Control and optimization of nitrifying communities for nitritation from domestic wastewater at room temperatures

Enzyme and Microbial Technology 45 (2009) 226–232

Contents lists available at ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Control and optimization of nitrifying communities for nitritation from domestic wastewater at room temperatures Wei Zeng ∗ , Yue Zhang, Lei Li, Yong-zhen Peng, Shu-ying Wang Key Laboratory of Beijing for Water Quality Science and Water Environment Recovery Engineering, College of Environmental and Energy Engineering, Beijing University of Technology, Beijing, 100124, China

a r t i c l e

i n f o

Article history: Received 12 February 2009 Received in revised form 27 April 2009 Accepted 13 May 2009 Keywords: Nitritation Domestic wastewater Room temperature Ammonia oxidizing bacteria

a b s t r a c t To achieve nitritation from complete-nitrification seed sludge at room temperature of 19 ± 1 ◦ C, a labscale sequencing batch reactor (SBR) treating domestic wastewater with low C/N ratios was operated to investigate the control and optimization of nitrifying communities. Ammonia oxidizing bacteria (AOB) dominance was enhanced through the combination of low DO concentrations (<1.0 mg/L) and preset short-cycle control of aeration time. Nitritation was successfully established with NO2 − -N/NOx − -N over 95%. To avoid the adverse impact of low DO concentrations on AOB activities, DO concentrations were increased to 1–2 mg/L. At the normal DO levels and temperatures, on-line control strategy of aerobic durations maintained the stability of nitritation with nitrite accumulation rate over 95% and ammonia removal above 97%. Fluorescence in-situ hybridization (FISH) analysis presented that the maximal percentage of AOB in biomass reached 10.9% and nitrite oxidizing bacteria (NOB) were washed out. © 2009 Elsevier Inc. All rights reserved.

1. Introduction Biological nitrification–denitrification is the most commonly used process for nitrogen removal from wastewater. Complete nitrification implies the oxidation of ammonia to nitrite, and then to nitrate, whereas denitrification is the anoxic reduction of nitrate into nitrite, then into nitrous oxide, nitric oxide, and finally into N2 gas. Among many innovative technologies for nitrogen removal, nitrogen removal via nitrite was reported to be technically feasible and economically favorable [1], which termed partial nitrification of NH4 + to nitrite (nitritation) and subsequently direct reduction of nitrite to N2 gas (denitritation) [2,3]. Therefore, in comparison with complete nitrification–denitrification, nitritation-denitritation saves 25% of aeration energy and 40% of COD demand for denitrification, as well as lower biomass production and increased kinetics [4,5]. With regard to the domestic wastewater, nitrogen removal via nitrite is particularly significant because the soluble COD in it is typically limiting. Another new and promising process for nitrogen removal is anaerobic ammonium oxidation (anammox), in which ammonium is directly converted to nitrogen gas with nitrite as the electron acceptor under anoxic conditions [6]. The application of anammox would lead to a significant saving of aeration cost and external electron donor as compared with the conventional nitrification–denitrification

∗ Corresponding author. Tel.: +86 10 67391918; fax: +86 10 67392627. E-mail address: [email protected] (W. Zeng). 0141-0229/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.enzmictec.2009.05.011

process [7]. However, due to very slow growth rates of anammox bacteria and high susceptivity to environmental conditions, anammox bacteria are very difficult to be cultured and enriched. This results in a long start-up period of anmmox process, and thus becomes a major obstacle in the anammox application [7]. The key point of achieving nitrogen removal via nitrite is to oxidize ammonia to nitrite instead of nitrate and maintain a stable nitrite accumulation rate. That is, ammonia oxidizing bacteria (AOB) become dominant nitrifying bacteria and nitrite oxidizing bacteria (NOB) are inhibited or washout. Many studies have been showing the main factors to affect the nitrite buildup, such as higher temperature [8,9], short SRT [8], low DO concentration [10–12] and higher free ammonia (FA) concentration [13–15]. Present researches show that high temperature of 28–38 ◦ C is favorable for nitrogen removal via nitrite due to the specific growth rate of AOB higher than that of NOB [16]. SHARON process created by Delft University of Technology is a successful full-scale application of nitritation–denitritation at high temperatures of 30–35 ◦ C and SRT of 1.5 days [8]. The researches about the effect of temperature on nitritation can be grouped into two classes: (1) achievement and maintenance of nitritation at high temperatures of 28–35 ◦ C [17], and (2) start-up of nitritation at high temperatures, and then temperatures gradually declined and nitritation was maintained at room or low temperatures [18]. Some researches also proved that nitritation start-up could be promoted and accelerated at high temperatures [19]. However, the temperatures of real domes-

