- Email: [email protected]
Contribution of flagella and invasion proteins to pathogenesis of Salmonella enterica serovar enteritidis in chicks
FEMS Microbiology Letters 204 (2001) 287^291
www.fems-microbiology.org
Contribution of £agella and invasion proteins to pathogenesis of Salmonella enterica serovar enteritidis in chicks Craig T. Parker, Jean Guard-Petter * United States Department of Agriculture, ARS-SEPRL, 934 College Station Road, Athens, GA 30605, USA Received 12 February 2001; received in revised form 20 July 2001; accepted 22 August 2001 First published online 11 October 2001
Abstract To explore the relative contribution that flagella and Salmonella invasion proteins make to the virulence of Salmonella enteritidis in poultry, 20-day-old chicks were challenged orally and by subcutaneous injection with wild-type strain SE-HCD, two non-flagellated mutants (fliC: :Tn10 mutant and flhD: :Tn10 mutant) and two Salmonella invasion protein insertion mutants (sipD and iacP). When injected subcutaneously, wild-type SE-HCD was the only strain to cause substantial mortality and morbidity and to grow well in organs. The flhD mutant of SE-HCD was invasive when given orally, whereas wild-type SE-HCD and the fliC mutant were significantly attenuated. Salmonella invasion protein mutants were not invasive by either route. These results suggest that temporary suppression of Class I regulators of flagellin biosynthesis may aid oral infection in poultry. ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Flagella ; Invasion; Chicken ; Egg; Salmonella
1. Introduction Salmonella enterica serovar enteritidis (Salmonella enteritidis) is a major cause of human food-borne illness, due in part to its ability to infect poultry and to contaminate eggs [1,2]. Virulence characterization of invasive S. enteritidis has highlighted that £agellation is one of several distinguishing virulence markers in poultry [3,4]. However, there is evidence against £agellation as an important virulence factor for S. enterica [5]. Signi¢cantly, the egg-contaminating serotype Salmonella pullorum/gallinarum is highly pathogenic for birds, but lacks £agella and is non-motile [6]. Some investigations report that loss of £agellation might be associated with increased production of virulence factors [7], but surface migration by hyper£agellated swarm cells has also been associated with virulence in other Gram-negative bacteria including Salmonella [8,9]. Although it is not clear from these studies the degree to which £agella contributes to virulence in poultry, the liter-
* Corresponding author. Tel. : +1 (706) 546 3446; Fax: +1 (706) 546 3161. E-mail address : [email protected] (J. Guard-Petter).
ature provides ample evidence for the importance of large arrays of virulence genes encoding Salmonella invasion proteins (SIPs) located in the Salmonella pathogenicity islands (SPI) [10,11]. To further understand how virulence factors contribute to egg contamination, and especially to further address the role of £agella in birds, we compared the relative ability of £agella and SIP mutants of S. enteritidis to infect 20-day-old chicks following oral and subcutaneous challenge. 2. Materials and methods 2.1. Description of wild-type S. enteritidis S. enteritidis SE-HCD (phage type 13a) is a wild-type strain that has been characterized for virulence attributes in chicks [12,13]. It has a propensity to hyper£agellate [14], to be parenterally adapted [15], to produce unusual lipopolysaccharide O-chain structures [16], and to grow to high cell density in culture [14]. It is moderately invasive when given orally as compared to some strains of S. enteritidis, but it grows to high numbers in spleens [15]. In addition to the large 37-kb Salmonella virulence plasmid, SE-HCD also has a bioluminescence reporter plasmid
0378-1097 / 01 / $20.00 ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 0 1 ) 0 0 4 1 2 - 8
FEMSLE 10160 5-11-01
288
C.T. Parker, J. Guard-Petter / FEMS Microbiology Letters 204 (2001) 287^291
lacking luxI, which will produce luciferase in correlation with growth to high cell density in broth culture [13]. 2.2. Description of £agellar transposon mutants A Salmonella typhimurium £hD: :Tn10 mutant [17] was obtained from V. Koronakis, Cambridge University, UK, and a S. typhimurium £iC : :Tn10 mutant [14] from A. O'Brien, F.E. Herbert School of Medicine. The £hD: :Tn10 and £iC: :Tn10 mutations were introduced into S. enteritidis from S. typhimurium by P22HT-int transductions using standard techniques [18]. All tetracycline resistant transductants were non-motile in soft agar and did not swarm under growth conditions that aid £agellation [14] (data not shown). The location of transposons within targeted £iC and £hD genes was con¢rmed by polymerase chain reaction (PCR) ampli¢cation of wild-type and mutant chromosomal DNA using upper and lower wild-type primer pairs and a Tn10 identifying primer as listed below (Medline accession numbers and GenBank identi¢cation follows sequence) (Fig. 1): £hDU, GTTGGTTATTCTGGATGGGAA; £hDL, CGCTGCTGGAGTGTTTGT (Medicine accession number: AFO29300, GenBank identi¢cation: 2772916); £iCU, GGCAATCTGGAGGCAAAGTTTA ; £iCL, ACCACGTGTCGGTGAATCAATC (Medicine accession number: D13689, GenBank identi¢cation: 217062); Tn10Rout, ACCACGTGTCGGTGAATCAATC (Medicine accession number: AF223162, GenBank identi¢cation: 7739612). Fine map analysis of chromosomal DNA obtained from wild-type and its £iC and £hD mutants showed that laboratory manipulations did not introduce unexpected genomic rearrangements, because these three strains had indistinguishable patterns and remained genetically similar to other clinical and veterinary isolates from disparate sources that were phage type 13a [19]. Growth curves were conducted to assess growth rates of wild-type SEHCD and its £iC and £hD mutants. The £hD mutant of SE-HCD grew to approximately twice the cell density as either wild-type or the £iC mutant in tryptone broth, which is an expected consequence of mutation because cells from £hD mutants are shorter than wild-type [20,21]. 2.3. Construction of sipD and iacP mutants To create the sipD mutant, a 1.1-kb fragment harboring the sipD gene was ampli¢ed via PCR from S. typhimurium utilizing primer sipD25 (5P-ATCTAT ACGCCATCATGGGTG T-3P) and primer sipD1173 (5P-TGATCTCGGTCTGCATACCTG-3P) (GenBank accession number : U40013). Next, we TA cloned the PCR-generated fragment into pGEM-T (Promega). To create an insertional mutation, this recombinant plasmid was opened at a unique BglII site within sipD and a BamHI fragment containing a kan cassette from pUC-4K was ligated into this site. The sipD: :kan fragment was then excised from
