- Email: [email protected]
Contribution of hly homologs to the hemolytic activity of Prevotella intermedia
Anaerobe 18 (2012) 350e356
Contents lists available at SciVerse ScienceDirect
Anaerobe journal homepage: www.elsevier.com/locate/anaerobe
Molecular biology, genetics and biotechnology
Contribution of hly homologs to the hemolytic activity of Prevotella intermedia Naoko Suzuki a, Haruka Fukamachi b, Takafumi Arimoto b, *, Matsuo Yamamoto a, Takeshi Igarashi b a b
Department of Periodontology, Showa University School of Dentistry, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo 142-8555, Japan Department of Oral Microbiology, Showa University School of Dentistry, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo 142-8555, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 January 2012 Received in revised form 3 April 2012 Accepted 16 April 2012 Available online 25 April 2012
Prevotella intermedia is a periodontal pathogen that requires iron for its growth. Although this organism has hemolytic activity, the precise nature of its hemolytic substances and their associated hemolytic actions are yet to be fully determined. In the present study, we identified and characterized several putative hly genes in P. intermedia ATCC25611 which appear to encode hemolysins. Six hly genes (hlyA, B, C, D, E, and hlyI) of P. intermedia were identified by comparing their nucleotide sequences to those of known hly genes of Bacteroides fragilis NCTC9343. The hlyA-E, and hlyI genes were overexpressed individually in the non-hemolytic Escherichia coli strain JW5181 and examined its contribution to the hemolytic activity on sheep blood agar plates. E. coli cells expressing the hlyA and hlyI genes exhibited hemolytic activity under anaerobic conditions. On the other hand, only E. coli cells stably expressing the hlyA gene were able to lyse the red blood cells when cultured under aerobic conditions. In addition, expression of the hlyA and hlyI genes was significantly upregulated in the presence of red blood cells. Furthermore, we found that the growth of P. intermedia was similar in an iron-limited medium supplemented with either red blood cells or heme. Taken together, our results indicate that the hlyA and hlyI genes of P. intermedia encode putative hemolysins that appear to be involved in the lysis of red blood cells, and suggest that these hemolysins might play important roles in the iron-dependent growth of this organism. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Hemolytic activity Real-time RT-PCR Prevotella intermedia
1. Introduction Prevotella intermedia, a gram-negative, black-pigmented obligate anaerobic rod, is often isolated from periodontal lesions associated with various forms of periodontal disease, including chronic periodontitis, pregnancy gingivitis, and acute necrotizing ulcerative gingivitis [1e5]. P. intermedia appears to have a variety of virulence capabilities important for initiating and sustaining periodontal disease, including the capacity to invade eukaryotic cells [6], degrade immunoglobulins [7], suppress the immune functions of B and T cells [8], and lyse red blood cells via an associated hemolytic activity [9]. The ability of a pathogen to survive, proliferate, and establish infection in its relevant host is greatly influenced by the availability of essential nutrients. Iron appears to be an indispensable nutrient for P. intermedia [10]. In the human oral cavity, however, iron availability is limited by intracellular containment within ferritin, hemosiderin, and heme-containing proteins such as hemoglobin and myoglobin. Furthermore, free iron is maintained at a level too
* Corresponding author. Tel.: þ81 3 3784 8166; fax: þ81 3 3784 4105. E-mail address: [email protected] (T. Arimoto). 1075-9964/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.anaerobe.2012.04.005
low to support bacterial growth. Red blood cells are usually abundant in inflamed periodontal pockets, so heme could be one possible source of iron for bacteria. As P. intermedia is lacking in the ability to synthesize heme [10], this pathogen must have some means of acquiring the iron from red blood cells it needs to survive in its relevant host. Heme acquisition from red blood cells by bacteria usually involves hemolysis, hemoglobin binding, and the degradation of hemoglobin with the subsequent release of heme. In turn, free heme is bound and transported into the bacterial cell. Several studies have reported that periodontal pathogenic bacteria, including Porphyromonas gingivalis [11,12], Treponema denticola [13,14], Aggregatibacter actinomycetemcomitans [15], and Prevotella melaninogenica [16], are capable of producing hemolytic substances. Importantly, several reports exist in the literature showing that P. intermedia is also able to carry out hemolysis [9,17], hemoglobin degradation [18,19], and heme transportation [20], all of which supports the idea that P. intermedia might be able to use heme from red blood cells as a source of iron. Even though a hemolysin from P. intermedia has been partially purified and characterized [21], and a P. intermedia gene encoding multiple hemolytic domains has been cloned [22], the precise nature and mode(s) of action of the hemolytic substances produced by this organism remains to be determined.
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
In this study, we identified six possible hemolysin-related genes (hlyA, hlyB, hlyC, hlyD, hlyE, and hlyI) in the genomic database of P. intermedia 17. Each gene was introduced into non-hemolytic Escherichia coli cells in an appropriate vector, and the hemolytic activity of the transformed strains was subsequently examined. We also investigated the expression level of the hly genes throughout the growth of P. intermedia. Here, we determined the contribution of the hly genes to hemolytic activity of this pathogen. 2. Material and methods 2.1. Bacterial strains and culture conditions P. intermedia ATCC25611 was used in this study, and was maintained anaerobically (in an atmosphere of10% CO2, 10% H2, and 80% N2) at 37 C on tryptic soy agar supplemented with 5% sheep blood. E. coli JW5181 is a derivative of E. coli BW2511 (hlyE::Kmr) [23] and was cultured aerobically at 37 C in Luria-Bertani (LB) broth (Invitrogen, Carlsbad, CA, USA). Recombinant strains were grown in LB broth supplemented with ampicillin (50 mg/ml). 2.2. DNA manipulation P. intermedia ATCC25611 genomic DNA was extracted using the GenElute Bacterial genomic DNA kit (SigmaeAldrich, St. Louis, MO). Plasmid DNA was extracted using the Wizard miniprep purification kit (Promega, Madison, WI). Ligation of DNA was performed using the DNA Ligation Kit version 2 (TaKaRa Bio, Shiga, Japan). 2.3. Cloning, purification, and expression of recombinant hemolysins The primers and plasmids used in this study are listed in Table 1. The genome of P. intermedia 17 was used to design the primers for our study. The hlyA, hlyB, hlyC, hlyD, and hlyE genes were amplified from P. intermedia ATCC25611 using LA Taq DNA polymerase (TakaRa Bio) in a long and accurate polymerase chain reaction (LAPCR). The amplified fragments were digested with the appropriate restriction enzymes and ligated into the pGEX-6P-1 vector (GE Healthcare UK, Little Chalfont, UK). Each plasmid construct was then transformed into the non-hemolytic E. coli JW5181 strain. The pGEX-6P-1 carrying the hlyI gene of P. intermedia ATCC25611 was constructed as previously reported [24]. 2.4. Solid hemolysis assay E. coli JW5181 was used as the host strain to confirm that the cloned genes were not interfering with endogenous E. coli hemolytic activity. E. coli cells expressing the relevant hly genes (hlyA-E, and hlyI) were tested for their hemolytic activity on sheep blood agar plates. The bacterial cultures were plated onto sheep blood agar, and incubated either anaerobically at 37 C for four days or aerobically at 37 C for three days. Hemolytic activity was determined by comparing the hemolytic zones produced by the hlyexpressing bacterial cells to those produced by control E. coli JW5181 cells carrying an empty pGEX-6P-1 vector. 2.5. Liquid hemolysis assay A liquid hemolysis assay was carried out as described by Okamoto et al. [17] with minor modifications. Briefly, E. coli strains constructed in this study were washed with NCN buffer (150 mM sodium chloride, 3 mM sodium citrate [pH 6.8]), and then resuspended in NCN to a density of 1 109 CFU/ml. Equal volumes of the bacterial suspension and 2% (v/v) red blood cells were mixed, and
351
Table 1 Plasmids and primers used for this study. Plasmids or primer Primers pGEX-hlyA-F pGEX-hlyA-R pGEX-hlyB-F pGEX-hlyB-R pGEX-hlyC-F pGEX-hlyC-R pGEX-hlyD-F pGEX-hlyD-R pGEX-hlyE-F pGEX-hlyE-R Pi16SrRNA-F Pi16SrRNA-R real-hlyA-F real-hlyA-R real-hlyB-F real-hlyB-R real-hlyC-F real-hlyC-R real-hlyD-F real-hlyD-R real-hlyE-F real-hlyE-R real-hlyI-F real-hlyI-R Plasmids pGEX-hlyA pGEX-hlyB pGEX-hlyC pGEX-hlyD pGEX-hlyE a b c
Nucleotide sequence(50 /30 )
References
CGCGGATCCATGAAGGAAGAAGAGATTATa CGCGAATTCTTACCGCTCCTCGTAAATCACTTb AGAGGATCCATGGAGAGGACCATCGATATa CCCGAATTCCTAAAGTTCATATACCTTATCb CCGCCGAATTCTCTGAAATCGCTTTTTTCAGTTTGTCb GCGCCTCGAGCTACTTTTCATCTTGAATCGTTAC CCTGGATCCATGACGTTCCAGAAGGTTTTCa CCTGAATTCTTAGGGAACTGGGTCGTATCCb CTCCGGATCCCTGTCTTTGACATTGTCTGCa GGGGCTCGAGCTAAACGCTAACTTTTAGCTc TCCACCGATGAATCTTTGGTC ATCCAACCTTCCCTCCACTC TGGGTCGCTCTTTCGTTTCT ACCGTCCCAAAGATTATCGAGTGC ACAGGAACGGAATGGCTTACCGAA CGTTCTTGTCGGGCAAGTTT GCGAAAGCTGTCAATGGGCGAAAT ATGCCTTCAAGCATTTCCTGCTCG TTTATCAACGGTTTATCACGCCTTT TCAATGCTTGCTTTGCGTACTCCG TAACCTGTCCTGTTGCCGAATTGC ATGGTCGATGTCGTGGTTCTAGAC TTGCATTCGTAATCAGGGCTTGCG TTCGCTTCGAAGTCGTCCCAATCT
This This This This This This This This This This [25] [25] This This This This This This This This This This This This
study study study study study study study study study study
study study study study study study study study study study study study
pGEX6P-1 containing the hlyA from P. intermedia genomic DNA pGEX6P-1 containing the hlyB from P. intermedia genomic DNA pGEX6P-1 containing the hlyC from P. intermedia genomic DNA pGEX6P-1 containing the hlyD from P. intermedia genomic DNA pGEX6P-1 containing the hlyE from P. intermedia genomic DNA
The underlined sequence corresponds to BamH I sites. The underlined sequence corresponds to EcoR I sites. The underlined sequence corresponds to Xho I sites.