W. Zeng et al. / Enzyme and Microbial Technology 45 (2009) 226–232

tic wastewater (usually at 10–25 ◦ C), especially in winter, cannot reach the optimal temperature of 30 ◦ C for nitrogen removal via nitrite. In the temperature range of 10–20 ◦ C, a high nitrite accumulation rate can hardly be maintained due to the specific growth rate of NOB higher than that of AOB [20]. Therefore, relatively low wastewater temperature is the major obstacle for achievement and full-scale application of nitrogen removal via nitrite. Very limited research has been undertaken on nitritation start-up from seed sludge with complete nitrification–denitrification at room temperatures. Since both temperature and FA concentration of domestic wastewater cannot reach the optimal values for nitrogen removal via nitrite, DO concentration and pH control became the main method to establish nitritation. Due to the stronger DO affinity of AOB than NOB at low DO concentrations, nitrite accumulation occurred at DO concentration of 0.5–1.0 mg/L, as well as aeration energy savings [21–24]. However, long-term operation with low DO concentration would result in AOB activities inhibited, nitritation rate declining as well as sludge bulking easily occurring. Previous researches also proved that the “ammonia valley” in pH-time profile indicated the end of ammonia oxidizing to nitrite, and could be used for on-line control of aerobic duration to maintain a high nitrite accumulation rate [18,19]. The pH “ammonia valley” can be detected due to the change of pH values from slowly declining during nitritation to a sudden rise at the end of ammonia oxidizing to nitrite. The on-line control of aerobic duration based on the pH “ammonia valley” is an effective method for achievement of nitrogen removal via nitrite in high temperature wastewater treatment system [19]. Peng et al. suggested that long-term application of real-time control of aeration time was crucial for stable partial nitrification via nitrite [24,25]. This study aimed to (1) investigate the effects of combination of DO concentration control and aeration time control based on pH-time variations on the establishment of nitritation at room temperatures, (2) achieve nitritation at the temperature of 19 ± 1 ◦ C, i.e., wash out NOB from seed sludge with complete nitrification–denitrification and make AOB become dominant nitrifying bacteria by appropriately regulating the competition of AOB and NOB, and (3) develop an effective control method for stable performance of nitrogen removal via nitrite with the higher nitritation rates and total nitrogen (TN) removal efficiencies at room temperatures. 2. Materials and methods 2.1. Wastewater and seed sludge The real domestic wastewater with low C/N ratio of 2:1 was used as influent. Everyday the real domestic wastewater from one septic tank of residential district near our campus was pumped into influent tank in the laboratory just before experiment. After sedimentation for 0.5 h, the wastewater was fed into reactor. The composition of the domestic wastewater is shown in Table 1. The inoculated sludge with complete nitrification–denitrification was taken from the recycling sludge of Gaobeidian municipal wastewater treatment plant in Beijing. Fluorescence in-situ hybridization (FISH) analysis showed that nitrifying communities in seed sludge were composed of AOB and NOB. Due to the similarity of wastewater composition, after sludge acclimation for two weeks, the experiments were begun. 2.2. Experimental set-up and operation A lab-scale sequencing batch reactor (SBR, working volume 11 L) with a bubble air diffuser, mechanical stirring and on-line measurement of dissolved