pGEM-T using SphI and SacI and subcloned into pCVD442 [22], a positive selection suicide vector. For the iacP mutant, a three-step PCR procedure was performed. In the ¢rst two steps of PCR, a 419-bp fragment containing the 5P-end of the iacP gene was ampli¢ed with primers iacP1866 (5P-TAAAGAGTGCAGCGTTGA-3P) and iacP2285L (5P-AGCGTAAAGATCTT CAACCAGATG-3P), and a 527-bp fragment containing the 3P-end of the iacP gene was ampli¢ed with primers iacP2285U (5P-CATCTGGTTGAAGATCTTTACGCT-3P) and iacP2812L (5P-TAAACCC AATTTCTCACC A-3P). The resulting products were gel puri¢ed using QIAquick gel extraction (Qiagen, Valencia, CA, USA) and then used together in a third step of overlapping extension PCR using primers iacP1866 and iacP2816 to produce a 946bp fragment that was TA cloned into pGEM-T. To create an insertional mutation, this recombinant plasmid was opened at a unique BglII site within iacP created by primers iacP2285 (site underlined) and a BamHI fragment containing a kan cassette from pUC-4K was ligated into this site. The iacP: :kan fragment was then excised from pGEM-T using SphI and SacI and subcloned into pCVD442. These suicide plasmids were subsequently transformed into Escherichia coli SM10Vpir and mated to SE6-E21. To enrich for bacteria that had resolved the integrated plasmid, conjugants were grown in LB without antibiotics followed by plating on LB containing 5% sucrose and no salt, and incubation overnight at 30³C to select for the loss of the sacB-containing plasmid. Isolated colonies were then screened for the loss of the plasmid-encoded ampicillin resistance and the acquisition of kanamycin resistance. The chromosomal mutation was veri¢ed by PCR. Finally, the mutation was transduced by P22HT-int into SE-HCD as described [23]. Insertion of the kanamycin cassette into the targeted gene in SE-HCD was con¢rmed by detection of a PCR product that was larger than wildtype (Fig. 1). Growth characteristics of SIP mutants were similar to those of wild-type. 2.4. Preparation of cultures for challenge of 20-day-old chicks Challenge inocula were prepared by incubating SEHCD and mutants for 16 h at 37³C without shaking, followed by shaking for 3 h at rpm setting of 8 on a New Brunswick Model G76, which resulted in an 1/10 OD600 of 0.4 and lux reading of 52U103 lux units (Turner luminometer). These conditions indicated that cells were in the early stage of high cell density growth [13]. Dosage was determined by serial 10-fold dilutions of cells on BG agar and then incubating plates at 37³C for 16 h before counting colony-forming units (CFU). Final average dose per chick was 5.1 þ 0.4U106 CFU for all strains. Chicks from a speci¢c pathogen free £ock were challenged orally and subcutaneously by injection in separate experiments.
FEMSLE 10160 5-11-01
C.T. Parker, J. Guard-Petter / FEMS Microbiology Letters 204 (2001) 287^291
289
Relative virulence of strains was determined by measuring mortality and morbidity, by determining if spleens were culture positive, and by counting CFU of salmonellae in the spleens of surviving chicks 3 days post-inoculation as previously described [12]. 2.5. Statistical analyses A 10-fold di¡erence in recovery of the average CFU per spleen from groups of 8^10 chicks has been noted before to be signi¢cant as analyzed by t-test and cluster analysis, even when standard deviations were large [12]. Cluster analysis of chick spleen counts, which is shown in Table 1 as a ranking of data, is an e¡ective method for dealing with wide standard deviations [24]. Cluster analysis is considered a more stringent method for analyzing the signi¢cance of data sets that are composed of mixed subpopulations and non-random data distribution patterns, whereas t-test analysis is best suited for analysis of variation occurring within a single population where selection of data at random followed by ranking will produce a single bell curve [24^26]. At P values of 0.1 or less, results from t-test analysis of data for signi¢cance agree with results obtained by using cluster analysis, and thus values equal to or less than 0.1 are considered to indicate signi¢cance. S. enteritidis is known to exist in culture as mixed subpopulations that when separated have di¡erent virulence potentials in birds [12,15,27^30]. For these reasons, both t-test and cluster analyses of spleen counts are provided in Table 1 to substantiate the signi¢cance of the di¡erences seen between strains (Table 1). 3. Results 3.1. Results from oral challenge of 20-day-old chicks SE-HCD was moderately invasive when infection was
Fig. 1. Con¢rmation of placement of the Tn10 transposon and the kanamycin resistance cassette into respective £agella and SIP genes of S. enteritidis. Shown are electrophoresed PCR products following hybridization of chromosomal DNA from appropriate strains to the following pairs of primers: Lanes 1 and 12, MW markers; lane 2, HCD-£iCU/ £iCL; lane 3, HCD£iC : :Tn10-£iCU/£iCL ; lane 4, HCD£iC : :Tn10-£iCU/Tn10Rout; lane 5, HCD-£hDU/£hDL ; lane 6, HCD£hD: :Tn10£hDU/£hDL; lane 7, HCD£hD: :Tn10-£hDU/Tn10Rout ; lane 8, HCDiacPU/L ; lane 9, HCDiacP: :kan-iacPU/L; lane 10, HCD-sipDU/L; lane 11, HCDsipD: :kan-sipDU/L.
by the oral route (60% positive spleens), but yielded only low numbers of CFU in those spleens that were positive (average 13 CFU per spleen) (Table 1). The £iC mutant was similar to wild-type (60% positive spleens, average of 25 CFU per spleen), indicating that the presence of £agellin was not necessary to achieve at least a moderate level of oral invasion. In comparison, the £hD mutant yielded a higher percentage of positive spleens (89%) and CFU counts per spleen were two logs higher than what was obtained by oral infection of chicks with wild-type or the £iC mutant (2295 CFU per spleen) (Table 1). Mutation of sipD and iacP nearly eliminated oral invasiveness in chicks, which left too few positive spleens for further statistical analysis (Table 1). Cluster analysis indicated that £hD SE-HCD had substantial population heterogene-
Table 1 Challenge of 20-day-old chicks with SIP and £agellar mutants of S. enteritidis Virulence parameter
Number of chicks challenged % Morbidity/mortality % Positive spleens (number positive/number survivors) Average CFU per positive spleen (U103 ) t-Test P value Cluster analysis of spleen counts (CFU) % 6 104 % 105 % 106 % 107 % s 108 a
Oral
Subcutaneous
SE-HCD
£iC
£hD
sipD
iacP
SE-HCD
£iC
£hD
sipD
iacP
10 0 60 (6/10)
10 0 60 (6/10)
10 10 89 (8/9)
10 0 0 (0/10)
10 0 10 (1/10)
10 40 100 (8/8)
8 0 100 (8/8)
8 0 100 (8/8)
10 10 100 (9/9)
10 10 100 (9/9)
13
25
2295
naa
na
6650
815
223
90
40
^
0.20
0.07
na
na
^
0.09
0.08
0.07
0.07
100.0 0.0 0.0 0.0 0.0
100.0 0.0 0.0 0.0 0.0
25.0 25.0 37.5 12.5 0.0
na na na na na
na na na na na
37.5 25.0 12.5 0.0 25.0
0.0 62.5 37.5 0.0 0.0
50.0 50.0 0.0 0.0 0.0
66.7 33.3 0.0 0.0 0.0
88.9 11.1 0.0 0.0 0.0
Na, not analyzed because fewer than three positive spleens were recovered.
