACCTACTATGCCTTC; reverse, AGACCATGA CACAGACTTGC; mGlu2: forward, CTACAGTGATGTCTCCATCC; reverse, AAAGCCTC AATGCCTGTCTC; mGlu3: forward, CAAGTGACTACAGAGTGCAG; reverse, CTGTCACC AATGCTCAGCCTC; mGlu4: forward: CCAACGAGGATGACATCAGG; reverse: CACAGGTC ACGGTGCATGG; mGlu5: forward: GTCCTTCTGTTGATCCTGTC; reverse: ATGCAGCAT GGCCTCCACTC; mGlu6: forward, GCCAGTCAGATGATTCCACC; reverse: GCCTGGTA CCTGGAAGATGTC; mGlu7: forward, CCAGATGTGGCAGTGTGTTC; reverse: CGAGTCTT GATGGCATACAC; mGlu8: forward, ATCACCTTCAGCCTCATCTC; reverse: TGTGACCAC AGCCTTGAAGC. FGF-5: forward, GATGCCCACTCTGCAGTACA; reverse: GCGACGTTT TCTTCGTCTTC; H19: forward, GTTCAAGGTAGGGGGAGGAG; reverse: AGAGGACAG AAGGGCAGTCA; Brachyury: forward, TTCTTTGGCATCAAGGAAGG; reverse: TCCCGA GACCCAGTTCATAG; Otx-2: forward, GAAGTTGAGCCAGCATAGCC; reverse: TCTGACCCC TTGTCCACTTC; Nestin: forward, CTACCAGGAGCGCGTGGC; reverse: TCCACAGCC AGCTGGACCTT.
2.2. Cell cultures The embryonic ES-D3 cell line derived from 129/Svþc/þp mouse was purchased from ATCC. ES cells were induced to differentiate by plating onto a nonadhesive substrate in the absence of the cytokine LIF. Under these conditions, cells aggregate into embryoid bodies (EBs) and begin to differentiate. Neural induction was induced (i) by re-plating EBs at 4 DIV onto gelatin-coated dishes in the presence of DMEM/F12 medium supplemented with insulin, transferrin, selenium, fibronectin (ITSFn medium); or (ii) by exposure of EB suspension to all-trans-retinoic acid (1 mM) according to the 4/4þ protocol (i.e. 4 days without and 4 days with retinoic acid), followed by plating onto gelatin-coated dishes and culturing for 4 additional days in serum-free DMEM/F12 medium supplemented with N2.
2.3. RT-PCR analysis Total RNA was extracted from the cultures with Trizol reagent (Invitrogen, Milan, Italy) and subjected to DNAseI treatment (Promega, Italy) according to manufacturer’s instructions. Two micrograms of total RNA were then employed for cDNA synthesis, using Superscript II (BRL Life Tech.) and random examers’ primers according to manufacturer’s instructions. The RT product
2.4. Western blot analysis Western blot analysis was performed as described previously (Iacovelli et al., 2004). Briefly, cells were lysed for 10 min at 4 C in Triton X-100 lysis buffer (10 mM TriseHCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 10 mg/ml leupeptin, 10 mg/ml aprotinin, 1 mM sodium orthovanadate, 50 mM sodium fluoride, and 10 mM b-glycerophosphate). All cell lysates were cleared by centrifugation (10,000 g for 10 min) and 80 mg of proteins were separated by SDS-gel electrophoresis, blotted onto nitrocellulose and probed using different commercial antibodies. Membranes were saturated for 1 h with Tris-buffered saline (TBS; 100 mM Tris, 0.9% NaCl) containing 0.05% Tween 20, 1% bovine serum albumin and 1% non-fat dry milk, and then incubated overnight with primary antibodies. Antibodies were used at the following dilutions: mouse monoclonal anti-Nestin antibodies, 1:200 (BD Bioscience, clone 25); rabbit polyclonal anti-mGlu2/3, -4, and -5 antibodies, 1:1000; rabbit polyclonal anti-Dlx-2 antibodies 1:200. Immunoreactive bands were visualized by enhanced chemiluminescence using horseradish peroxidase-linked secondary antibody. As levels of the housekeeping proteins we have tested (b-actin, GAPDH) changed substantially during differentiation of EBs, densitometric
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
608
values of nestin and Dlx-2 were normalized by the amount of proteins loaded in the gel.