227

Fig. 1. Lab-scale SBR reactor with control equipment. (1) Air pump, (2) airflow meter, (3) DO and pH meter, (4) pH sensor, (5) DO sensor, (6) stirrer, (7) temperature controller, (8) influent tank, (9) feeding pump, (10) sampling valves, (11) air diffuser and (12) waste sludge.

oxygen (DO) and pH was applied in the experiments (Fig. 1). The reactor was controlled at 19 ± 1 ◦ C using temperature controller and electric heater. The airflow meter controlled the aeration rate to achieve the desired DO concentration according to the different experimental conditions. An appropriate amount of settled sludge was directly discharged from the reactor at the end of sludge-settling period. The mixed liquor suspended solid (MLSS) concentration was maintained at 3000–3500 mg/L with sludge retention time (SRT) of 30–35 days. Each cycle of SBR consisted of 5 min feeding and aerobic period, followed by 30 min settling and 5 min decanting. The length of the aerobic period for nitritation was either preset or real-time controlled by on-line measurement of DO and pH. The SBR was operated for 174 days including four successive phases (Table 2). The second phase consisted of three sub-phases with preset aerobic durations of 3, 4 and 5 h, respectively. The experimental purpose of phase 1 was to investigate if nitritation could be achieved only by preset shortcycle control without DO restriction. Phase 2 was to investigate the effects of combination of low DO concentrations and preset short-cycle control on the establishment of nitritation. Phases 3 and 4 were to set up an effective control strategy for stable performance of nitritation with the higher nitritation rates and TN removal efficiencies at the low and normal DO levels.

2.3. Analytical methods Ammonia nitrogen (NH4 + -N), nitrate nitrogen (NO3 − -N), nitrite nitrogen (NO2 − N), total nitrogen, COD and MLSS were measured according to the APHA standard methods [26]. DO and pH were monitored online using DO/pH meters (WTW Multi 340i, Germany). Nitrifying bacteria in sludge samples were semi-quantified by FISH according to Amann [27]. Table 3 lists the 16S rRNA-targeted oligonucleotide probes used in this study [28–30]. The AOB are restricted to the ␥- and ␤-Proteobacteria. Of these, all but one (Nitrosococcus oceanus) are affiliated with the ␥ subdivision. Since N. oceanus is a marine isolate and no additional AOB within the ␥ subdivision have been described, probe Nso1225 was used only for the ␤ subdivision. Nso1225 encompasses all sequenced AOB of the ␤-Proteobacteria [29]. Moreover, the previous researches demonstrated a superior resolution of 16S rRNA versus amoA analysis [31]. The FISH images from randomly selected 50 fields of each sludge sample were quantified using the software of Image-Pro Plus 6.0. In order to decrease the error of FISH quantification, both cell-counting procedures and area measurement were used. For the randomly acquired fields with efficient dispersion of cells, the relative abundance of nitrifying bacteria was determined by comparison of the obtained numbers with counts of all bacterial cells. For the fields with dense clusters, the areas of hybridized nitrifying bacteria were measured. The abundance of nitrifying bacteria was then expressed as fraction of the area occupied by all bacteria. This method only requires the software to differentiate between labeled biomass (including cell clusters) and unlabeled background, but does not rely on single-cell recognition within clusters [32].

Table 1 Composition of the domestic wastewater. Contents

COD (mg L−1 )

NH4 + -N (mg L−1 )

NO3 − -N (mg L−1 )

NO2 − -N (mg L−1 )

pH

C/N

Alkalinity (CaCO3 , mg L−1 )

Range Average

121–416 188

54–78 65.6

0–0.21 0.15

0–0.09 0.08

7.46–8.01 7.61

1.89–2.51 2.05

455.6–556 521.9

228

W. Zeng et al. / Enzyme and Microbial Technology 45 (2009) 226–232

Table 2 SBR operation for partial nitrification at normal temperatures. Phase

Aeration rate (L h−1 )

1 2

100–200 40

3 4

40 120

DO (mg L−1 ) DO range 0.55–5.67 0.04–0.75 0.04–0.88 0.04–1.10 0.04–1.71 0.46–5.4

Aerobic duration (h)