FEMSLE 10160 5-11-01
290
C.T. Parker, J. Guard-Petter / FEMS Microbiology Letters 204 (2001) 287^291
ity, which is demonstrated as placement of spleen counts for individual chicks in four of ¢ve clusters (Table 1). Thus, it appears that the absence of FlhD (and possibly other Class I regulatory components of the £hDC operon) rather than the absence of motility or £agellin enhanced the oral invasiveness of SE-HCD (Table 1). While P22 transduction might have inadvertently transferred a genetic change from one serovar to the other that could have a¡ected results, we could ¢nd no evidence that this was probable. The parent S. typhimurium strains used to transfer mutation to SE-HCD are well-characterized and available chromosomal databases of S. typhimurium and S. enteritidis reveal no signi¢cant di¡erences in genetic sequence where mutations were targeted [17,31]. Construction of £agellar mutants in a di¡erent phage type of S. enteritidis resulted in a similar result, which was that £hD S. enteritidis was more virulent than wild-type when given orally (data not shown). Overall these results strongly suggest that oral invasiveness is a stage in the infectious process in chicks that requires SIPs and that appears to be enhanced by the absence of the Class I regulator FlhD.
¢nding that the absence of FlhD enhanced oral invasiveness in these experiments suggests that the advantages to the pathogen associated with £agellation and motility are limited in scope in birds. In contrast, SIP proteins appear to be as essential for invasiveness in birds as they are in mammals. Thus, avian-adapted non-motile salmonellae may have evolved to optimize oral colonization at the expense of narrowing host range to birds, whereas motile salmonellae retain £agellation perhaps to aid productive infection with a wider range of hosts. There is evidence that some salmonellae strains that are serotyped as S. pullorum may actually be S. enteritidis strains that have suppressed £agellation [14,37]. Thus, it is conceivable that human illness from S. enteritidis could have increased when an avian-adapted subpopulation with enhanced oral invasiveness emerged on-farm. However, this type of subpopulation has not yet been identi¢ed in a research setting. Further investigation is in progress to determine if £hD S. enteritidis aids the process of egg contamination in experimentally infected hens.
3.2. Results from subcutaneous challenge of 20-day-old chicks
References
When challenge was by the subcutaneous route, all mutants were signi¢cantly attenuated in comparison to wildtype SE-HCD, as determined by average CFU spleen counts and by observing a narrowing in the spread of data across clusters (Table 1). SE-HCD was the only strain that produced considerable mortality and morbidity in chicks (de¢ned as illness likely leading to death within the next 24 h). In addition, SE-HCD injected subcutaneously produced the highest spleen counts in two of eight chicks (Table 1: counts greater than 108 CFU per spleen). All mutants had a narrower range of CFU recovered from spleens than did wild-type, which suggests that mutation in general limits subpopulation variability that aids growth in spleens (Table 1). Mutation of SIP genes appeared to be more attenuating than mutation of £agellar genes, because a lack of SIPs resulted in the largest decrease in the number of CFU recovered from spleens following subcutaneous challenge (Table 1). 4. Discussion Two types of £agellar mutants were made, because £agellar biosynthesis is a complex process requiring a hierarchy of genes located in three di¡erent classes of operons [17,32] and both a Class I master operon mutant and a Class III mutant would be non-£agellated and hence nonmotile. However, £uctuations in Class I regulators of £agellin biosynthesis are known to greatly a¡ect cellular development and hence virulence of Salmonella and other Gram-negative pathogens [10,20,21,33^36]. The surprising
[1] St. Louis, M.E., Morse, D.L., Potter, M.E., DeMel¢, T.M., Guzewich, J.J., Tauxe, R.V. and Blake, P.A. (1988) The emergence of grade A eggs as a major source of Salmonella enteritidis infections. New implications for the control of salmonellosis [see comments]. J. Am. Med. Assoc. 259, 2103^2107. [2] Timoney, J.F., Shivaprasad, H.L., Baker, R.C. and Rowe, B. (1989) Egg transmission after infection of hens with Salmonella enteritidis phage type 4. Vet. Rec. 125, 600^601. [3] Allen-Vercoe, E. and Woodward, M.J. (1999) The role of £agella, but not ¢mbriae, in the adherence of Salmonella enterica serotype Enteritidis to chick gut explant. J. Med. Microbiol. 48, 771^780. [4] Allen-Vercoe, E., Sayers, A.R. and Woodward, M.J. (1999) Virulence of Salmonella enterica serotype Enteritidis a£agellate and a¢mbriate mutants in a day-old chick model. Epidemiol. Infect. 122, 395^402. [5] Lockman, H.A. and Curtiss, R.D. (1990) Salmonella typhimurium mutants lacking £agella or motility remain virulent in BALB/c mice. Infect. Immun. 58, 137^143. [6] Shivaprasad, H.L. (2000) Fowl typhoid and pullorum disease [in process citation]. Rev. Sci. Tech. 19, 405^424. [7] Gardel, C.L. and Mekalanos, J.J. (1996) Alterations in Vibrio cholerae motility phenotypes correlate with changes in virulence factor expression. Infect. Immun. 64, 2246^2255. [8] Allison, C., Lai, H.C. and Hughes, C. (1992) Co-ordinate expression of virulence genes during swarm-cell di¡erentiation and population migration of Proteus mirabilis. Mol. Microbiol. 6, 1583^1591. [9] Flanary, P.L., Allen, R.D., Dons, L. and Kathariou, S. (1999) Insertional inactivation of the Listeria monocytogenes cheYA operon abolishes response to oxygen gradients and reduces the number of £agella. Can. J. Microbiol. 45, 646^652. [10] Galan, J.E. (1996) Molecular genetic bases of Salmonella entry into host cells. Mol. Microbiol. 20, 263^271. [11] Collazo, C.M. and Galan, J.E. (1997) The invasion-associated type III system of Salmonella typhimurium directs the translocation of Sip proteins into the host cell. Mol. Microbiol. 24, 747^756. [12] Guard-Petter, J., Lakshmi, B., Carlson, R. and Ingram, K. (1995) Characterization of lipopolysaccharide heterogeneity in Salmonella enteritidis by an improved gel electrophoresis method. Appl. Environ. Microbiol. 61, 2845^2851.