then incubated at 37 C. Spontaneous lysis was determined in the supernatant from the mixture of NCN buffer and red blood cells under the same conditions. After incubation, the test tubes were centrifuged at 1000 g for 5 min to pellet non-lysed red blood cells, before the optical density (OD540) of the supernatants was determined. A positive control for complete hemolysis (100%) was generated by replacing the same volume of bacterial suspension with distilled water in the assay. The percentage hemolysis was calculated as follows:
% hemolysis ¼ ðOD540 nm Test OD540 nm NCN=OD540 nm H2 O OD540 nm NCNÞ100 All assays were performed at least twice, and results presented as standard deviation (SD). 2.6. Cell preparation for gene expression analysis Three-day-old P. intermedia colonies maintained on blood agar plates were precultured in THB-M medium containing 3% ToddHewitt broth (Difco), 0.5% yeast extract, 0.075% cysteine, and 5 mg/mL menadione. After overnight incubation, cells (5% v/v) were transferred into THB-M and grown to exponential phase (OD600 w 1.5). To measure the expression levels of the hly genes under iron-replete and iron-depleted conditions, 7.7 mM heme (iron-repleted) and 125 mM of the iron scavenging compound, 2,20 -
352
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
Dipyridyl (iron-depleted), was added to THB-M, respectively. To the iron-depleted medium, 7.7 mM protoporphyrin IX (PPIX) was also added to compensate for the non-iron component of heme. To determine the effect of red blood cells, if any, on the expression of the hly genes in P. intermedia, 0.1% red blood cells were added to the THB-M medium. Cell cultures were harvested by centrifugation at 15,000 g for 10 min. Pellets (containing bacterial and red blood cells for samples and containing only red blood cells for reference control) were then washed (twice) in distilled water and resuspended in the original volume of PBS. The growth rate of P. intermedia in the presence of the red blood cells (as a source of iron) was determined by measuring the optical density (OD600) of the PBS suspension containing the resuspended bacterial cells. 2.7. RNA extraction and quantitative real-time PCR Total cellular RNA was isolated from P. intermedia ATCC25611 cells using the RNeasy mini kit (Qiagen), according to the manufacturer’s instructions. Traces of genomic DNA were removed by an additional treatment with TURBO DNA-freeÔ (Ambion, Austin, TX, USA) at 37 C for 30 min. Each RNA sample was then reverse transcribed into cDNA using the Quanti Tect Reverse Transcription kit (Qiagen). Primers used for real-time RT-PCR are listed in Table 1. Real-time PCR was performed in 1 SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK) with specific primer pairs (2 ng/mL) and 0.5 ng/mL cDNA in a 20-mL sample volume. The realtime PCR protocol included an initial denaturation at 95 C for 90 s, followed by 40 cycles with two steps each at 95 C for 5 s, and 60 C for 1 min. Non-template controls were included to confirm the absence of primer-dimer formation. All samples including nontemplate controls were run in triplicate on an ABI-Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The expression level of each gene (hlyA, hlyB, hlyC, hlyD, hlyE, and hlyI) was normalized to the expression of the 16S rRNA gene of P. intermedia [25]. Values are expressed as fold increases in mRNA levels relative to the control.
fragilis. The hlyA-E, and hlyI genes of B. fragilis NCTC9343 [26] and those of P. intermedia ATCC25611 shared 64.4%, 58.7%, 55.2%, 63.9%, 56.3%, and 54.2% homology, respectively. The sizes of the hlyA, hlyB, hlyC, hlyD, hlyE, and hlyI PCR fragments obtained from P. intermedia were found to be 990 bp, 771 bp, 1230 bp, 246 bp, 1227 bp, and 1170 bp, respectively; in turn, the molecular weights of their predicted proteins were calculated to be 37,839 Da, 31,688 Da, 49,690 Da, 9432 Da, 46,502 Da, and 44,415 Da, respectively. Southern analysis, using the hlyA, hlyB, hlyC, hlyD, hlyE, and hlyI PCR fragments as probes against appropriately digested P. intermedia ATCC25611 chromosomal DNA, revealed a single band corresponding to the relevant gene. The hlyA gene of P. intermedia was found to share homology with the phyA gene of P. melaninogenica [16]. Furthermore, the corresponding HlyA and PhyA proteins were 82% identical at the amino acid sequence level. Beem et al. [22] cloned a 3.9 kb DNA fragment containing multiple hemolytic ORFs (ORF1, ORF2, and ORF3) that appear to be required for hemolysin production in P. intermedia 27. While the ORF3 of P. intermedia 27 shared significant sequence homology with the hlyF gene of B. fragilis NCTC9343, we failed to find an ORF3 homolog in the genome database of P. intermedia 17. In addition, the hlyF fragment from B. fragilis failed to adhere to appropriately digested genomic DNA of P. intermedia ATCC25611 used in our Southern hybridization experiments (data not shown). 3.2. Hemolytic activity of E. coli JW5181 cells expressing the relevant hemolysin genes of P. intermedia To characterize the various hemolysin genes of P. intermedia at the molecular level, the hlyA-E, and hlyI genes were cloned, expressed in the host strain E. coli JW5181, and their encoded hemolysins subsequently investigated for their ability to lyse red blood cells in a solid assay. Fig. 1 shows that E. coli cells expressing the hlyA gene produced b-hemolysis under aerobic condition after 3 days of incubation (Fig. 1A). We, also found that E. coli cells expressing the hlyA and hlyI genes exhibited hemolytic activities under anaerobic conditions after 4 days of incubation (Fig. 1B).
3. Results 3.3. Liquid hemolytic activity 3.1. Analysis of the hly genes from P. intermedia ATCC25611 A search of the genome of P. intermedia 17 revealed the presence of six putative genes (hlyA, PI1901; hlyB, PI1900; hlyC, PI1162; hlyD, PI0084; hlyE, pPI0237; and hlyI, PI0305) that shared sequence homology with certain hemolysin-encoding genes of Bacteroides
The hemolytic activity encoded by the hly genes was determined in a liquid hemolysis assay using whole-cell preparations and sheep red blood cells. As shown in Fig. 2A, E. coli cells expressing the hlyA gene showed strong hemolytic activity, and 100% of the red blood cells were lysed in just over a 50 min incubation period (Fig. 2B).
Fig. 1. Hemolytic activity of E. coli JW5181 (hlyE::Kmr) transformed with pGEX constructs carrying P. intermedia hemolytic genes. Bacteria were grown aerobically (A) and anaerobically (B) on sheep blood agar plates. Hemolytic activity was determined by the appearance of a clear zone around the colonies.
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
100 80 60 40 20 0
B 120 Hemolysis(%)
Hemolysis(%)
A
353
100 80 60 40 20 0 0
30
60 90 120 Time (min)
150
Fig. 2. Liquid hemolytic activity. (A) E. coli expressing the hlyAeE, and hlyI were used to determine putative hemolytic activity encoded by these genes. E. coli carrying vector pGEX6P-1 alone was used as a control. Bacterial cells were incubated with sheep blood cells at 37 C for 120 min with shaking. Released hemoglobin was measured spectrophotometrically at an absorbance of 540 nm. (B) Kinetics of the hemolytic activity of E. coli expressing hlyA was quantified at different time points.