Operational days (cycles)

Preset 3 h Preset 3 h Preset 4 h Preset 5 h Real-time control Real-time control

55 (165 cycles) 18 (54 cycles) 22 (66 cycles) 20 (60 cycles) 30 (34 cycles) 30 (62 cycles)

Average DO 4.05 0.46 0.52 0.59 0.62 1.94

Table 3 16S rRNA-targeted oligonucleotide probes used in this study. Probe

% Formamide

Sequence

Fluorochrome-labeled

Specificity

EUBmix a

35 (with NSO1225) 40 (with NIT3) 35 (with Ntspa662) 35 40 35

EUB338:GCTGCCTCCCGTAGGAGT EUB338-II: GCAGCCACCCGTAGGTGT EUB338-III: GCTGCCACCCGTAGGTGT CGCCATTGTATTACGTGTGA CCTGTGCTCCATGCTCCG GGAATTCCGCGCTCCTCT

FITC

Eubacteria

Cy3 Cy3 Cy3

Ammonia-oxidizing ␤-Proteobacteria Nitrobacteria Nitrospira

NSO1225 NIT3 Ntspa662 a

EUBmix is an equimolar mixture of probes EUB338, EUB338-II and EUB338-III.

3. Results and discussion 3.1. Establishment of nitritation by low DO and preset short-cycle control Because nitritation produced acid, pH gradually declined during nitritation. When ammonia was depleted, nitrite concentration reached peak and pH began to increase. A valley could be detected in pH-time variations, termed “ammonia valley” [18]. The “ammonia valley” indicated the completion of nitritation exactly, as well as maintained the nitrite buildup by avoiding extended aeration [19]. In the start-up period of nitritation, the preset short-cycle control of aeration time was applied to encourage AOB growth. That is, aeration time was preset and aeration was stopped before the pH “ammonia valley” detected. In phase 1, aerobic duration of each cycle was 3 h with an average DO concentration of 4 mg/L for 55 days (165 cycles) operation in order to investigate the establishment of nitritation only by preset short-cycle control without DO restriction. In phase 2, with the average DO concentrations below 1 mg/L, aerobic durations were gradually prolonged from 3 to 4 h and 5 h when the nitrite accumulation rate increased. An overview of nitrite accumulation rates, NO2 − -N/TN, NO3 − -N/TN and TN removal efficiencies in phases 1 and 2 is given in Fig. 2. As shown in Fig. 2, during the phase 1 of 55 days operation, the nitrite accumulation rate (NO2 − -N/NOx − -N) was below 10% on average except for the maximum 24.6% on the 27th day, and NO3 − N/TN was always much higher than NO2 − -N/TN. It proved that NOB was not inhibited and partial nitrification to nitrite could not occur only by preset short-cycle control without DO restriction. In phase 2, with low DO operation, NO2 − -N/NOx − -N was gradually increased and finally maintained over 95%; meanwhile, NO3 − -N/TN was much lower than that in phase 1 and could finally be negligible. That verified the successful startup of nitrogen removal via nitrite. AOB have a stronger DO affinity than NOB, particularly at low DO concentration. With a long period of low DO operation, NOB activities were selectively inhibited due to DO limitation. Moreover, by preset short-cycle control, aerobic duration was not enough for NOB completely oxidizing nitrite to nitrate, and thus NOB growth was further suppressed. The variations of TN removal efficiencies are also presented in Fig. 2 to analyze the nitrogen balance in phases 1 and 2. In phase 1 with the high DO level of 4 mg/L, the average TN loss