FEMSLE 10160 5-11-01
C.T. Parker, J. Guard-Petter / FEMS Microbiology Letters 204 (2001) 287^291 [13] Guard-Petter, J. (1998) Variants of smooth Salmonella enterica serovar Enteritidis that grow to higher cell density than the wild type are more virulent. Appl. Environ. Microbiol. 64, 2166^2172. [14] Guard-Petter, J. (1997) Induction of £agellation and a novel agarpenetrating £agellar structure in Salmonella enterica grown on solid media: possible consequences for serological identi¢cation. FEMS Microbiol. Lett. 149, 173^180. [15] Guard-Petter, J., Keller, L.H., Rahman, M.M., Carlson, R.W. and Silvers, S. (1996) A novel relationship between O-antigen variation, matrix formation, and invasiveness of Salmonella enteritidis. Epidemiol. Infect. 117, 219^231. [16] Parker, C.T., Liebana, E., Henzler, D.J. and Guard-Petter, J. (2001) Lipopolysaccharide O-antigen microheterogeneity of Salmonella serotypes Enteritidis and Typhimurium. Environ. Microbiol., to appear. [17] Kutsukake, K. (1997) Autogenous and global control of the £agellar master operon, £hD, in Salmonella typhimurium. Mol. Gen. Genet. 254, 440^448. [18] Davis, R.W., Botstein, D. and Roth, J.R. (1980) Advanced Bacterial Genetics: A Manual for Genetic Engineering. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [19] Liebana, E., Garcia-Migura, L., Guard-Petter, J., McDowell, S., Rankin, S., Opitz, M. and Davies, R.H. (2001) Salmonella enterica sero-type Enteritidis phage types 4, 7, 6, 8, 13a, 29, and 34: A comparative analysis of genomic ¢ngerprints from geographically distant isolates. J. Appl. Microbiol., in press. [20] Pruss, B.M. and Matsumura, P. (1996) A regulator of the £agellar regulon of Escherichia coli, £hD, also a¡ects cell division. J. Bacteriol. 178, 668^674. [21] Pruss, B.M., Markovic, D. and Matsumura, P. (1997) The Escherichia coli £agellar transcriptional activator £hD regulates cell division through induction of the acid response gene cadA. J. Bacteriol. 179, 3818^3821. [22] Donnenberg, M.S. and Kaper, J.B. (1991) Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59, 4310^4317. [23] Maloy, S., Stewart, V. and Taylor, R. (1996) Genetic Analysis of Pathogenic Bacteria. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [24] Guard-Petter, J., Henzler, D.J., Rahman, M.M. and Carlson, R.W. (1997) On-farm monitoring of mouse-invasive Salmonella enterica serovar enteritidis and a model for its association with the production of contaminated eggs. Appl. Environ. Microbiol. 63, 1588^1593. [25] Kamimura, R.T., Bicciato, S., Shimizu, H., Alford, J. and Stephanopoulos, G. (2000) Mining of biological data I: Identifying discrim-
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
291
inating features via mean hypothesis testing. Metab. Eng. 2, 218^ 227. Taraviras, S.L., Ivanciuc, O. and Cabrol-Bass, D. (2000) Identi¢cation of groupings of graph theoretical molecular descriptors using a hybrid cluster analysis approach. J. Chem. Inf. Comput. Sci. 40, 1128^1146. Petter, J.G. (1993) Detection of two smooth colony phenotypes in a Salmonella enteritidis isolate which vary in their ability to contaminate eggs. Appl. Environ. Microbiol. 59, 2884^2890. Humphrey, T.J., Williams, A., McAlpine, K., Lever, M.S., GuardPetter, J. and Cox, J.M. (1996) Isolates of Salmonella enterica Enteritidis PT4 with enhanced heat and acid tolerance are more virulent in mice and more invasive in chickens. Epidemiol. Infect. 117, 79^88. Lu, S., Manges, A.R., Xu, Y., Fang, F.C. and Riley, L.W. (1999) Analysis of virulence of clinical isolates of Salmonella enteritidis in vivo and in vitro. Infect. Immun. 67, 5651^5657. Jorgensen, F., Leach, S., Wilde, S.J., Davies, A., Stewart, G.S. and Humphrey, T. (2000) Invasiveness in chickens, stress resistance and RpoS status of wild-type Salmonella enterica subsp. enterica serovar typhimurium de¢nitive type 104 and serovar enteritidis phage type 4 strains [in process citation]. Microbiology 146, 3227^3235. Carsiotis, M., Weinstein, D.L., Karch, H., Holder, I.A. and O'Brien, A.D. (1984) Flagella of Salmonella typhimurium are a virulence factor in infected C57BL/6J mice. Infect. Immun. 46, 814^818. Yanagihara, S., Iyoda, S., Ohnishi, K., Iino, T. and Kutsukake, K. (1999) Structure and transcriptional control of the £agellar master operon of Salmonella typhimurium. Genes Genet. Syst. 74, 105^111. Lucas, R.L., Lostroh, C.P., DiRusso, C.C., Spector, M.P., Wanner, B.L. and Lee, C.A. (2000) Multiple factors independently regulate hilA and invasion gene expression in Salmonella enterica serovar typhimurium. J. Bacteriol. 182, 1872^1882. Kutsukake, K. and Iino, T. (1994) Role of the FliA-FlgM regulatory system on the transcriptional control of the £agellar regulon and £agellar formation in Salmonella typhimurium. J. Bacteriol. 176, 3598^3605. Groisman, E.A. and Ochman, H. (1993) Cognate gene clusters govern invasion of host epithelial cells by Salmonella typhimurium and Shigella £exneri. EMBO J. 12, 3779^3787. Claret, L. and Hughes, C. (2000) Rapid turnover of FlhD and FlhC, the £agellar regulon transcriptional activator proteins, during Proteus swarming. J. Bacteriol. 182, 833^836. Holt, P.S. and Chaubal, L.H. (1997) Detection of motility and putative synthesis of £agellar proteins in Salmonella pullorum cultures. J. Clin. Microbiol. 35, 1016^1020.