2.5. Detection of cytotoxicity Cytotoxicity was assessed using a commercial kit (Roche). Briefly, about 106 cells/ml were plated in 96-well plates and incubated in ITSFn medium with or without L-AP4 (30 mM), at 37 C. After 24 h, 100 ml of the centrifuged supernatant was collected into a new plate. Following the addition of 100 ml of the reaction mixture containing the catalyst (NADþ is reduced to NADH/Hþ by LDH) and tetrazolium salts, the probe was incubated for additional 30 min at room temperature. The absorbance of the samples was measured at 495 nm using a microplate reader. To determine the percentage of cytotoxicity, the average absorbance values of the probes were calculated and the background control (ITSFn medium without cells) was subtracted; whereby the resulting values were set into the following equation:
Cytotoxicity ð%Þ ¼
experimental sample low control 100 ; high control low control
where low control ¼ LDH activity in the medium of untreated cells (spontaneous LDH release); high control ¼ maximum releasable LDH activity after treating the cultures with 2% Triton X-100 (maximum LDH release). Each assay was performed in triplicate and repeated twice.
2.6. Immunocytochemistry Dissected EBs (18 mm thick slices) were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 5 min. Sections were incubated with blocking buffer (TBS, 0.1% Triton X-100, and 2% normal goat serum) for 30 min followed by incubation with rabbit polyclonal anti-mGlu4 antibody (1:100) in blocking buffer overnight at 4 C. After washing with PBS, the sections were incubated with a fluorescein isothiocynate (FITC)-labeled secondary antibody (goat anti-rabbit IgG1, 1:200). Sections were washed three times with PBS, mounted with mounting media and examined under a confocal microscope (Zeiss, LSM510 laser scanner microscope; Oberkochen, Germany).
3. Results D3 ES cells were plated onto a non-adhering substrate with a serum-containing medium devoid of LIF. Under these conditions, cells aggregated into EBs and started to express specific markers of the three germ layers (see below). Analysis of the transcripts for each mGlu receptor subtype by qualitative RTPCR showed that EBs at 4 DIV expressed mGlu3 and mGlu4 mRNAs, whereas the transcripts of all other receptor subtype were undetectable (Fig. 1A). The absence of mGlu5 mRNA was unexpected because mGlu5 is the only mGlu receptor subtype expressed by undifferentiated ES cells (Cappuccio et al., 2005). We therefore examined the expression kinetics of mGlu receptor proteins in EBs at different DIVs. Levels of mGlu5 receptor protein were still substantial in EBs at 1 DIV, but then progressively decreased and became undetectable at 4 DIV (Fig. 1B). In contrast, expression of mGlu4 receptors increased from 1 to 2 DIV and then remained constant up to 4 DIV (Fig. 1C). The mGlu2/3 receptor protein was undetectable in cultured EBs up to 4 DIV (Fig. 1D). The presence of mGlu4 receptors in EBs was confirmed by immunofluorescence staining with a confocal microscope (Fig. 1E). To unravel the role of mGlu4 receptors in the differentiation program of EB cells, we used the group-III receptor agonist, L-AP4. We adopted this strategy because (i) no other groupIII mGlu receptor subtypes (i.e. mGlu6, -7 or -8) are expressed by EBs; and (ii) the only mGlu4 selective drug available (i.e. PHCCC) could not be used for the effect of the lipid solvent on cell differentiation. We carried out a quantitative analysis of the mRNA of the following molecular markers of the three germ layers: the mesoderm marker, brachyury; the endoderm marker, H19; the primitive ectoderm marker, FGF-5; and the early neuroectoderm marker, Otx-2. A 4-day treatment of EBs with L-AP4 (30 mM, applied every day) increased the
Fig. 1. RT-PCR analysis of mGlu receptor subtypes in cultured EBs at 4 DIV is shown in (A). Mouse cerebral cortex (CTX) and cerebellum (CBL) are used as positive controls; Western blot analysis of mGlu5, mGlu4, and mGlu2/3 receptors is shown in (B), (C), and (D), respectively. Protein lysates from the cerebral cortex (CTX) of wild type (þ/þ) or mGlu5 knockout mice (/) or from the mouse cerebellum (CBL) were also loaded as positive controls. Confocal, immunofluorescence analysis of mGlu4 receptors in EBs at 4 DIV is shown in (E).