To investigate the effect of iron availability on the expression of the hly genes, real-time RT-PCR analysis was performed on cDNA prepared from RNA extracted from P. intermedia grown to midexponential phase under iron-repleted and iron-depleted conditions. Cultures grown under the iron-depleted conditions exhibited a slower growth rate than those grown under iron-replete conditions (Fig. 3B). The mRNA levels of the hlyC and hlyD genes were upregulated by 2.79- and 2.16-fold, respectively, under irondepleted conditions (Fig. 3A). The expression of the hlyA and hlyI genes was upregulated, though the increases were not significant (Fig. 3A). Transcripts for the hlyB and hlyE genes were not detectable under similar experimental conditions. 3.5. hly mRNA expression at different growth phases of P. intermedia using red blood cells as a source of iron To determine whether P. intermedia could use red blood cells as a source of iron, we investigated the effects of sheep red blood cells on its growth. As shown in Fig. 4A, the growth curves obtained for P. intermedia growing in THB-M medium supplemented with either red blood cells or heme were similar. To evaluate the contribution of hly genes identified in this study, we also analyzed the mRNA
Relative expression
A 1.5
hlyC
hlyA
*
3.5 3 2.5 2 1.5 1 0.5 0
**
1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
1 0.5 0
**
hlyD Relative expression
3.4. The expression of hly mRNA under iron-depleted conditions
levels of the hly genes when P. intermedia was grown to lag phase, mid-exponential phase, and late-exponential phase in the presence of red blood cells and heme (Fig. 4B). The mRNA transcript levels of the hlyB-E genes were not found to vary significantly in bacterial
B
2.5
hlyI
2 1.5 1 0.5 0
5 4
OD600
Furthermore, hemolytic activity was only detectable in the wholecell suspensions prepared from E. coli cells expressing the hlyA gene. Hemolytic assays were performed under aerobic and anaerobic conditions, and the rates of hemolysis were found to be similar (data not shown). While treatment with certain eSH containing compounds, including glutathione, cysteine, and DTT did not appear to affect the hemolytic activities of the E. coli cells expressing the hlyA-E genes after a 20 min exposure, cysteine did seem to increase the hemolytic activity of cells expressing the hlyI gene by w1.2-fold after a 120 min exposure (data not shown). We also examined the effects of temperature on the hemolytic activities of the putative hemolysins encoded by the various hly genes. After an initial incubation at 37 C for 60 min, red blood cells and bacteria were held at 4 C for a further 60 min. The shift to 4 C had little, if any, effect on the hemolytic activities exhibited by the E. coli cells expressing the relevant hly genes. To characterize the purified recombinant enzymes, the hlyA-E genes were expressed in E. coli BL21 and individually purified as a single protein band. However, none of the purified proteins showed hemolytic activity (data not shown). Although the reason why the purified recombinant HlyA lost its hemolytic activity is unclear, a similar loss of activity in purified recombinant hemolysins was reported in P. gingivalis [27] and P. melaninogenica [16].
3 2 1 0 0
5
10
15
20
25
Time (hours) Fig. 3. Analysis of hly mRNA expression under iron-deplete condition. RNA samples used in (A) were obtained from cultures shown in (B). (A) Real-time RT-PCR was used to determine the expression levels of the hly genes in bacteria grown under irondepleted and iron-replete conditions. Expression levels were normalized to the 16S rRNA internal control. The error bars indicate the variations of three biological replicates. Solid columns represent grown under iron-replete condition; open columns represent grown under iron-depleted conditions. *p < 0.05, **p < 0.01. (B) Growth curve of bacterial cultures grown in THB-M medium containing 7.7 mM heme (ironrepleted conditions) (-) or 125 mM 2,20 -Dipyridyl and 7.7 mM protoporphyrin IX (irondepleted conditions) (,). The time points of total RNA extraction were indicated by the relevant arrows.
354
A
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
6
OD600
5 4 3 2 1 0 0
5
10
15
20
25
Time (hours)
B Relative expression
hlyA
4 3
Relative expression
* *
2 1 0
hlyI
*
16 14 12 10 8 6 4 2 0
lag phase
mid exponential phase late exponential phase
*
* *
lag phase
mid exponential phase late exponential phase
Fig. 4. (A) The effect of red blood cells on the growth of P. intermedia. Growth curve of cultures grown in THB-M medium containing 7.7 mM heme (-) or 1% red blood cells as a source of iron (6). (B) Differential expression of hly genes in different growth phase. Real-time RT-PCR was used to determine the expression levels of the hly genes in bacteria grown under iron-replete conditions and in the presence of red blood cells in difference growth phases. The error bars indicate the variations of three biological replicates. Solid columns represent growth in the presence of heme; open columns represent grown under red blood cells. *p < 0.01.
cells grown in the presence of red blood cells or heme. The expression level of the hlyA gene was significantly enhanced, even in lag phase, and its high level expression was maintained throughout the growth of P. intermedia (lag phase, 2.89-fold; midlog phase, 2.19-fold; late-log phase, 3.36-fold) (Fig. 4B). The expression level of the hlyI gene was also enhanced throughout the P. intermedia growth (lag phase, 5.44-fold; mid-log phase, 4.01fold; late-log phase, 11.02-fold) (Fig. 4B). These results suggest that the hlyA and hlyI genes were expressed effectively when red blood cells rather than heme was used as a source of iron.
4. Discussion P. intermedia, one of periodontal pathogens, requires iron for its growth. Since red blood cells are usually abundant in inflamed periodontal pockets, it has been presumed that this pathogen
utilized heme as source of iron. Although hemolytic activities are thought to contribute to the acquisition of heme from red blood cells, the precise nature and actions of its hemolytic substances remain to be fully determined. In this study, we identified and analyzed several putative hemolysin genes (hly) encoding hemolytic substances (hemolysins). Six possible hemolysin-related genes (hlyA, B, C, D, E and hlyI) of P. intermedia ATCC25611 were identified by comparing their sequences to those of known hly genes of B. fragilis NCTC9343. The DNA sequence containing multiple hemolytic domains (ORF1, ORF2, and ORF3) previously isolated from P. intermedia strain 27 [22] was not found in the genome databases of P. intermedia 17 or in the genome DNA of P. intermedia ATCC25611 (data not shown). We interpreted this to mean that hemolysin genes are likely to differ from strain to strain. In addition, we previously identified hlyI as being an L-cysteine desulfhydrase (lcs) gene [24]. The LCS protein appears to be a cysteinedependent enzyme that produces hydrogen sulfide, pyruvate, and ammonia as end-products, and also appears to be responsible for hemoglobin-modification and hemolysis. The extent of the hemolytic activity of P. intermedia seems to vary with the type of red blood cells [9,28]. In an earlier study, we found that P. intermedia was able to lyse sheep red blood cells in solid and liquid hemolysis assays. In the present study, therefore, we used sheep red blood cells in our hemolysis assays. The hlyA-E and hlyI genes of P. intermedia were cloned, expressed in the host strain E. coli JW5181, and their associated hemolysins investigated for their ability to lyse red blood cells in solid and liquid assays. Plasmid constructs expressing the various hly genes were transformed into the E. coli JW5181 strain where the chromosomal gene for hemolysin ClyA (HlyE) [29] has been deleted. In the solid assay, E. coli cells expressing the hlyA gene produced b-hemolysis under both aerobic and anaerobic conditions, but E. coli cells expressing the hlyI gene produced b-hemolysis only under anaerobic conditions. As the hlyA-expressing E. coli produced b-hemolysis independent of the atmosphere, P. intermedia might prefer HlyA to lyse red blood cells. Robertson et al. [26] reported that the B. fragilis HlyA protein produced a-hemolysis under anaerobic condition, and b-hemolysis when produced together with the HlyB protein. These authors also suggested that HlyA and HlyB of B. fragilis combine to form a two component hemolysin, thereby enhancing their individual hemolytic activities against red blood cells. Therefore, an E. coli strain that co-expressed HlyA and HlyB was generated, and its hemolytic activity was compared to that of a HlyA-expressing E. coli strain. However, enhanced hemolytic activity, as shown for B. fragilis genes, was not observed for P. intermedia genes (data not shown). Here, we found that E. coli expressing HlyA alone produced b-hemolysis under aerobic and anaerobic conditions. In addition, little, if any, synergism existed between the hemolysins encoded by the hlyA and hlyB genes of P. intermedia. Our results suggest that the putative hemolysin encoded by the hlyA gene of P. intermedia might act differently to that encoded by the hlyA gene of B. fragilis. Liquid hemolysis assay using whole-cell suspensions of E. coli generated demonstrated that only E. coli cells expressing the hlyA gene exhibited strong hemolytic activity. Hemolytic activities in supernatants prepared from P. intermedia cultures have previously been characterized by Takada et al. [21]. These investigators also reported that their partially purified hemolytic substance, which they designated prevolysin O, was activated by certain reducing agents, including cysteine, glutathione, and DTT. However, we found that the hemolytic activities encoded by hlyA-E genes were not increased by the use of similar reducing agents. In addition, Lcs derived from the hlyI has been identified as a cysteine-dependent hemolysin in our previous study [24]. Our results led us to conclude that the hemolytic substance encoded by the hlyA-E and hlyI genes of P. intermedia is unlikely to be prevolysin O. We also
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