FEMSLE 10160 5-11-01
www.fems-microbiology.org
Contribution of £agella and invasion proteins to pathogenesis of Salmonella enterica serovar enteritidis in chicks Craig T. Parker, Jean Guard-Petter * United States Department of Agriculture, ARS-SEPRL, 934 College Station Road, Athens, GA 30605, USA Received 12 February 2001; received in revised form 20 July 2001; accepted 22 August 2001 First published online 11 October 2001
Abstract To explore the relative contribution that flagella and Salmonella invasion proteins make to the virulence of Salmonella enteritidis in poultry, 20-day-old chicks were challenged orally and by subcutaneous injection with wild-type strain SE-HCD, two non-flagellated mutants (fliC: :Tn10 mutant and flhD: :Tn10 mutant) and two Salmonella invasion protein insertion mutants (sipD and iacP). When injected subcutaneously, wild-type SE-HCD was the only strain to cause substantial mortality and morbidity and to grow well in organs. The flhD mutant of SE-HCD was invasive when given orally, whereas wild-type SE-HCD and the fliC mutant were significantly attenuated. Salmonella invasion protein mutants were not invasive by either route. These results suggest that temporary suppression of Class I regulators of flagellin biosynthesis may aid oral infection in poultry. ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Flagella ; Invasion; Chicken ; Egg; Salmonella
1. Introduction Salmonella enterica serovar enteritidis (Salmonella enteritidis) is a major cause of human food-borne illness, due in part to its ability to infect poultry and to contaminate eggs [1,2]. Virulence characterization of invasive S. enteritidis has highlighted that £agellation is one of several distinguishing virulence markers in poultry [3,4]. However, there is evidence against £agellation as an important virulence factor for S. enterica [5]. Signi¢cantly, the egg-contaminating serotype Salmonella pullorum/gallinarum is highly pathogenic for birds, but lacks £agella and is non-motile [6]. Some investigations report that loss of £agellation might be associated with increased production of virulence factors [7], but surface migration by hyper£agellated swarm cells has also been associated with virulence in other Gram-negative bacteria including Salmonella [8,9]. Although it is not clear from these studies the degree to which £agella contributes to virulence in poultry, the liter-
* Corresponding author. Tel. : +1 (706) 546 3446; Fax: +1 (706) 546 3161. E-mail address : [email protected] (J. Guard-Petter).
ature provides ample evidence for the importance of large arrays of virulence genes encoding Salmonella invasion proteins (SIPs) located in the Salmonella pathogenicity islands (SPI) [10,11]. To further understand how virulence factors contribute to egg contamination, and especially to further address the role of £agella in birds, we compared the relative ability of £agella and SIP mutants of S. enteritidis to infect 20-day-old chicks following oral and subcutaneous challenge. 2. Materials and methods 2.1. Description of wild-type S. enteritidis S. enteritidis SE-HCD (phage type 13a) is a wild-type strain that has been characterized for virulence attributes in chicks [12,13]. It has a propensity to hyper£agellate [14], to be parenterally adapted [15], to produce unusual lipopolysaccharide O-chain structures [16], and to grow to high cell density in culture [14]. It is moderately invasive when given orally as compared to some strains of S. enteritidis, but it grows to high numbers in spleens [15]. In addition to the large 37-kb Salmonella virulence plasmid, SE-HCD also has a bioluminescence reporter plasmid
0378-1097 / 01 / $20.00 ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 0 1 ) 0 0 4 1 2 - 8
FEMSLE 10160 5-11-01
288
C.T. Parker, J. Guard-Petter / FEMS Microbiology Letters 204 (2001) 287^291
lacking luxI, which will produce luciferase in correlation with growth to high cell density in broth culture [13]. 2.2. Description of £agellar transposon mutants A Salmonella typhimurium £hD: :Tn10 mutant [17] was obtained from V. Koronakis, Cambridge University, UK, and a S. typhimurium £iC : :Tn10 mutant [14] from A. O'Brien, F.E. Herbert School of Medicine. The £hD: :Tn10 and £iC: :Tn10 mutations were introduced into S. enteritidis from S. typhimurium by P22HT-int transductions using standard techniques [18]. All tetracycline resistant transductants were non-motile in soft agar and did not swarm under growth conditions that aid £agellation [14] (data not shown). The location of transposons within targeted £iC and £hD genes was con¢rmed by polymerase chain reaction (PCR) ampli¢cation of wild-type and mutant chromosomal DNA using upper and lower wild-type primer pairs and a Tn10 identifying primer as listed below (Medline accession numbers and GenBank identi¢cation follows sequence) (Fig. 1): £hDU, GTTGGTTATTCTGGATGGGAA; £hDL, CGCTGCTGGAGTGTTTGT (Medicine accession number: AFO29300, GenBank identi¢cation: 2772916); £iCU, GGCAATCTGGAGGCAAAGTTTA ; £iCL, ACCACGTGTCGGTGAATCAATC (Medicine accession number: D13689, GenBank identi¢cation: 217062); Tn10Rout, ACCACGTGTCGGTGAATCAATC (Medicine accession number: AF223162, GenBank identi¢cation: 7739612). Fine map analysis of chromosomal DNA obtained from wild-type and its £iC and £hD mutants showed that laboratory manipulations did not introduce unexpected genomic rearrangements, because these three strains had indistinguishable patterns and remained genetically similar to other clinical and veterinary isolates from disparate sources that were phage type 13a [19]. Growth curves were conducted to assess growth rates of wild-type SEHCD and its £iC and £hD mutants. The £hD mutant of SE-HCD grew to approximately twice the cell density as either wild-type or the £iC mutant in tryptone broth, which is an expected consequence of mutation because cells from £hD mutants are shorter than wild-type [20,21]. 2.3. Construction of sipD and iacP mutants To create the sipD mutant, a 1.1-kb fragment harboring the sipD gene was ampli¢ed via PCR from S. typhimurium utilizing primer sipD25 (5P-ATCTAT ACGCCATCATGGGTG T-3P) and primer sipD1173 (5P-TGATCTCGGTCTGCATACCTG-3P) (GenBank accession number : U40013). Next, we TA cloned the PCR-generated fragment into pGEM-T (Promega). To create an insertional mutation, this recombinant plasmid was opened at a unique BglII site within sipD and a BamHI fragment containing a kan cassette from pUC-4K was ligated into this site. The sipD: :kan fragment was then excised from