was 2–3% mainly caused by microbial assimilation. In phase 2 with the low DO level of 0.5 mg/L, the TN removal efficiencies were increased to 10–20%, and the maximum was up to 26%. Obvious TN loss was observed in phase 2 under limiting aeration. Since simultaneous nitrification–denitrification (SND) defines that nitrification and denitrification can be carried out concurrently in one reactor under the aerobic conditions with the low DO concentrations, SND occurred in this study. It is clear so far that DO has been recognized as one of the key factors in SND [33]. Therefore, the establishment of anoxic micro-environment under limiting aeration could be important determinant factor for TN loss in this investigation. The other possible reason for TN loss was anammox. Since anammox bacteria are strictly anaerobes and autotrophs, they are very difficult to be cultured. Previous researches have shown that although the anammox bacteria are possibly present in biological wastewater treatment, the very low abundance makes them hardly show anammox activities without any other enrichment techniques [34]. In this study, no culture or enrichment techniques were taken for the growth of anammox bacteria. Additionally, the low DO concentrations, organic substrate and room temperature in the real domestic wastewater treatment were unfavorable for the growth of anammox bacteria. Although we could not exclude the presence of anammox bacteria,

Fig. 2. Variations of NO2 − -N/NOx − -N, NO2 − -N/TN, NO3 − -N/TN and TN removal efficiencies in the effluent.

W. Zeng et al. / Enzyme and Microbial Technology 45 (2009) 226–232

229

Fig. 3. Cycle studies on the 43rd day, 69th day, 94th day and 106th day.

their contribution to the TN loss could be considered unimportant. In phases 1–2, the cycle studies on the 43rd, 69th, 94th and 106th day were performed to gain a better insight into the nitritation process (Fig. 3). As shown in Fig. 3(a), on day 43 of phase 1 with high DO concentrations, NO2 − -N/NOx − -N continuously declined during nitrification indicating the failure of nitritation. Under high DO concentrations, due to the synergistic relationship of AOB and NOB, the produced nitrite was rapidly oxidized to nitrate by NOB resulting in NO2 − -N/NOx − -N declining. That also proved that even with preset short-cycle control of 3 h, nitritation could not be established without DO limitation. On the 69th day of phase 2 with 3 h aeration time and an average DO concentration of 0.46 mg/L (Fig. 3b), in the initial period NO2 − -N/NOx − -N gradually rose and reached the maximum of 77% at the first hour. Thereafter it declined with continuing aeration, which verified the adverse impact of long aeration time on nitrite accumulation. On the 94th day of phase 2 with 4 h aeration time and the average DO concentrations of 0.52 mg/L, NO2 − -N/NOx − -N reached 81.3% at the second hour and then maintained at 81–88% without decline. On the 106th day of phase 2 with 5 h aeration time and an average DO concentration of 0.59 mg/L, NO2 − -N/NOx − -N reached 88.3% at the second hour and increased to 95.2% at the end of aeration indicating NOB activities inhibited and nitritation achieved. In phases 1–2, the above characteristics of nitrite accumulation rate in four typical cycles implied the system transition from complete nitrification to partial nitrification.

breakpoint was used as signal to indicate the end of ammonia oxidation and stop aeration. The DOaverage of phases 3 and 4 was controlled at 0.62 and 1.94 mg/L, respectively. The cycle studies in phases 3 and 4 were performed in order to characterize the relationship between the nitritation process and control parameters (Figs. 4 and 5). As shown in Figs. 4 and 5, an “ammonia valley” in pH-time profile (arrow A) and a distinct change of the DO slope (DO breakpoint, arrow B) accurately indicated the end of ammonia oxidation to nitrite. The NO2 − -N/NOx − -N variations showed that in the initial 2 h of aeration, NO2 − -N/NOx − -N reached 80% and then maintained over 95% till the end of nitritation. During phases 3 and 4, the performance of nitritation and ammonia removal using real-time control is shown in Fig. 6. Fig. 6 presented that based on the successful start-up of nitritation in phase 2, nitritation was still stably maintained and above 97% of ammonia removal was achieved in phases 3 and 4 through real-time control of aerobic duration. In the initial 30 days of phase 3 with low DO concentrations, NO2 − -N/NOx − -N fluctuated due to the system transition from preset short-cycle control to real-time control of aerobic duration (Fig. 6). In the subsequent 30–88 days, the nitrite accumulation rates stabilized over 97%. It proved that real-time

3.2. Stable performance of nitrogen removal via nitrite by real-time control Partial nitrification to nitrite with the nitrite accumulation rates above 95% was successfully started up at 19 ± 1 ◦ C from seed sludge with complete nitrification by low DO and preset short-cycle control. Low DO and preset short-cycle control favors nitritation start-up, but unfavorable for ammonia removal. To improve the ammonia removal, real-time control of aerobic duration was applied in phases 3 and 4, i.e., the pH “ammonia valley” and DO

Fig. 4. Cycle study in phase 3.