found that shifting the E. coli cells expressing the various hly genes from 37 C to 4 C for 60 min did not significantly impact upon their hemolytic activities. Thus, the hot/cold phenomenon which seemed to regulate the activities of the hemolysins produced by P. gingivalis [30] and T. denticola [31] does not appear to be important for regulating the actions of the hemolysins produced by P. intermedia. Yu et al. [32] reported that the transcript and protein levels of the hemin uptake receptors, PIN0009 and PINA0611, were induced in P. intermedia 17 grown under iron-depleted conditions. Thus, we used real-time RT-PCR to measure and compare the expression levels of the hly genes in bacteria grown in iron-replete and irondepleted conditions. As shown in Fig. 3A, the hlyC and D gene transcripts were significantly elevated in bacterial cells grown under iron-depleted conditions compared to those grown under iron-replete conditions. Conversely, the expression of the hlyA gene was not affected by iron conditions. Together, our results would seem to suggest that (i) the hlyA gene encodes a hemolysin that is active under iron-depleted conditions and whose expression is constitutive, and (ii) the iron-dependent regulation of the hlyC and hlyD genes might help P. intermedia to overcome the iron-depleted conditions it encounters in its relevant host. Our data provide new evidence that under iron-depleted conditions, genes related to hemolysis (initial step of heme acquisition) are also upregulated as shown for hemin uptake related genes. Transcriptional analysis of genes related to hemoglobin degradation may provide us valid information to understand how P. intermedia acquires iron from red blood cells to survive in the inflamed lesions. The ability of red blood cells to support the growth of P. intermedia was also studied. Similar growth curves were obtained for P. intermedia grown in iron-limited medium supplemented with red blood cells or heme. These results suggest that P. intermedia might be able to lyse red blood cells and to use heme as a source of iron to support its growth. Differential expression analysis of the hemin-binding related genes, hmuY, hmuR, and pg1237 of P. gingivalis, demonstrated that these gene expression levels were affected by growth phase [33]. On this line, we also found the differential expressions of the hlyA and hlyI genes in bacterial cells grown to lag phase, mid-log phase, and late-log phase, in the presence of red blood cells as compared to those under ironrepleted conditions. As shown in Fig. 4B, the high level expression of the hlyA was maintained throughout the P. intermedia growth. On the other hand, the expression level of the hlyI was always higher than that of the hlyA throughout the growth of this pathogen (Fig. 4B). Furthermore, the highest expression level of the hlyI gene was observed in late-log phase (Fig. 4B). Several factors may be involved in this late-log phase upregulation, such as higher level of metabolic wastes and degradation products of proteins. As Lcs is L-cysteine desulfhydrase, cysteine, containing in the growth media and/or accumulated metabolic products, may enhanced the expression of the hlyI gene. Our results suggest that the putative hemolysins encoded by the hlyA and hlyI genes are involved in the lysis of red blood cells, and that the protein products of these various hly genes might play important roles in the iron-dependent growth of P. intermedia. It is possible that, in vivo, hemolysin-induced lyses of red blood cells results in the release of hemoglobin; in turn, the hemoglobin might become a valuable source of heme if it is subsequently degraded by proteases, such as interpain A [19]. The heme could then be transported by hemin uptake receptors [32,34] and used by P. intermedia. The ability to extract heme from red blood cells in a highly hemorrhagic milieu provides an organism with a distinct advantage to grow and survive in the environment of the periodontium. Taken together, the results of our study on the hly genes of P. intermedia add to the growing number of virulence determinants
355
of this organism, and highlights potential therapeutic targets to help control the growth and emergence of this human pathogen. Acknowledgments This work was supported in part by a Grant-in-Aid for Scientific Research (C) (grant no. 22592048), and by the Private University High Technology Research Center Project (grant no. S1001010). References [1] Van der Weijden GA, Timmerman MF, Reijerse E, Wolffe GN, Van Winkelhoff AJ, Van der Velden U. The prevalence of A. actinomycetemcomitans, P. gingivalis and P. intermedia in selected subjects with periodontitis. Journal of Clinical Periodontology 1994;21:583e658. [2] Loesche WJ, Syed SA, Laughon BE, Stoll J. The bacteriology of acute necrotizing ulcerative gingivitis. Journal of Periodontology 1982;53:223e30. [3] Kornman KS, Loesche WJ. The subgingival microbial flora during pregnancy. Journal of Periodontal Research 1980;15:111e22. [4] Haffajee AD, Socransky SS. Microbial etiological agents of destructive periodontal diseases. Periodontology 2000 1994;5:78e111. [5] Gharbia SE, Haapasalo M, Shah HN, Kotiranta A, Lounatmaa K, Pearce MA, et al. Characterization of Prevotella intermedia and Prevotella nigrescens isolates from periodontic and endodontic infections. Journal of Periodontology 1994;65:56e61. [6] Dorn BR, Dunn Jr WA, Progulske-Fox A. Invasion of human coronary artery cells by periodontal pathogens. Infection and Immunity 1999;67:5792e8. [7] Jansen HJ, Grenier D, Van der Hoeven JS. Characterization of immunoglobulin G-degrading proteases of Prevotella intermedia and Prevotella nigrescens. Oral Microbiology and Immunology 1995;10:138e45. [8] Shenker BJ, Vitale L, Slots J. Immunosuppressive effects of Prevotella intermedia on in vitro human lymphocyte activation. Infection and Immunity 1991;59: 4583e9. [9] Beem JE, Nesbitt WE, Leung KP. Identification of hemolytic activity in Prevotella intermedia. Oral Microbiology and Immunology 1998;13:97e105. [10] Gibbons RJ, Macdonald JB. Hemin and vitamin K compounds as required factors for the cultivation of certain strains of Bacteroides melaninogenicus. Journal of Bacteriology 1960;80:164e70. [11] Li N, Yun P, Nadkarni MA, Ghadikolaee NB, Nguyen KA, Lee M, et al. Structure determination and analysis of a haemolytic gingipain adhesin domain from Porphyromonas gingivalis. Molecular Microbiology 2010;76:861e73. [12] Deshpande RG, Khan MB. Purification and characterization of hemolysin from Porphyromonas gingivalis A7436. FEMS Microbiology Letters 1999;176: 387e94. [13] Chu L, Kennell W, Holt SC. Characterization of hemolysis and hemoxidation activities by Treponema denticola. Microbial Pathogenesis 1994;16:183e95. [14] Chu L, Burgum A, Kolodrubetz D, Holt SC. The 46-kilodalton-hemolysin gene from Treponema denticola encodes a novel hemolysin homologous to aminotransferases. Infection and Immunity 1995;63:4448e55. [15] Kato T, Kimizuka R, Okuda K. Isolation and characterization of hemolytic genes from Actinobacillus actinomycetemcomitans. FEMS Microbiology Letters 1996;143:217e21. [16] Allison HE, Hillman JD. Cloning and characterization of a Prevotella melaninogenica hemolysin. Infection and Immunity 1997;65:2765e71. [17] Okamoto M, Maeda N, Kondo K, Leung KP. Hemolytic and hemagglutinating activities of Prevotella intermedia and Prevotella nigrescens. FEMS Microbiology Letters 1999;178:299e304. [18] Guan SM, Nagata H, Shizukuishi S, Wu JZ. Degradation of human hemoglobin by Prevotella intermedia. Anaerobe 2006;12:279e82. [19] Byrne DP, Wawrzonek K, Jaworska A, Birss AJ, Potempa J, Smalley JW. Role of the cysteine protease interpain A of Prevotella intermedia in breakdown and release of haem from haemoglobin. The Biochemical Journal 2010;425:257e64. [20] Tompkins GR, Wood DP, Birchmeier KR. Detection and comparison of specific hemin binding by Porphyromonas gingivalis and Prevotella intermedia. Journal of Bacteriology 1997;179:620e6. [21] Takada K, Fukatsu A, Otake S, Hirasawa M. Isolation and characterization of hemolysin activated by reductant from Prevotella intermedia. FEMS Immunology and Medical Microbiology 2003;35:43e7. [22] Beem JE, Nesbitt WE, Leung KP. Cloning of Prevotella intermedia loci demonstrating multiple hemolytic domains. Oral Microbiology and Immunology 1999;14:143e52. [23] Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular Systems Biology 2006 2006;2:0008. [24] Yano T, Fukamachi H, Yamamoto M, Igarashi T. Characterization of L-cysteine desulfhydrase from Prevotella intermedia. Oral Microbiology and Immunology 2009;24:485e92. [25] Abiko Y, Sato T, Mayanagi G, Takahashi N. Profiling of subgingival plaque biofilm microflora from periodontally healthy subjects and from subjects with periodontitis using quantitative real-time PCR. Journal of Periodontal Research 2010;45:389e95.
356
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
[26] Robertson KP, Smith CJ, Gough AM, Rocha ER. Characterization of Bacteroides fragilis hemolysins and regulation and synergistic interactions of HlyA and HlyB. Infection and Immunity 2006;74:2304e16. [27] Karunakaran T, Holt SC. Cloning of two distinct hemolysin genes from Porphyromonas (Bacteroides) gingivalis in Escherichia coli. Microbial Pathogenesis 1993;15:37e49. [28] Silva TA, Rodrigues PH, Ribeiro RN, Noronha FS, Farias Lde M, Carvalho MA. Hemolytic activity of Prevotella intermedia and Prevotella nigrescens strains: influence of abiotic factors in solid and liquid assays. Research in Microbiology 2003;154:29e35. [29] Wai SN, Westermark M, Oscarsson J, Jass J, Maier E, Benz R, et al. Characterization of dominantly negative mutant ClyA cytotoxin proteins in Escherichia coli. Journal of Bacteriology 2003;185:5491e9.
[30] Hoshi M, Kato I, Goto N, Hasegawa K. Hemolytic toxin produced by Porphyromonas gingivalis. FEMS Microbiology Letters 1993;114:273e7. [31] Grenier D. Characteristics of hemolytic and hemagglutinating activities of Treponema denticola. Oral Microbiology and Immunology 1991;6:246e9. [32] Yu F, Anaya C, Lewis JP. Outer membrane proteome of Prevotella intermedia 17: identification of thioredoxin and iron-repressible hemin uptake loci. Proteomics 2007;7:403e12. [33] Wu J, Lin X, Xie H. Regulation of hemin binding proteins by a novel transcriptional activator in Porphyromonas gingivalis. Journal of Bacteriology 2009; 191:115e22. [34] Lewis JP, Plata K, Yu F, Rosato A, Anaya C. Transcriptional organization, regulation and role of the Porphyromonas gingivalis W83 hmu haemin-uptake locus. Microbiology 2006;152:3367e82.