pGEM-T using SphI and SacI and subcloned into pCVD442 [22], a positive selection suicide vector. For the iacP mutant, a three-step PCR procedure was performed. In the ¢rst two steps of PCR, a 419-bp fragment containing the 5P-end of the iacP gene was ampli¢ed with primers iacP1866 (5P-TAAAGAGTGCAGCGTTGA-3P) and iacP2285L (5P-AGCGTAAAGATCTT CAACCAGATG-3P), and a 527-bp fragment containing the 3P-end of the iacP gene was ampli¢ed with primers iacP2285U (5P-CATCTGGTTGAAGATCTTTACGCT-3P) and iacP2812L (5P-TAAACCC AATTTCTCACC A-3P). The resulting products were gel puri¢ed using QIAquick gel extraction (Qiagen, Valencia, CA, USA) and then used together in a third step of overlapping extension PCR using primers iacP1866 and iacP2816 to produce a 946bp fragment that was TA cloned into pGEM-T. To create an insertional mutation, this recombinant plasmid was opened at a unique BglII site within iacP created by primers iacP2285 (site underlined) and a BamHI fragment containing a kan cassette from pUC-4K was ligated into this site. The iacP: :kan fragment was then excised from pGEM-T using SphI and SacI and subcloned into pCVD442. These suicide plasmids were subsequently transformed into Escherichia coli SM10Vpir and mated to SE6-E21. To enrich for bacteria that had resolved the integrated plasmid, conjugants were grown in LB without antibiotics followed by plating on LB containing 5% sucrose and no salt, and incubation overnight at 30³C to select for the loss of the sacB-containing plasmid. Isolated colonies were then screened for the loss of the plasmid-encoded ampicillin resistance and the acquisition of kanamycin resistance. The chromosomal mutation was veri¢ed by PCR. Finally, the mutation was transduced by P22HT-int into SE-HCD as described [23]. Insertion of the kanamycin cassette into the targeted gene in SE-HCD was con¢rmed by detection of a PCR product that was larger than wildtype (Fig. 1). Growth characteristics of SIP mutants were similar to those of wild-type. 2.4. Preparation of cultures for challenge of 20-day-old chicks Challenge inocula were prepared by incubating SEHCD and mutants for 16 h at 37³C without shaking, followed by shaking for 3 h at rpm setting of 8 on a New Brunswick Model G76, which resulted in an 1/10 OD600 of 0.4 and lux reading of 52U103 lux units (Turner luminometer). These conditions indicated that cells were in the early stage of high cell density growth [13]. Dosage was determined by serial 10-fold dilutions of cells on BG agar and then incubating plates at 37³C for 16 h before counting colony-forming units (CFU). Final average dose per chick was 5.1 þ 0.4U106 CFU for all strains. Chicks from a speci¢c pathogen free £ock were challenged orally and subcutaneously by injection in separate experiments.
FEMSLE 10160 5-11-01
C.T. Parker, J. Guard-Petter / FEMS Microbiology Letters 204 (2001) 287^291
289
Relative virulence of strains was determined by measuring mortality and morbidity, by determining if spleens were culture positive, and by counting CFU of salmonellae in the spleens of surviving chicks 3 days post-inoculation as previously described [12]. 2.5. Statistical analyses A 10-fold di¡erence in recovery of the average CFU per spleen from groups of 8^10 chicks has been noted before to be signi¢cant as analyzed by t-test and cluster analysis, even when standard deviations were large [12]. Cluster analysis of chick spleen counts, which is shown in Table 1 as a ranking of data, is an e¡ective method for dealing with wide standard deviations [24]. Cluster analysis is considered a more stringent method for analyzing the signi¢cance of data sets that are composed of mixed subpopulations and non-random data distribution patterns, whereas t-test analysis is best suited for analysis of variation occurring within a single population where selection of data at random followed by ranking will produce a single bell curve [24^26]. At P values of 0.1 or less, results from t-test analysis of data for signi¢cance agree with results obtained by using cluster analysis, and thus values equal to or less than 0.1 are considered to indicate signi¢cance. S. enteritidis is known to exist in culture as mixed subpopulations that when separated have di¡erent virulence potentials in birds [12,15,27^30]. For these reasons, both t-test and cluster analyses of spleen counts are provided in Table 1 to substantiate the signi¢cance of the di¡erences seen between strains (Table 1). 3. Results 3.1. Results from oral challenge of 20-day-old chicks SE-HCD was moderately invasive when infection was
Fig. 1. Con¢rmation of placement of the Tn10 transposon and the kanamycin resistance cassette into respective £agella and SIP genes of S. enteritidis. Shown are electrophoresed PCR products following hybridization of chromosomal DNA from appropriate strains to the following pairs of primers: Lanes 1 and 12, MW markers; lane 2, HCD-£iCU/ £iCL; lane 3, HCD£iC : :Tn10-£iCU/£iCL ; lane 4, HCD£iC : :Tn10-£iCU/Tn10Rout; lane 5, HCD-£hDU/£hDL ; lane 6, HCD£hD: :Tn10£hDU/£hDL; lane 7, HCD£hD: :Tn10-£hDU/Tn10Rout ; lane 8, HCDiacPU/L ; lane 9, HCDiacP: :kan-iacPU/L; lane 10, HCD-sipDU/L; lane 11, HCDsipD: :kan-sipDU/L.
by the oral route (60% positive spleens), but yielded only low numbers of CFU in those spleens that were positive (average 13 CFU per spleen) (Table 1). The £iC mutant was similar to wild-type (60% positive spleens, average of 25 CFU per spleen), indicating that the presence of £agellin was not necessary to achieve at least a moderate level of oral invasion. In comparison, the £hD mutant yielded a higher percentage of positive spleens (89%) and CFU counts per spleen were two logs higher than what was obtained by oral infection of chicks with wild-type or the £iC mutant (2295 CFU per spleen) (Table 1). Mutation of sipD and iacP nearly eliminated oral invasiveness in chicks, which left too few positive spleens for further statistical analysis (Table 1). Cluster analysis indicated that £hD SE-HCD had substantial population heterogene-
Table 1 Challenge of 20-day-old chicks with SIP and £agellar mutants of S. enteritidis Virulence parameter
Number of chicks challenged % Morbidity/mortality % Positive spleens (number positive/number survivors) Average CFU per positive spleen (U103 ) t-Test P value Cluster analysis of spleen counts (CFU) % 6 104 % 105 % 106 % 107 % s 108 a
Oral
Subcutaneous
SE-HCD
£iC
£hD
sipD
iacP
SE-HCD
£iC
£hD
sipD
iacP
10 0 60 (6/10)
10 0 60 (6/10)
10 10 89 (8/9)
10 0 0 (0/10)
10 0 10 (1/10)
10 40 100 (8/8)
8 0 100 (8/8)
8 0 100 (8/8)
10 10 100 (9/9)
10 10 100 (9/9)
13
25
2295
naa
na
6650
815
223
90
40
^
0.20
0.07
na
na
^
0.09
0.08
0.07
0.07
100.0 0.0 0.0 0.0 0.0
100.0 0.0 0.0 0.0 0.0
25.0 25.0 37.5 12.5 0.0
na na na na na
na na na na na
37.5 25.0 12.5 0.0 25.0
0.0 62.5 37.5 0.0 0.0
50.0 50.0 0.0 0.0 0.0
66.7 33.3 0.0 0.0 0.0
88.9 11.1 0.0 0.0 0.0
Na, not analyzed because fewer than three positive spleens were recovered.