230

W. Zeng et al. / Enzyme and Microbial Technology 45 (2009) 226–232

Table 4 FISH quantification of nitrifying bacteria and specific nitrification rate. Samples

Seed sludge End of phase 1 Middle of phase 2 End of phase 2 End of phase 3 End of phase 4

AOB (%) (probe: NSO1225)

1.98 2.11 4.36 9.97 10.13 10.9

± ± ± ± ± ±

0.21 0.49 0.74 1.01 0.93 0.54

Specific nitrification rate (kg NH4 + -N/kg MLSS d)

NOB (%) Nitrospira (probe:Ntspa662)

Nitrobacteria (probe:NIT3)

8 ± 0.63 9.6 ± 0.78 5.35 ± 0.52 0.49 ± 0.17 <0.2% <0.2%

0.625 ± 0.28 0.23 ± 0.13 No signal No signal No signal No signal

Fig. 5. Cycle study in phase 4.

control of aerobic duration was favorable to maintain nitritation and improve ammonia removal under low DO concentrations and normal temperatures. Long-term low DO operation would cause nitritation rate to decrease and sludge to bulk. Therefore, DO concentration was increased to 1.5–2.2 mg/L in phase 4. Although this DO concentration range would encourage NOB growth, real-time control of aeration time based on pH “ammonia valley” and DO breakpoint inhibited NOB growth. Under real-time control of aeration period, aeration was stopped at the end of ammonia oxidized to nitrite, and thus avoided the accumulated nitrite further oxidized to nitrate by NOB under a longer aerobic duration. During phase 4 of 30 days operation with DOaverage of 1.94 mg/L and normal temperatures of 19 ± 1 ◦ C, the nitrite accumulation rates were always above 95% and the ammonia removal efficiencies were over 97% by the real-time control of aerobic duration, as well as nitritation rate was two times of that under the low DO concentrations. 3.3. Population dynamics of nitrifying bacteria AOB and NOB in seed sludge and four operational phases were semi-quantified by FISH (Table 4). The typical FISH micrographs

Fig. 6. Nintritation and ammonia removal using real-time control in phases 3 and 4.

0.038 0.040 0.060 0.080 0.079 0.085

are presented in Fig. 7. As shown in Table 4, seed sludge was typical activated sludge with complete nitrification to nitrate. In phase 1 with high DO concentrations for 55 days, the percentage of nitrifying bacteria in biomass was increased; however, NOB were still much more than AOB. By low DO concentrations and preset shortcycle control in phase 2 for 60 days, AOB became the dominant nitrifying bacteria (9.97%) and very few Nitrospira were detected. In phases 3 and 4 with real-time control, the maximal percentage of AOB reached 10.9% and no NOB was detected. Corresponding to the quantitative results of AOB, the specific nitrification rates in seed sludge and four operational phases are also presented in Table 4. With the increasing of AOB percent, the specific nitrification rate increased from 0.038 kg NH4 + -N/(kg MLSS d) in seed sludge to 0.085 kg NH4 + -N/(kg MLSS d) in the end of phase 4. FA inhibition has been recognized as one of the key factors in nitritation. FA concentration was calculated according to the following formula [35]: FA (mg/L) =

[NH4 + -N] × 107.6 exp[6334/(273 + T )] + 107.6

(1)