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
609
Fig. 2. Real-time PCR analysis of the transcripts for the mesoderm marker, brachyury (Brachy), the endoderm marker H19, the primitive ectoderm marker FGF-5, and the neuroectoderm marker Otx-2 in cultured EBs exposed for 4 days to L-AP4 (30 mM) and/or MSOP (200 mM) is shown. Note that activation of mGlu4 receptors increased the expression of Brachyury and H19 mRNA, and decreased the expression of FGF-5 mRNA. Data are means SEM of 6 determinations from two independent experiments. p < 0.05 vs. controls (CTRL) (One-Way ANOVA þTurkey’s t test).
expression of brachyury and H19 mRNA, and decreased the expression of FGF-5 mRNA. No significant changes in Otx2 mRNA were induced by L-AP4 (Fig. 2). These effects were prevented by the mGlu4 receptor antagonists, MSOP (200 mM), which was inactive by itself (Fig. 2). We next examined whether activation of mGlu4 receptors could affect lineage commitment under conditions that favour differentiation towards a neural phenotype. We selected two models of neural induction: (i) plating of EBs at 4 DIV onto gelatincoated dishes in the presence of the ITSFn medium, which is known to select nestin-positive cells from differentiating EBs (Okabe et al., 1996; Lee et al., 2000); and (ii) exposure of EBs to a 4/4þ day treatment with all-trans-retinoic acid (1 mM) followed by plating onto an adhesive substrate and culturing in DMEM/F12 supplemented with N2 (Bain et al., 1996; Okada et al., 2004). In the first model of neural induction, EB cells cultured for 4 days in ITSFn medium expressed the homeobox Dlx-2 and the intermediate filament protein nestin, which are both markers of neural precursor cells (Fig. 3A, B). A daily addition of L-AP4 (30 mM) for 8 days (4 days without and 4 days with the ITSFn medium), induced a 3-fold increase in
the levels of nestin and Dlx-2 proteins (Fig. 3A, B). This increase was reduced by co-application of the group-III mGlu receptor antagonists, CPPG (100 nM) (Fig. 3A, B). To define the temporal window of the effect of L-AP4, we applied the drug either during the 4 days preceding neural induction or during the 4 days in which cells were incubated with the ITSFn medium. L-AP4 amplified Dlx-2 expression only when combined with the ITSFn medium (Fig. 4). Incubation in ITSFn medium enriches EB cultures of neural precursor cells by providing a non-permissive environment for the survival of nestin-negative cells (Okabe et al., 1996). We therefore wondered whether the L-AP4-induced increase in the expression of nestin and Dlx-2 was a consequence of an increased cell survival. We assessed cell damage by monitoring the release of LDH in cultures exposed to L-AP4 during the incubation in ITSFn medium, a condition in which the increase in nestin and Dlx-2 levels was apparent. There was no change in LDH release when L-AP4 was applied during the 4 days of incubation in ITSFn medium or during the 4 preceding days (86 2 or 85 4% of control LDH release, respectively; means S.E.M.; n ¼ 4) in spite of the different effect of these treatments on neural differentiation (see
Fig. 3. Expression of the early neural markers, Dlx-2 (A) and Nestin (B), in cultured EBs at 4 DIV shifted into ITSFn medium for 4 more days. Cultures were treated with daily with L-AP4 (30 mM) and/or CPPG (100 nM) during the total incubation time (8 days). Representative immunoblots of Dxl-2 and Nestin are shown in the upper part of (A) and (B). Normalized values (see Methods) are expressed as per cent of controls (means SEM) and were calculated from 6 determinations from 3 independent experiments. p < 0.05 vs. controls (CTRL) or L-AP4 alone (#) (One-Way ANOVA þTurkey’s t test).