Contents lists available at SciVerse ScienceDirect
Anaerobe journal homepage: www.elsevier.com/locate/anaerobe
Molecular biology, genetics and biotechnology
Contribution of hly homologs to the hemolytic activity of Prevotella intermedia Naoko Suzuki a, Haruka Fukamachi b, Takafumi Arimoto b, *, Matsuo Yamamoto a, Takeshi Igarashi b a b
Department of Periodontology, Showa University School of Dentistry, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo 142-8555, Japan Department of Oral Microbiology, Showa University School of Dentistry, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo 142-8555, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 January 2012 Received in revised form 3 April 2012 Accepted 16 April 2012 Available online 25 April 2012
Prevotella intermedia is a periodontal pathogen that requires iron for its growth. Although this organism has hemolytic activity, the precise nature of its hemolytic substances and their associated hemolytic actions are yet to be fully determined. In the present study, we identified and characterized several putative hly genes in P. intermedia ATCC25611 which appear to encode hemolysins. Six hly genes (hlyA, B, C, D, E, and hlyI) of P. intermedia were identified by comparing their nucleotide sequences to those of known hly genes of Bacteroides fragilis NCTC9343. The hlyA-E, and hlyI genes were overexpressed individually in the non-hemolytic Escherichia coli strain JW5181 and examined its contribution to the hemolytic activity on sheep blood agar plates. E. coli cells expressing the hlyA and hlyI genes exhibited hemolytic activity under anaerobic conditions. On the other hand, only E. coli cells stably expressing the hlyA gene were able to lyse the red blood cells when cultured under aerobic conditions. In addition, expression of the hlyA and hlyI genes was significantly upregulated in the presence of red blood cells. Furthermore, we found that the growth of P. intermedia was similar in an iron-limited medium supplemented with either red blood cells or heme. Taken together, our results indicate that the hlyA and hlyI genes of P. intermedia encode putative hemolysins that appear to be involved in the lysis of red blood cells, and suggest that these hemolysins might play important roles in the iron-dependent growth of this organism. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Hemolytic activity Real-time RT-PCR Prevotella intermedia
1. Introduction Prevotella intermedia, a gram-negative, black-pigmented obligate anaerobic rod, is often isolated from periodontal lesions associated with various forms of periodontal disease, including chronic periodontitis, pregnancy gingivitis, and acute necrotizing ulcerative gingivitis [1e5]. P. intermedia appears to have a variety of virulence capabilities important for initiating and sustaining periodontal disease, including the capacity to invade eukaryotic cells [6], degrade immunoglobulins [7], suppress the immune functions of B and T cells [8], and lyse red blood cells via an associated hemolytic activity [9]. The ability of a pathogen to survive, proliferate, and establish infection in its relevant host is greatly influenced by the availability of essential nutrients. Iron appears to be an indispensable nutrient for P. intermedia [10]. In the human oral cavity, however, iron availability is limited by intracellular containment within ferritin, hemosiderin, and heme-containing proteins such as hemoglobin and myoglobin. Furthermore, free iron is maintained at a level too
* Corresponding author. Tel.: þ81 3 3784 8166; fax: þ81 3 3784 4105. E-mail address: [email protected] (T. Arimoto). 1075-9964/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.anaerobe.2012.04.005
low to support bacterial growth. Red blood cells are usually abundant in inflamed periodontal pockets, so heme could be one possible source of iron for bacteria. As P. intermedia is lacking in the ability to synthesize heme [10], this pathogen must have some means of acquiring the iron from red blood cells it needs to survive in its relevant host. Heme acquisition from red blood cells by bacteria usually involves hemolysis, hemoglobin binding, and the degradation of hemoglobin with the subsequent release of heme. In turn, free heme is bound and transported into the bacterial cell. Several studies have reported that periodontal pathogenic bacteria, including Porphyromonas gingivalis [11,12], Treponema denticola [13,14], Aggregatibacter actinomycetemcomitans [15], and Prevotella melaninogenica [16], are capable of producing hemolytic substances. Importantly, several reports exist in the literature showing that P. intermedia is also able to carry out hemolysis [9,17], hemoglobin degradation [18,19], and heme transportation [20], all of which supports the idea that P. intermedia might be able to use heme from red blood cells as a source of iron. Even though a hemolysin from P. intermedia has been partially purified and characterized [21], and a P. intermedia gene encoding multiple hemolytic domains has been cloned [22], the precise nature and mode(s) of action of the hemolytic substances produced by this organism remains to be determined.
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
In this study, we identified six possible hemolysin-related genes (hlyA, hlyB, hlyC, hlyD, hlyE, and hlyI) in the genomic database of P. intermedia 17. Each gene was introduced into non-hemolytic Escherichia coli cells in an appropriate vector, and the hemolytic activity of the transformed strains was subsequently examined. We also investigated the expression level of the hly genes throughout the growth of P. intermedia. Here, we determined the contribution of the hly genes to hemolytic activity of this pathogen. 2. Material and methods 2.1. Bacterial strains and culture conditions P. intermedia ATCC25611 was used in this study, and was maintained anaerobically (in an atmosphere of10% CO2, 10% H2, and 80% N2) at 37 C on tryptic soy agar supplemented with 5% sheep blood. E. coli JW5181 is a derivative of E. coli BW2511 (hlyE::Kmr) [23] and was cultured aerobically at 37 C in Luria-Bertani (LB) broth (Invitrogen, Carlsbad, CA, USA). Recombinant strains were grown in LB broth supplemented with ampicillin (50 mg/ml). 2.2. DNA manipulation P. intermedia ATCC25611 genomic DNA was extracted using the GenElute Bacterial genomic DNA kit (SigmaeAldrich, St. Louis, MO). Plasmid DNA was extracted using the Wizard miniprep purification kit (Promega, Madison, WI). Ligation of DNA was performed using the DNA Ligation Kit version 2 (TaKaRa Bio, Shiga, Japan). 2.3. Cloning, purification, and expression of recombinant hemolysins The primers and plasmids used in this study are listed in Table 1. The genome of P. intermedia 17 was used to design the primers for our study. The hlyA, hlyB, hlyC, hlyD, and hlyE genes were amplified from P. intermedia ATCC25611 using LA Taq DNA polymerase (TakaRa Bio) in a long and accurate polymerase chain reaction (LAPCR). The amplified fragments were digested with the appropriate restriction enzymes and ligated into the pGEX-6P-1 vector (GE Healthcare UK, Little Chalfont, UK). Each plasmid construct was then transformed into the non-hemolytic E. coli JW5181 strain. The pGEX-6P-1 carrying the hlyI gene of P. intermedia ATCC25611 was constructed as previously reported [24]. 2.4. Solid hemolysis assay E. coli JW5181 was used as the host strain to confirm that the cloned genes were not interfering with endogenous E. coli hemolytic activity. E. coli cells expressing the relevant hly genes (hlyA-E, and hlyI) were tested for their hemolytic activity on sheep blood agar plates. The bacterial cultures were plated onto sheep blood agar, and incubated either anaerobically at 37 C for four days or aerobically at 37 C for three days. Hemolytic activity was determined by comparing the hemolytic zones produced by the hlyexpressing bacterial cells to those produced by control E. coli JW5181 cells carrying an empty pGEX-6P-1 vector. 2.5. Liquid hemolysis assay A liquid hemolysis assay was carried out as described by Okamoto et al. [17] with minor modifications. Briefly, E. coli strains constructed in this study were washed with NCN buffer (150 mM sodium chloride, 3 mM sodium citrate [pH 6.8]), and then resuspended in NCN to a density of 1 109 CFU/ml. Equal volumes of the bacterial suspension and 2% (v/v) red blood cells were mixed, and
351
Table 1 Plasmids and primers used for this study. Plasmids or primer Primers pGEX-hlyA-F pGEX-hlyA-R pGEX-hlyB-F pGEX-hlyB-R pGEX-hlyC-F pGEX-hlyC-R pGEX-hlyD-F pGEX-hlyD-R pGEX-hlyE-F pGEX-hlyE-R Pi16SrRNA-F Pi16SrRNA-R real-hlyA-F real-hlyA-R real-hlyB-F real-hlyB-R real-hlyC-F real-hlyC-R real-hlyD-F real-hlyD-R real-hlyE-F real-hlyE-R real-hlyI-F real-hlyI-R Plasmids pGEX-hlyA pGEX-hlyB pGEX-hlyC pGEX-hlyD pGEX-hlyE a b c
Nucleotide sequence(50 /30 )
References
CGCGGATCCATGAAGGAAGAAGAGATTATa CGCGAATTCTTACCGCTCCTCGTAAATCACTTb AGAGGATCCATGGAGAGGACCATCGATATa CCCGAATTCCTAAAGTTCATATACCTTATCb CCGCCGAATTCTCTGAAATCGCTTTTTTCAGTTTGTCb GCGCCTCGAGCTACTTTTCATCTTGAATCGTTAC CCTGGATCCATGACGTTCCAGAAGGTTTTCa CCTGAATTCTTAGGGAACTGGGTCGTATCCb CTCCGGATCCCTGTCTTTGACATTGTCTGCa GGGGCTCGAGCTAAACGCTAACTTTTAGCTc TCCACCGATGAATCTTTGGTC ATCCAACCTTCCCTCCACTC TGGGTCGCTCTTTCGTTTCT ACCGTCCCAAAGATTATCGAGTGC ACAGGAACGGAATGGCTTACCGAA CGTTCTTGTCGGGCAAGTTT GCGAAAGCTGTCAATGGGCGAAAT ATGCCTTCAAGCATTTCCTGCTCG TTTATCAACGGTTTATCACGCCTTT TCAATGCTTGCTTTGCGTACTCCG TAACCTGTCCTGTTGCCGAATTGC ATGGTCGATGTCGTGGTTCTAGAC TTGCATTCGTAATCAGGGCTTGCG TTCGCTTCGAAGTCGTCCCAATCT
This This This This This This This This This This [25] [25] This This This This This This This This This This This This
study study study study study study study study study study
study study study study study study study study study study study study
pGEX6P-1 containing the hlyA from P. intermedia genomic DNA pGEX6P-1 containing the hlyB from P. intermedia genomic DNA pGEX6P-1 containing the hlyC from P. intermedia genomic DNA pGEX6P-1 containing the hlyD from P. intermedia genomic DNA pGEX6P-1 containing the hlyE from P. intermedia genomic DNA
The underlined sequence corresponds to BamH I sites. The underlined sequence corresponds to EcoR I sites. The underlined sequence corresponds to Xho I sites.