In this investigation, with an average influent NH4 + -N of 65 mg/L and pH of 7.6, the influent FA concentration was only 1 mg/L. With continual nitritation of NH4 + -N and consuming of alkalinity, NH4 + N and pH gradually decreased, which also resulted in gradually decreased FA concentration. The previous researches about FA inhibition of nitrite oxidizers in landfill leachate treatment presented that a proper controlled FA ranging between 30 and 70 mg/L could effectively inhibit the NOB; whereas when FA was below 20 mg/L, complete nitrification occurred and the nitrite accumulation rate declined to a very low level [15]. Therefore, in the treatment of real domestic wastewater, the relatively low FA level (<1 mg/L) would not cause the inhibition of NOB. The major reasons for AOB to be dominant nitrifying bacteria were the following two factors: (1) Control of aeration time. The previous researches also proved that extended aeration encouraged the transition of partial nitrification to complete nitrification [18,19], and thus, control of aeration time was significant for achieving partial nitrification to nitrite. In this study, aeration time was controlled based on pH-time profile. As shown in Fig. 3, during nitrification pH continuously declined. And aeration was stopped before pH “ammonia valley” was detected, which indicated ammonia was still left in the reactor. The short-cycle control of aeration time avoided the adverse impact of longer HRT on nitritation, and thus promoted nitritation and inhibited nitratation, especially in start-up period of nitritation. The drawback of short-cycle control of aeration time was decreasing the ammonia removal efficiencies; however, it increased NH4 + -N loadings and encouraged AOB growth. When the nitrite accumulation rate increased, aeration time was prolonged from 3 to 4 h and 5 h to improve the ammonia removal. AOB acclimatized the gradually prolonged aeration time and NOB were washed out. Since previous researches presented that the variation of

W. Zeng et al. / Enzyme and Microbial Technology 45 (2009) 226–232

231

Fig. 7. FISH micrographs for AOB. FITC labeled EUBmix target for Eubacteria and Cy3 labeled NSO1225 target for ␤-AOB. (A) Seed sludge, (B) middle of phase 2 (on the 95th day), (C) end of phase 2 (on the 115th day) and (D) end of phase 4 (on the 170th day).

operational conditions in one reactor would mainly affect the AOB proportion rather than the diversity of AOB communities [36,37], only FISH quantification of AOB was analyzed in this study. Therefore, we could not confirm the variations of AOB communities with the prolonged aeration time before further experimental confirmation was carried out, such as PCR-DGGE or PCR-cloning-sequencing. (2) Low DO concentration. The oxygen affinity constant of AOB and NOB was 0.25–0.5 mg/L and 0.72–1.84 mg/L, respectively [38]. Thus, AOB have a stronger DO affinity than NOB. Especially at low DO concentrations, AOB outcompete NOB [39]. In phase 2 of this study, the average DO concentration was only 0.47–0.6 mg/L with aeration rate of 40 L/h. This low DO concentration promoted AOB growth and inhibited NOB.

After successful start-up of nitritation, through the real-time control of aerobic duration, nitrogen removal via nitrite was stably maintained at low DO concentrations of 0.5–1.0 mg/L and normal DO levels of 1–2 mg/L with nitrite accumulation rate over 95% and ammonia removal efficiencies above 97%. FISH analysis proved that AOB became dominant nitrifying bacteria with the maximal AOB percentage of 10.9%. Therefore, the real-time control of aerobic duration was an effective method to maintain nitrogen removal via nitrite from domestic wastewater at normal temperatures. Acknowledgements This study was financially supported by the Natural Science Foundation of China (grant no. 50608001, 50878005), the Natural Science Foundation of Beijing (grant no. 8072005) and the project of Beijing Excellent Researcher (grant no. 20081D0501500178).