FEMSLE 10160 5-11-01
290
C.T. Parker, J. Guard-Petter / FEMS Microbiology Letters 204 (2001) 287^291
ity, which is demonstrated as placement of spleen counts for individual chicks in four of ¢ve clusters (Table 1). Thus, it appears that the absence of FlhD (and possibly other Class I regulatory components of the £hDC operon) rather than the absence of motility or £agellin enhanced the oral invasiveness of SE-HCD (Table 1). While P22 transduction might have inadvertently transferred a genetic change from one serovar to the other that could have a¡ected results, we could ¢nd no evidence that this was probable. The parent S. typhimurium strains used to transfer mutation to SE-HCD are well-characterized and available chromosomal databases of S. typhimurium and S. enteritidis reveal no signi¢cant di¡erences in genetic sequence where mutations were targeted [17,31]. Construction of £agellar mutants in a di¡erent phage type of S. enteritidis resulted in a similar result, which was that £hD S. enteritidis was more virulent than wild-type when given orally (data not shown). Overall these results strongly suggest that oral invasiveness is a stage in the infectious process in chicks that requires SIPs and that appears to be enhanced by the absence of the Class I regulator FlhD.
¢nding that the absence of FlhD enhanced oral invasiveness in these experiments suggests that the advantages to the pathogen associated with £agellation and motility are limited in scope in birds. In contrast, SIP proteins appear to be as essential for invasiveness in birds as they are in mammals. Thus, avian-adapted non-motile salmonellae may have evolved to optimize oral colonization at the expense of narrowing host range to birds, whereas motile salmonellae retain £agellation perhaps to aid productive infection with a wider range of hosts. There is evidence that some salmonellae strains that are serotyped as S. pullorum may actually be S. enteritidis strains that have suppressed £agellation [14,37]. Thus, it is conceivable that human illness from S. enteritidis could have increased when an avian-adapted subpopulation with enhanced oral invasiveness emerged on-farm. However, this type of subpopulation has not yet been identi¢ed in a research setting. Further investigation is in progress to determine if £hD S. enteritidis aids the process of egg contamination in experimentally infected hens.
3.2. Results from subcutaneous challenge of 20-day-old chicks
References
When challenge was by the subcutaneous route, all mutants were signi¢cantly attenuated in comparison to wildtype SE-HCD, as determined by average CFU spleen counts and by observing a narrowing in the spread of data across clusters (Table 1). SE-HCD was the only strain that produced considerable mortality and morbidity in chicks (de¢ned as illness likely leading to death within the next 24 h). In addition, SE-HCD injected subcutaneously produced the highest spleen counts in two of eight chicks (Table 1: counts greater than 108 CFU per spleen). All mutants had a narrower range of CFU recovered from spleens than did wild-type, which suggests that mutation in general limits subpopulation variability that aids growth in spleens (Table 1). Mutation of SIP genes appeared to be more attenuating than mutation of £agellar genes, because a lack of SIPs resulted in the largest decrease in the number of CFU recovered from spleens following subcutaneous challenge (Table 1). 4. Discussion Two types of £agellar mutants were made, because £agellar biosynthesis is a complex process requiring a hierarchy of genes located in three di¡erent classes of operons [17,32] and both a Class I master operon mutant and a Class III mutant would be non-£agellated and hence nonmotile. However, £uctuations in Class I regulators of £agellin biosynthesis are known to greatly a¡ect cellular development and hence virulence of Salmonella and other Gram-negative pathogens [10,20,21,33^36]. The surprising
[1] St. Louis, M.E., Morse, D.L., Potter, M.E., DeMel¢, T.M., Guzewich, J.J., Tauxe, R.V. and Blake, P.A. (1988) The emergence of grade A eggs as a major source of Salmonella enteritidis infections. New implications for the control of salmonellosis [see comments]. J. Am. Med. Assoc. 259, 2103^2107. [2] Timoney, J.F., Shivaprasad, H.L., Baker, R.C. and Rowe, B. (1989) Egg transmission after infection of hens with Salmonella enteritidis phage type 4. Vet. Rec. 125, 600^601. [3] Allen-Vercoe, E. and Woodward, M.J. (1999) The role of £agella, but not ¢mbriae, in the adherence of Salmonella enterica serotype Enteritidis to chick gut explant. J. Med. Microbiol. 48, 771^780. [4] Allen-Vercoe, E., Sayers, A.R. and Woodward, M.J. (1999) Virulence of Salmonella enterica serotype Enteritidis a£agellate and a¢mbriate mutants in a day-old chick model. Epidemiol. Infect. 122, 395^402. [5] Lockman, H.A. and Curtiss, R.D. (1990) Salmonella typhimurium mutants lacking £agella or motility remain virulent in BALB/c mice. Infect. Immun. 58, 137^143. [6] Shivaprasad, H.L. (2000) Fowl typhoid and pullorum disease [in process citation]. Rev. Sci. Tech. 19, 405^424. [7] Gardel, C.L. and Mekalanos, J.J. (1996) Alterations in Vibrio cholerae motility phenotypes correlate with changes in virulence factor expression. Infect. Immun. 64, 2246^2255. [8] Allison, C., Lai, H.C. and Hughes, C. (1992) Co-ordinate expression of virulence genes during swarm-cell di¡erentiation and population migration of Proteus mirabilis. Mol. Microbiol. 6, 1583^1591. [9] Flanary, P.L., Allen, R.D., Dons, L. and Kathariou, S. (1999) Insertional inactivation of the Listeria monocytogenes cheYA operon abolishes response to oxygen gradients and reduces the number of £agella. Can. J. Microbiol. 45, 646^652. [10] Galan, J.E. (1996) Molecular genetic bases of Salmonella entry into host cells. Mol. Microbiol. 20, 263^271. [11] Collazo, C.M. and Galan, J.E. (1997) The invasion-associated type III system of Salmonella typhimurium directs the translocation of Sip proteins into the host cell. Mol. Microbiol. 24, 747^756. [12] Guard-Petter, J., Lakshmi, B., Carlson, R. and Ingram, K. (1995) Characterization of lipopolysaccharide heterogeneity in Salmonella enteritidis by an improved gel electrophoresis method. Appl. Environ. Microbiol. 61, 2845^2851.