then incubated at 37 C. Spontaneous lysis was determined in the supernatant from the mixture of NCN buffer and red blood cells under the same conditions. After incubation, the test tubes were centrifuged at 1000 g for 5 min to pellet non-lysed red blood cells, before the optical density (OD540) of the supernatants was determined. A positive control for complete hemolysis (100%) was generated by replacing the same volume of bacterial suspension with distilled water in the assay. The percentage hemolysis was calculated as follows:
% hemolysis ¼ ðOD540 nm Test OD540 nm NCN=OD540 nm H2 O OD540 nm NCNÞ100 All assays were performed at least twice, and results presented as standard deviation (SD). 2.6. Cell preparation for gene expression analysis Three-day-old P. intermedia colonies maintained on blood agar plates were precultured in THB-M medium containing 3% ToddHewitt broth (Difco), 0.5% yeast extract, 0.075% cysteine, and 5 mg/mL menadione. After overnight incubation, cells (5% v/v) were transferred into THB-M and grown to exponential phase (OD600 w 1.5). To measure the expression levels of the hly genes under iron-replete and iron-depleted conditions, 7.7 mM heme (iron-repleted) and 125 mM of the iron scavenging compound, 2,20 -
352
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
Dipyridyl (iron-depleted), was added to THB-M, respectively. To the iron-depleted medium, 7.7 mM protoporphyrin IX (PPIX) was also added to compensate for the non-iron component of heme. To determine the effect of red blood cells, if any, on the expression of the hly genes in P. intermedia, 0.1% red blood cells were added to the THB-M medium. Cell cultures were harvested by centrifugation at 15,000 g for 10 min. Pellets (containing bacterial and red blood cells for samples and containing only red blood cells for reference control) were then washed (twice) in distilled water and resuspended in the original volume of PBS. The growth rate of P. intermedia in the presence of the red blood cells (as a source of iron) was determined by measuring the optical density (OD600) of the PBS suspension containing the resuspended bacterial cells. 2.7. RNA extraction and quantitative real-time PCR Total cellular RNA was isolated from P. intermedia ATCC25611 cells using the RNeasy mini kit (Qiagen), according to the manufacturer’s instructions. Traces of genomic DNA were removed by an additional treatment with TURBO DNA-freeÔ (Ambion, Austin, TX, USA) at 37 C for 30 min. Each RNA sample was then reverse transcribed into cDNA using the Quanti Tect Reverse Transcription kit (Qiagen). Primers used for real-time RT-PCR are listed in Table 1. Real-time PCR was performed in 1 SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK) with specific primer pairs (2 ng/mL) and 0.5 ng/mL cDNA in a 20-mL sample volume. The realtime PCR protocol included an initial denaturation at 95 C for 90 s, followed by 40 cycles with two steps each at 95 C for 5 s, and 60 C for 1 min. Non-template controls were included to confirm the absence of primer-dimer formation. All samples including nontemplate controls were run in triplicate on an ABI-Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The expression level of each gene (hlyA, hlyB, hlyC, hlyD, hlyE, and hlyI) was normalized to the expression of the 16S rRNA gene of P. intermedia [25]. Values are expressed as fold increases in mRNA levels relative to the control.
fragilis. The hlyA-E, and hlyI genes of B. fragilis NCTC9343 [26] and those of P. intermedia ATCC25611 shared 64.4%, 58.7%, 55.2%, 63.9%, 56.3%, and 54.2% homology, respectively. The sizes of the hlyA, hlyB, hlyC, hlyD, hlyE, and hlyI PCR fragments obtained from P. intermedia were found to be 990 bp, 771 bp, 1230 bp, 246 bp, 1227 bp, and 1170 bp, respectively; in turn, the molecular weights of their predicted proteins were calculated to be 37,839 Da, 31,688 Da, 49,690 Da, 9432 Da, 46,502 Da, and 44,415 Da, respectively. Southern analysis, using the hlyA, hlyB, hlyC, hlyD, hlyE, and hlyI PCR fragments as probes against appropriately digested P. intermedia ATCC25611 chromosomal DNA, revealed a single band corresponding to the relevant gene. The hlyA gene of P. intermedia was found to share homology with the phyA gene of P. melaninogenica [16]. Furthermore, the corresponding HlyA and PhyA proteins were 82% identical at the amino acid sequence level. Beem et al. [22] cloned a 3.9 kb DNA fragment containing multiple hemolytic ORFs (ORF1, ORF2, and ORF3) that appear to be required for hemolysin production in P. intermedia 27. While the ORF3 of P. intermedia 27 shared significant sequence homology with the hlyF gene of B. fragilis NCTC9343, we failed to find an ORF3 homolog in the genome database of P. intermedia 17. In addition, the hlyF fragment from B. fragilis failed to adhere to appropriately digested genomic DNA of P. intermedia ATCC25611 used in our Southern hybridization experiments (data not shown). 3.2. Hemolytic activity of E. coli JW5181 cells expressing the relevant hemolysin genes of P. intermedia To characterize the various hemolysin genes of P. intermedia at the molecular level, the hlyA-E, and hlyI genes were cloned, expressed in the host strain E. coli JW5181, and their encoded hemolysins subsequently investigated for their ability to lyse red blood cells in a solid assay. Fig. 1 shows that E. coli cells expressing the hlyA gene produced b-hemolysis under aerobic condition after 3 days of incubation (Fig. 1A). We, also found that E. coli cells expressing the hlyA and hlyI genes exhibited hemolytic activities under anaerobic conditions after 4 days of incubation (Fig. 1B).
3. Results 3.3. Liquid hemolytic activity 3.1. Analysis of the hly genes from P. intermedia ATCC25611 A search of the genome of P. intermedia 17 revealed the presence of six putative genes (hlyA, PI1901; hlyB, PI1900; hlyC, PI1162; hlyD, PI0084; hlyE, pPI0237; and hlyI, PI0305) that shared sequence homology with certain hemolysin-encoding genes of Bacteroides
The hemolytic activity encoded by the hly genes was determined in a liquid hemolysis assay using whole-cell preparations and sheep red blood cells. As shown in Fig. 2A, E. coli cells expressing the hlyA gene showed strong hemolytic activity, and 100% of the red blood cells were lysed in just over a 50 min incubation period (Fig. 2B).
Fig. 1. Hemolytic activity of E. coli JW5181 (hlyE::Kmr) transformed with pGEX constructs carrying P. intermedia hemolytic genes. Bacteria were grown aerobically (A) and anaerobically (B) on sheep blood agar plates. Hemolytic activity was determined by the appearance of a clear zone around the colonies.
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
100 80 60 40 20 0
B 120 Hemolysis(%)
Hemolysis(%)
A
353
100 80 60 40 20 0 0
30
60 90 120 Time (min)
150
Fig. 2. Liquid hemolytic activity. (A) E. coli expressing the hlyAeE, and hlyI were used to determine putative hemolytic activity encoded by these genes. E. coli carrying vector pGEX6P-1 alone was used as a control. Bacterial cells were incubated with sheep blood cells at 37 C for 120 min with shaking. Released hemoglobin was measured spectrophotometrically at an absorbance of 540 nm. (B) Kinetics of the hemolytic activity of E. coli expressing hlyA was quantified at different time points.