610
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
4. Discussion
Fig. 4. Same as in Fig. 3, but with L-AP4 being applied during the 4 days preceding the inductive cue (pre-L-AP4) or during the following days of incubation in ITSFn medium (co-L-AP4). Values were calculated from 6 determinations from 2 independent experiments. *p < 0.05 vs. controls (CTRL) (One-Way ANOVA þTurkey’s t test).
above). As a second model of neural induction, we exposed EBs to 4/4þ retinoic acid. Following retinoic acid treatment, cells were cultured for additional 4 days onto an adhesive substrate in the presence of DMEM/F12 medium supplemented with N2. A 12-day treatment with L-AP4 (30 mM), since the first day of EB formation, amplified the expression of Dlx-2. Co-treatment with the mGlu4 antagonist CPPG (100 nM) reduced this effect (Fig. 5A). The same pro-neural effect was observed when L-AP4 was added to the cultures during the 4-day treatment with retinoic acid (Fig. 5B, C). However, L-AP4 had no effect when applied to the cultures before retinoic acid treatment (Fig. 5B).
Differentiation of ES cells into EBs was associated with a switch in the expression of mGlu receptors, characterized by a progressive loss of mGlu5 receptors and the acquisition of mGlu4 receptors. These receptor subtypes are different in terms of G protein coupling, synaptic localization, and transduction pathways. While activation of mGlu5 receptors stimulates polyphosphoinositide hydrolysis with an ensuing oscillatory increase in intracellular Ca2þ (Kawabata et al., 1996), activation of mGlu4 receptors induces pleiotropic effects including inhibition of adenylyl cyclase and activation of the phosphoatidylinositol-3-kinase pathway (Iacovelli et al., 2004). Both pathways are widely implicated in processes of cell proliferation and differentiation. The presence of mGlu4 receptors in differentiating EBs provides one of the few examples of a non-neuronal expression of this particular receptor subtype. Interestingly, mGlu4 receptors are also expressed by P19 embryocarcinoma cells (Heck et al., 1997), which can be considered as a pathological counterpart of EBs. Our data suggest that activation of mGlu4 receptors affects cell fate in a context-dependent manner. Pharmacological activation of mGlu4 receptors in EBs spontaneously differentiating into cells of the three germ layers, drives cell differentiation towards mesoderm and endoderm lineages. In contrast, activation of mGlu4 receptors in EBs exposed to inductive neural cues (i.e. ITSFn medium or retinoic acid) amplifies cells’ commitment towards a neural phenotype. This is reminiscent of data obtained with cerebellar granule cell neuroprogenitors in culture, where pharmacological activation of mGlu4 receptors reduces cell proliferation and promotes cell differentiation into mature neurons (Canudas et al.,
Fig. 5. Expression of Dlx-2 and nestin in cultured EBs at 4 DIV treated for 4 days with 1 mM retinoic acid (RA) and then plated into DMEM/F12 þ N2 medium for 4 more days. In (A) L-AP4 and/or CPPG were applied to the cultures during the whole incubation time (12 days). In (B) L-AP4 was applied either during the 4 initial days (pre-L-AP4) or during the following 4 days in which RA was present (co-L-AP4). In (C) L-AP4 and/or CPPG were applied to the cultures during the 4 days of RA treatment. Values were calculated from 6e9 determinations from 3 independent experiments. p < 0.05 vs. the respective controls (CTRL) (*) or vs. RA alone (#) (One-Way ANOVA þTurkey’s t test).
I. Cappuccio et al. / Neuropharmacology 51 (2006) 606e611