FEMSLE 10160 5-11-01
C.T. Parker, J. Guard-Petter / FEMS Microbiology Letters 204 (2001) 287^291 [13] Guard-Petter, J. (1998) Variants of smooth Salmonella enterica serovar Enteritidis that grow to higher cell density than the wild type are more virulent. Appl. Environ. Microbiol. 64, 2166^2172. [14] Guard-Petter, J. (1997) Induction of £agellation and a novel agarpenetrating £agellar structure in Salmonella enterica grown on solid media: possible consequences for serological identi¢cation. FEMS Microbiol. Lett. 149, 173^180. [15] Guard-Petter, J., Keller, L.H., Rahman, M.M., Carlson, R.W. and Silvers, S. (1996) A novel relationship between O-antigen variation, matrix formation, and invasiveness of Salmonella enteritidis. Epidemiol. Infect. 117, 219^231. [16] Parker, C.T., Liebana, E., Henzler, D.J. and Guard-Petter, J. (2001) Lipopolysaccharide O-antigen microheterogeneity of Salmonella serotypes Enteritidis and Typhimurium. Environ. Microbiol., to appear. [17] Kutsukake, K. (1997) Autogenous and global control of the £agellar master operon, £hD, in Salmonella typhimurium. Mol. Gen. Genet. 254, 440^448. [18] Davis, R.W., Botstein, D. and Roth, J.R. (1980) Advanced Bacterial Genetics: A Manual for Genetic Engineering. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [19] Liebana, E., Garcia-Migura, L., Guard-Petter, J., McDowell, S., Rankin, S., Opitz, M. and Davies, R.H. (2001) Salmonella enterica sero-type Enteritidis phage types 4, 7, 6, 8, 13a, 29, and 34: A comparative analysis of genomic ¢ngerprints from geographically distant isolates. J. Appl. Microbiol., in press. [20] Pruss, B.M. and Matsumura, P. (1996) A regulator of the £agellar regulon of Escherichia coli, £hD, also a¡ects cell division. J. Bacteriol. 178, 668^674. [21] Pruss, B.M., Markovic, D. and Matsumura, P. (1997) The Escherichia coli £agellar transcriptional activator £hD regulates cell division through induction of the acid response gene cadA. J. Bacteriol. 179, 3818^3821. [22] Donnenberg, M.S. and Kaper, J.B. (1991) Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59, 4310^4317. [23] Maloy, S., Stewart, V. and Taylor, R. (1996) Genetic Analysis of Pathogenic Bacteria. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [24] Guard-Petter, J., Henzler, D.J., Rahman, M.M. and Carlson, R.W. (1997) On-farm monitoring of mouse-invasive Salmonella enterica serovar enteritidis and a model for its association with the production of contaminated eggs. Appl. Environ. Microbiol. 63, 1588^1593. [25] Kamimura, R.T., Bicciato, S., Shimizu, H., Alford, J. and Stephanopoulos, G. (2000) Mining of biological data I: Identifying discrim-
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
291
inating features via mean hypothesis testing. Metab. Eng. 2, 218^ 227. Taraviras, S.L., Ivanciuc, O. and Cabrol-Bass, D. (2000) Identi¢cation of groupings of graph theoretical molecular descriptors using a hybrid cluster analysis approach. J. Chem. Inf. Comput. Sci. 40, 1128^1146. Petter, J.G. (1993) Detection of two smooth colony phenotypes in a Salmonella enteritidis isolate which vary in their ability to contaminate eggs. Appl. Environ. Microbiol. 59, 2884^2890. Humphrey, T.J., Williams, A., McAlpine, K., Lever, M.S., GuardPetter, J. and Cox, J.M. (1996) Isolates of Salmonella enterica Enteritidis PT4 with enhanced heat and acid tolerance are more virulent in mice and more invasive in chickens. Epidemiol. Infect. 117, 79^88. Lu, S., Manges, A.R., Xu, Y., Fang, F.C. and Riley, L.W. (1999) Analysis of virulence of clinical isolates of Salmonella enteritidis in vivo and in vitro. Infect. Immun. 67, 5651^5657. Jorgensen, F., Leach, S., Wilde, S.J., Davies, A., Stewart, G.S. and Humphrey, T. (2000) Invasiveness in chickens, stress resistance and RpoS status of wild-type Salmonella enterica subsp. enterica serovar typhimurium de¢nitive type 104 and serovar enteritidis phage type 4 strains [in process citation]. Microbiology 146, 3227^3235. Carsiotis, M., Weinstein, D.L., Karch, H., Holder, I.A. and O'Brien, A.D. (1984) Flagella of Salmonella typhimurium are a virulence factor in infected C57BL/6J mice. Infect. Immun. 46, 814^818. Yanagihara, S., Iyoda, S., Ohnishi, K., Iino, T. and Kutsukake, K. (1999) Structure and transcriptional control of the £agellar master operon of Salmonella typhimurium. Genes Genet. Syst. 74, 105^111. Lucas, R.L., Lostroh, C.P., DiRusso, C.C., Spector, M.P., Wanner, B.L. and Lee, C.A. (2000) Multiple factors independently regulate hilA and invasion gene expression in Salmonella enterica serovar typhimurium. J. Bacteriol. 182, 1872^1882. Kutsukake, K. and Iino, T. (1994) Role of the FliA-FlgM regulatory system on the transcriptional control of the £agellar regulon and £agellar formation in Salmonella typhimurium. J. Bacteriol. 176, 3598^3605. Groisman, E.A. and Ochman, H. (1993) Cognate gene clusters govern invasion of host epithelial cells by Salmonella typhimurium and Shigella £exneri. EMBO J. 12, 3779^3787. Claret, L. and Hughes, C. (2000) Rapid turnover of FlhD and FlhC, the £agellar regulon transcriptional activator proteins, during Proteus swarming. J. Bacteriol. 182, 833^836. Holt, P.S. and Chaubal, L.H. (1997) Detection of motility and putative synthesis of £agellar proteins in Salmonella pullorum cultures. J. Clin. Microbiol. 35, 1016^1020.
FEMSLE 10160 5-11-01