To investigate the effect of iron availability on the expression of the hly genes, real-time RT-PCR analysis was performed on cDNA prepared from RNA extracted from P. intermedia grown to midexponential phase under iron-repleted and iron-depleted conditions. Cultures grown under the iron-depleted conditions exhibited a slower growth rate than those grown under iron-replete conditions (Fig. 3B). The mRNA levels of the hlyC and hlyD genes were upregulated by 2.79- and 2.16-fold, respectively, under irondepleted conditions (Fig. 3A). The expression of the hlyA and hlyI genes was upregulated, though the increases were not significant (Fig. 3A). Transcripts for the hlyB and hlyE genes were not detectable under similar experimental conditions. 3.5. hly mRNA expression at different growth phases of P. intermedia using red blood cells as a source of iron To determine whether P. intermedia could use red blood cells as a source of iron, we investigated the effects of sheep red blood cells on its growth. As shown in Fig. 4A, the growth curves obtained for P. intermedia growing in THB-M medium supplemented with either red blood cells or heme were similar. To evaluate the contribution of hly genes identified in this study, we also analyzed the mRNA
Relative expression
A 1.5
hlyC
hlyA
*
3.5 3 2.5 2 1.5 1 0.5 0
**
1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
1 0.5 0
**
hlyD Relative expression
3.4. The expression of hly mRNA under iron-depleted conditions
levels of the hly genes when P. intermedia was grown to lag phase, mid-exponential phase, and late-exponential phase in the presence of red blood cells and heme (Fig. 4B). The mRNA transcript levels of the hlyB-E genes were not found to vary significantly in bacterial
B
2.5
hlyI
2 1.5 1 0.5 0
5 4
OD600
Furthermore, hemolytic activity was only detectable in the wholecell suspensions prepared from E. coli cells expressing the hlyA gene. Hemolytic assays were performed under aerobic and anaerobic conditions, and the rates of hemolysis were found to be similar (data not shown). While treatment with certain eSH containing compounds, including glutathione, cysteine, and DTT did not appear to affect the hemolytic activities of the E. coli cells expressing the hlyA-E genes after a 20 min exposure, cysteine did seem to increase the hemolytic activity of cells expressing the hlyI gene by w1.2-fold after a 120 min exposure (data not shown). We also examined the effects of temperature on the hemolytic activities of the putative hemolysins encoded by the various hly genes. After an initial incubation at 37 C for 60 min, red blood cells and bacteria were held at 4 C for a further 60 min. The shift to 4 C had little, if any, effect on the hemolytic activities exhibited by the E. coli cells expressing the relevant hly genes. To characterize the purified recombinant enzymes, the hlyA-E genes were expressed in E. coli BL21 and individually purified as a single protein band. However, none of the purified proteins showed hemolytic activity (data not shown). Although the reason why the purified recombinant HlyA lost its hemolytic activity is unclear, a similar loss of activity in purified recombinant hemolysins was reported in P. gingivalis [27] and P. melaninogenica [16].
3 2 1 0 0
5
10
15
20
25
Time (hours) Fig. 3. Analysis of hly mRNA expression under iron-deplete condition. RNA samples used in (A) were obtained from cultures shown in (B). (A) Real-time RT-PCR was used to determine the expression levels of the hly genes in bacteria grown under irondepleted and iron-replete conditions. Expression levels were normalized to the 16S rRNA internal control. The error bars indicate the variations of three biological replicates. Solid columns represent grown under iron-replete condition; open columns represent grown under iron-depleted conditions. *p < 0.05, **p < 0.01. (B) Growth curve of bacterial cultures grown in THB-M medium containing 7.7 mM heme (ironrepleted conditions) (-) or 125 mM 2,20 -Dipyridyl and 7.7 mM protoporphyrin IX (irondepleted conditions) (,). The time points of total RNA extraction were indicated by the relevant arrows.
354
A
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
6
OD600
5 4 3 2 1 0 0
5
10
15
20
25
Time (hours)
B Relative expression
hlyA
4 3
Relative expression
* *
2 1 0
hlyI
*
16 14 12 10 8 6 4 2 0
lag phase
mid exponential phase late exponential phase
*
* *
lag phase
mid exponential phase late exponential phase
Fig. 4. (A) The effect of red blood cells on the growth of P. intermedia. Growth curve of cultures grown in THB-M medium containing 7.7 mM heme (-) or 1% red blood cells as a source of iron (6). (B) Differential expression of hly genes in different growth phase. Real-time RT-PCR was used to determine the expression levels of the hly genes in bacteria grown under iron-replete conditions and in the presence of red blood cells in difference growth phases. The error bars indicate the variations of three biological replicates. Solid columns represent growth in the presence of heme; open columns represent grown under red blood cells. *p < 0.01.
cells grown in the presence of red blood cells or heme. The expression level of the hlyA gene was significantly enhanced, even in lag phase, and its high level expression was maintained throughout the growth of P. intermedia (lag phase, 2.89-fold; midlog phase, 2.19-fold; late-log phase, 3.36-fold) (Fig. 4B). The expression level of the hlyI gene was also enhanced throughout the P. intermedia growth (lag phase, 5.44-fold; mid-log phase, 4.01fold; late-log phase, 11.02-fold) (Fig. 4B). These results suggest that the hlyA and hlyI genes were expressed effectively when red blood cells rather than heme was used as a source of iron.
4. Discussion P. intermedia, one of periodontal pathogens, requires iron for its growth. Since red blood cells are usually abundant in inflamed periodontal pockets, it has been presumed that this pathogen
utilized heme as source of iron. Although hemolytic activities are thought to contribute to the acquisition of heme from red blood cells, the precise nature and actions of its hemolytic substances remain to be fully determined. In this study, we identified and analyzed several putative hemolysin genes (hly) encoding hemolytic substances (hemolysins). Six possible hemolysin-related genes (hlyA, B, C, D, E and hlyI) of P. intermedia ATCC25611 were identified by comparing their sequences to those of known hly genes of B. fragilis NCTC9343. The DNA sequence containing multiple hemolytic domains (ORF1, ORF2, and ORF3) previously isolated from P. intermedia strain 27 [22] was not found in the genome databases of P. intermedia 17 or in the genome DNA of P. intermedia ATCC25611 (data not shown). We interpreted this to mean that hemolysin genes are likely to differ from strain to strain. In addition, we previously identified hlyI as being an L-cysteine desulfhydrase (lcs) gene [24]. The LCS protein appears to be a cysteinedependent enzyme that produces hydrogen sulfide, pyruvate, and ammonia as end-products, and also appears to be responsible for hemoglobin-modification and hemolysis. The extent of the hemolytic activity of P. intermedia seems to vary with the type of red blood cells [9,28]. In an earlier study, we found that P. intermedia was able to lyse sheep red blood cells in solid and liquid hemolysis assays. In the present study, therefore, we used sheep red blood cells in our hemolysis assays. The hlyA-E and hlyI genes of P. intermedia were cloned, expressed in the host strain E. coli JW5181, and their associated hemolysins investigated for their ability to lyse red blood cells in solid and liquid assays. Plasmid constructs expressing the various hly genes were transformed into the E. coli JW5181 strain where the chromosomal gene for hemolysin ClyA (HlyE) [29] has been deleted. In the solid assay, E. coli cells expressing the hlyA gene produced b-hemolysis under both aerobic and anaerobic conditions, but E. coli cells expressing the hlyI gene produced b-hemolysis only under anaerobic conditions. As the hlyA-expressing E. coli produced b-hemolysis independent of the atmosphere, P. intermedia might prefer HlyA to lyse red blood cells. Robertson et al. [26] reported that the B. fragilis HlyA protein produced a-hemolysis under anaerobic condition, and b-hemolysis when produced together with the HlyB protein. These authors also suggested that HlyA and HlyB of B. fragilis combine to form a two component hemolysin, thereby enhancing their individual hemolytic activities against red blood cells. Therefore, an E. coli strain that co-expressed HlyA and HlyB was generated, and its hemolytic activity was compared to that of a HlyA-expressing E. coli strain. However, enhanced hemolytic activity, as shown for B. fragilis genes, was not observed for P. intermedia genes (data not shown). Here, we found that E. coli expressing HlyA alone produced b-hemolysis under aerobic and anaerobic conditions. In addition, little, if any, synergism existed between the hemolysins encoded by the hlyA and hlyB genes of P. intermedia. Our results suggest that the putative hemolysin encoded by the hlyA gene of P. intermedia might act differently to that encoded by the hlyA gene of B. fragilis. Liquid hemolysis assay using whole-cell suspensions of E. coli generated demonstrated that only E. coli cells expressing the hlyA gene exhibited strong hemolytic activity. Hemolytic activities in supernatants prepared from P. intermedia cultures have previously been characterized by Takada et al. [21]. These investigators also reported that their partially purified hemolytic substance, which they designated prevolysin O, was activated by certain reducing agents, including cysteine, glutathione, and DTT. However, we found that the hemolytic activities encoded by hlyA-E genes were not increased by the use of similar reducing agents. In addition, Lcs derived from the hlyI has been identified as a cysteine-dependent hemolysin in our previous study [24]. Our results led us to conclude that the hemolytic substance encoded by the hlyA-E and hlyI genes of P. intermedia is unlikely to be prevolysin O. We also
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