2004). Our results support the emerging idea that the function of mGlu receptors extends beyond the regulation of synaptic transmission and involves basic processes of cell biology, such as proliferation and differentiation of stem/progenitor cells (Canudas et al., 2004; Yoshimizu and Chaki, 2004; Di Giorgi Gerevini et al., 2005; Baskys et al., 2005; Castiglione et al., 2005). Subtype-selective ligands of mGlu receptors might be successfully used for the optimization of protocols aimed at sustaining self-renewal of stem/progenitor cells or implementing the number of cells differentiating towards a specific lineage. To what extent mGlu4 receptors regulate the fate of embryonic stem cells in the early phases of ontogenesis and how they are activated in vivo are unknown. The use of conditional knockout mice or the administration of mGlu4 receptor ligands during restricted time windows in the early pregnancy may help to unravel the physiological role of mGlu4 receptors in embryonic development. References Bain, G., Ray, W.J., Yao, M., Gottlieb, D.I., 1996. Retinoic acid promotes neural and represses mesodermal gene expression in mouse embryonic stem cells in culture. Biochem. Biophys. Res. Commun. 223, 691e694. Baskys, A., Bayazitov, I., Fang, L., Blaabjerg, M., Rom Poulsen, F., Zimmer, J., 2005. Group I metabotropic glutamate receptors reduce excitotoxic injury and may facilitate neurogenesis. Neuropharmacology 49, 146e156. Canudas, A.M., Di Giorni Gerevini, V., Iacovelli, L., Nano, G., D’Onofrio, M., Arcella, A., Giangaspero, F., Buscati, C., Ricci-Vitiani, L., Battaglia, G., Nicoletti, F., Melchiorri, D., 2004. PHCCC, a specific enhancer of type 4 metabotropic glutamate receptors, reduces proliferation and promotes differentiation of cerebellar granule cell neuroprecursors. J. Neurosci. 24, 10343e10352. Cappuccio, I., Spinanti, P., Porcellini, A., Desiderati, F., De Vita, T., Storto, M., Capobianco, L., Battaglia, G., Nicoletti, F., Melchiorri, D., 2005. Endogenous activation of mGlu5 metabotropic glutamate receptors supports self-renewal of cultured mouse embryonic stem cells. Neuropharmacology 1, 196e205. Castiglione, M., Calafiore, M., Blanco, E., Nicoletti, F., Copani, A., 2005. mGlu1 receptor regulates the proliferation rate of adult mouse svz neural
611
progenitor cells growing in culture. Abstract/Neuropharmacology 49, 231e279. De Blasi, A., Conn, P.J., Pin, J., Nicoletti, F., 2001. Molecular determinants of metabotropic glutamate receptor signaling. Trends Pharmacol. Sci. 22, 114e120. Di Giorgi Gerevini, V., Melchiorri, D., Battaglia, G., Ricci-Vitiani, L., Ciceroni, C., Buscati, C.L., Biagioni, F., Iacovelli, L., Canudas, A.M., Parati, E., De Maria, R., Nicoletti, F., 2005. Cell Death Differ. 12, 1124e1133. Doetschman, T.C., Eistetter, H., Katz, M., Schmidt, W., Kemler, R., 1985. J. Embryol. Exp. Morphol. 87, 27e45. Iacovelli, L., Capobianco, L., Iula, M., Di Giorgi Gerevini, V., Picascia, A., Blahos, J., Melchiorri, D., Nicoletti, F., De Blasi, A., 2004. Regulation of mGlu4 metabotropic glutamate receptor signaling by type-2 G-protein coupled receptor kinase (GRK2). Mol. Pharmacol. 65, 1103e1110. Lee, S.H., Lumelsky, N., Studer, L., Auerbach, J.M., McKay, R.D., 2000. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat. Biotechnol. 18, 675e679. Heck, S., Enz, R., Richter-Landsberg, C., Blohm, D.H., 1997. Expression of eight metabotropic glutamate receptor subtypes during neuronal differentiation of P19 embryocarcinoma cells: a study by RT-PCR and in situ hybridization. Brain Res. Dev. Brain Res. 101, 85e91. Kawabata, S., Tsutsumi, R., Kohara, A., Yamaguchi, T., Nakanishi, S., Okada, M., 1996. Control of calcium oscillations by phosphorylation of metabotropic glutamate receptors. Nature 383, 89e92. Okabe, S., Forsberg-Nilsson, K., Spiro, A.C., Segal, M., McKay, R.D.G., 1996. Development of neuronal precursors cells and functional post-mitotic neurons from embryonic stem cells in vitro. Mech. Dev. 59, 89e102. Okada, Y., Shimazaki, T., Sobue, G., Okano, H., 2004. Retinoic acidconcentration-dependent acquisition of neural cell identity during in vitro differentiation of mouse embryonic stem cells. Dev. Biol. 275, 124e142. Robertson, E.J., 1987. Embryo-derived stem cell lines. In: Robertson, E.J. (Ed.), Teratocarcinoma and Embryonic Stem Cells: A Practical Approach. IRL Press, Washington, D.C., pp. 71e112. Rolen, B.A., Lin, H.Y., Knezevic, V., Freund, E., Mummery, C.L., 1994. Expression of TGF-b and their receptors during implantation and organogenesis of the mouse embryo. Dev. Biol. 166, 716e728. Yoshimizu, T., Chaki, S., 2004. Increased cell proliferation in the adult mouse hippocampus following chronic administration of group-II metabotropic glutamate receptor antagonist, MGS0039. Biochem. Biophys. Res. Commun. 315, 493e496.