found that shifting the E. coli cells expressing the various hly genes from 37 C to 4 C for 60 min did not significantly impact upon their hemolytic activities. Thus, the hot/cold phenomenon which seemed to regulate the activities of the hemolysins produced by P. gingivalis [30] and T. denticola [31] does not appear to be important for regulating the actions of the hemolysins produced by P. intermedia. Yu et al. [32] reported that the transcript and protein levels of the hemin uptake receptors, PIN0009 and PINA0611, were induced in P. intermedia 17 grown under iron-depleted conditions. Thus, we used real-time RT-PCR to measure and compare the expression levels of the hly genes in bacteria grown in iron-replete and irondepleted conditions. As shown in Fig. 3A, the hlyC and D gene transcripts were significantly elevated in bacterial cells grown under iron-depleted conditions compared to those grown under iron-replete conditions. Conversely, the expression of the hlyA gene was not affected by iron conditions. Together, our results would seem to suggest that (i) the hlyA gene encodes a hemolysin that is active under iron-depleted conditions and whose expression is constitutive, and (ii) the iron-dependent regulation of the hlyC and hlyD genes might help P. intermedia to overcome the iron-depleted conditions it encounters in its relevant host. Our data provide new evidence that under iron-depleted conditions, genes related to hemolysis (initial step of heme acquisition) are also upregulated as shown for hemin uptake related genes. Transcriptional analysis of genes related to hemoglobin degradation may provide us valid information to understand how P. intermedia acquires iron from red blood cells to survive in the inflamed lesions. The ability of red blood cells to support the growth of P. intermedia was also studied. Similar growth curves were obtained for P. intermedia grown in iron-limited medium supplemented with red blood cells or heme. These results suggest that P. intermedia might be able to lyse red blood cells and to use heme as a source of iron to support its growth. Differential expression analysis of the hemin-binding related genes, hmuY, hmuR, and pg1237 of P. gingivalis, demonstrated that these gene expression levels were affected by growth phase [33]. On this line, we also found the differential expressions of the hlyA and hlyI genes in bacterial cells grown to lag phase, mid-log phase, and late-log phase, in the presence of red blood cells as compared to those under ironrepleted conditions. As shown in Fig. 4B, the high level expression of the hlyA was maintained throughout the P. intermedia growth. On the other hand, the expression level of the hlyI was always higher than that of the hlyA throughout the growth of this pathogen (Fig. 4B). Furthermore, the highest expression level of the hlyI gene was observed in late-log phase (Fig. 4B). Several factors may be involved in this late-log phase upregulation, such as higher level of metabolic wastes and degradation products of proteins. As Lcs is L-cysteine desulfhydrase, cysteine, containing in the growth media and/or accumulated metabolic products, may enhanced the expression of the hlyI gene. Our results suggest that the putative hemolysins encoded by the hlyA and hlyI genes are involved in the lysis of red blood cells, and that the protein products of these various hly genes might play important roles in the iron-dependent growth of P. intermedia. It is possible that, in vivo, hemolysin-induced lyses of red blood cells results in the release of hemoglobin; in turn, the hemoglobin might become a valuable source of heme if it is subsequently degraded by proteases, such as interpain A [19]. The heme could then be transported by hemin uptake receptors [32,34] and used by P. intermedia. The ability to extract heme from red blood cells in a highly hemorrhagic milieu provides an organism with a distinct advantage to grow and survive in the environment of the periodontium. Taken together, the results of our study on the hly genes of P. intermedia add to the growing number of virulence determinants
355
of this organism, and highlights potential therapeutic targets to help control the growth and emergence of this human pathogen. Acknowledgments This work was supported in part by a Grant-in-Aid for Scientific Research (C) (grant no. 22592048), and by the Private University High Technology Research Center Project (grant no. S1001010). References [1] Van der Weijden GA, Timmerman MF, Reijerse E, Wolffe GN, Van Winkelhoff AJ, Van der Velden U. The prevalence of A. actinomycetemcomitans, P. gingivalis and P. intermedia in selected subjects with periodontitis. Journal of Clinical Periodontology 1994;21:583e658. [2] Loesche WJ, Syed SA, Laughon BE, Stoll J. The bacteriology of acute necrotizing ulcerative gingivitis. Journal of Periodontology 1982;53:223e30. [3] Kornman KS, Loesche WJ. The subgingival microbial flora during pregnancy. Journal of Periodontal Research 1980;15:111e22. [4] Haffajee AD, Socransky SS. Microbial etiological agents of destructive periodontal diseases. Periodontology 2000 1994;5:78e111. [5] Gharbia SE, Haapasalo M, Shah HN, Kotiranta A, Lounatmaa K, Pearce MA, et al. Characterization of Prevotella intermedia and Prevotella nigrescens isolates from periodontic and endodontic infections. Journal of Periodontology 1994;65:56e61. [6] Dorn BR, Dunn Jr WA, Progulske-Fox A. Invasion of human coronary artery cells by periodontal pathogens. Infection and Immunity 1999;67:5792e8. [7] Jansen HJ, Grenier D, Van der Hoeven JS. Characterization of immunoglobulin G-degrading proteases of Prevotella intermedia and Prevotella nigrescens. Oral Microbiology and Immunology 1995;10:138e45. [8] Shenker BJ, Vitale L, Slots J. Immunosuppressive effects of Prevotella intermedia on in vitro human lymphocyte activation. Infection and Immunity 1991;59: 4583e9. [9] Beem JE, Nesbitt WE, Leung KP. Identification of hemolytic activity in Prevotella intermedia. Oral Microbiology and Immunology 1998;13:97e105. [10] Gibbons RJ, Macdonald JB. Hemin and vitamin K compounds as required factors for the cultivation of certain strains of Bacteroides melaninogenicus. Journal of Bacteriology 1960;80:164e70. [11] Li N, Yun P, Nadkarni MA, Ghadikolaee NB, Nguyen KA, Lee M, et al. Structure determination and analysis of a haemolytic gingipain adhesin domain from Porphyromonas gingivalis. Molecular Microbiology 2010;76:861e73. [12] Deshpande RG, Khan MB. Purification and characterization of hemolysin from Porphyromonas gingivalis A7436. FEMS Microbiology Letters 1999;176: 387e94. [13] Chu L, Kennell W, Holt SC. Characterization of hemolysis and hemoxidation activities by Treponema denticola. Microbial Pathogenesis 1994;16:183e95. [14] Chu L, Burgum A, Kolodrubetz D, Holt SC. The 46-kilodalton-hemolysin gene from Treponema denticola encodes a novel hemolysin homologous to aminotransferases. Infection and Immunity 1995;63:4448e55. [15] Kato T, Kimizuka R, Okuda K. Isolation and characterization of hemolytic genes from Actinobacillus actinomycetemcomitans. FEMS Microbiology Letters 1996;143:217e21. [16] Allison HE, Hillman JD. Cloning and characterization of a Prevotella melaninogenica hemolysin. Infection and Immunity 1997;65:2765e71. [17] Okamoto M, Maeda N, Kondo K, Leung KP. Hemolytic and hemagglutinating activities of Prevotella intermedia and Prevotella nigrescens. FEMS Microbiology Letters 1999;178:299e304. [18] Guan SM, Nagata H, Shizukuishi S, Wu JZ. Degradation of human hemoglobin by Prevotella intermedia. Anaerobe 2006;12:279e82. [19] Byrne DP, Wawrzonek K, Jaworska A, Birss AJ, Potempa J, Smalley JW. Role of the cysteine protease interpain A of Prevotella intermedia in breakdown and release of haem from haemoglobin. The Biochemical Journal 2010;425:257e64. [20] Tompkins GR, Wood DP, Birchmeier KR. Detection and comparison of specific hemin binding by Porphyromonas gingivalis and Prevotella intermedia. Journal of Bacteriology 1997;179:620e6. [21] Takada K, Fukatsu A, Otake S, Hirasawa M. Isolation and characterization of hemolysin activated by reductant from Prevotella intermedia. FEMS Immunology and Medical Microbiology 2003;35:43e7. [22] Beem JE, Nesbitt WE, Leung KP. Cloning of Prevotella intermedia loci demonstrating multiple hemolytic domains. Oral Microbiology and Immunology 1999;14:143e52. [23] Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular Systems Biology 2006 2006;2:0008. [24] Yano T, Fukamachi H, Yamamoto M, Igarashi T. Characterization of L-cysteine desulfhydrase from Prevotella intermedia. Oral Microbiology and Immunology 2009;24:485e92. [25] Abiko Y, Sato T, Mayanagi G, Takahashi N. Profiling of subgingival plaque biofilm microflora from periodontally healthy subjects and from subjects with periodontitis using quantitative real-time PCR. Journal of Periodontal Research 2010;45:389e95.
356
N. Suzuki et al. / Anaerobe 18 (2012) 350e356
[26] Robertson KP, Smith CJ, Gough AM, Rocha ER. Characterization of Bacteroides fragilis hemolysins and regulation and synergistic interactions of HlyA and HlyB. Infection and Immunity 2006;74:2304e16. [27] Karunakaran T, Holt SC. Cloning of two distinct hemolysin genes from Porphyromonas (Bacteroides) gingivalis in Escherichia coli. Microbial Pathogenesis 1993;15:37e49. [28] Silva TA, Rodrigues PH, Ribeiro RN, Noronha FS, Farias Lde M, Carvalho MA. Hemolytic activity of Prevotella intermedia and Prevotella nigrescens strains: influence of abiotic factors in solid and liquid assays. Research in Microbiology 2003;154:29e35. [29] Wai SN, Westermark M, Oscarsson J, Jass J, Maier E, Benz R, et al. Characterization of dominantly negative mutant ClyA cytotoxin proteins in Escherichia coli. Journal of Bacteriology 2003;185:5491e9.
[30] Hoshi M, Kato I, Goto N, Hasegawa K. Hemolytic toxin produced by Porphyromonas gingivalis. FEMS Microbiology Letters 1993;114:273e7. [31] Grenier D. Characteristics of hemolytic and hemagglutinating activities of Treponema denticola. Oral Microbiology and Immunology 1991;6:246e9. [32] Yu F, Anaya C, Lewis JP. Outer membrane proteome of Prevotella intermedia 17: identification of thioredoxin and iron-repressible hemin uptake loci. Proteomics 2007;7:403e12. [33] Wu J, Lin X, Xie H. Regulation of hemin binding proteins by a novel transcriptional activator in Porphyromonas gingivalis. Journal of Bacteriology 2009; 191:115e22. [34] Lewis JP, Plata K, Yu F, Rosato A, Anaya C. Transcriptional organization, regulation and role of the Porphyromonas gingivalis W83 hmu haemin-uptake locus. Microbiology 2006;152:3367e82.