4. Conclusions Using SBR process for the treatment of domestic wastewater with low C/N ratios at normal temperatures, by the combination of low DO concentration (DOaverage < 1.0 mg/L) and preset short-cycle control of aerobic duration, NOB were washed out of seed sludge with complete nitrification–denitrification and AOB became dominant nitrifying bacteria at 19 ◦ C ± 1 ◦ C. Preset short-cycle control termed as that aeration time was preset and aeration was stopped before the pH “ammonia valley” detected. After AOB became pre-dominant nitrifying bacteria and nitrite accumulation rate (NO2 − -N/NOx − -N) reached 50%, the aerobic durations were gradually prolonged from 3 to 4 h and 5 h to improve the ammonia removal and further enhance AOB dominance. By the above operational pattern, nitritation was successfully established with nitrite accumulation rate above 95%. The research also proved that at normal temperatures, for the seed sludge with complete nitrification–denitrification, AOB dominance could hardly be established only by the aerobic duration control without the DO restriction.

References [1] Abeling U, Seyfried CF. Anaerobic-aerobic treatment of high strength ammonium wastewater – nitrogen removal via nitrite. Water Sci Technol 1992;26(5–6):1007–15. [2] Jenicek P, Svehla P, Zabranska J, Dohanyos M. Factors affecting nitrogen removal by nitritation/denitritation. Water Sci Technol 2004;49(5–6):73–9. [3] Lai E, Senkpiel S, Solley D, Keller J. Nitrogen removal of high strength wastewater via nitritation/denitritation using a sequencing batch reactor. Water Sci Technol 2004;50(10):27–33. [4] Turk O, Mavinic DS. Benefits of using selective inhibition to remove nitrogen from highly nitrogenous wastes. Environ Technol Lett 1987;8:419–26. [5] Fux C, Velten S, Carozzi V, Solley D, Keller J. Efficient and stable nitritation and denitritation of ammonium-rich sludge dewatering liquor using an SBR with continuous loading. Water Res 2006;40(14):2765–75. [6] Jetten MSM, Strous M, van de Pas-Schoonen KT, Schalk J, van Dongen UGJM, van de Graaf AA, Logemann S, Mkuyzer G, van Loosdrecht MCM, Kuenen JG. The anaerobic oxidation of ammonium. FEMS Microbiol Rev 1999;22(5):421–37. [7] van Dongen U, Jetten MSM, van Loosdrecht MCM. The SHARON-anammox process for treatment of ammonium rich wastewater. Water Sci Technol 2001;44(1):153–60. [8] Hellinga C, Schellen AAJC, Mulder JW, van Loosdrecht MCM, Heijnen JJ. The Sharon process: an innovative method for nitrogen removal from mmoniumrich waste water. Water Sci Technol 1998;37(9):135–42.

232

W. Zeng et al. / Enzyme and Microbial Technology 45 (2009) 226–232

[9] Yoo H, Ahn K, Lee H, Lee K, Kwak Y, Song K. Nitrogen removal from synthetic wastewater by simultaneous nitrification and denitrification (SND) via nitrite in an intermittently aerated reactor. Water Res 1999;33(1):146–54. [10] Bae W, Baek S, Chung J, Lee Y. Optimal operational factors for nitrite accumulation in batch reactors. Biodegradation 2002;12(5):359–66. [11] Kim DJ, Chang JS, Lee DI, Han DW, Yoo IK, Cha GC. Nitrification of high trength ammonia wastewater and nitrite accumulation characteristics. Water Sci Technol 2003;47(11):45–51. [12] Ruiz G, Jeison D, Rubilar O, Ciudad G, Chamy R. Nitrification–denitrification via nitrite accumulation for nitrogen removal from wastewaters. Bioresour Technol 2006;97:330–5. [13] Balmelle B, Nguyen KM, Capdeville B, Cornier JC, Deguin A. Study of factors controlling nitrite build up in biological process for water nitrification. Water Sci Technol 1992;26(5–6):1017–25. [14] Aslan S, Dahab M. Nitritation and denitritation of ammonium-rich wastewater using fluidized-bed biofilm reactors. J Hazard Mater 2008;156:56–63. [15] Peng YZ, Zhang SJ, Zeng W, Zheng SW, Mino T, Satoh H. Organic removal by denitritation and methanogenesis and nitrogen removal by nitritation from landfill leachate. Water Res 2008;42(4–5):883–92. [16] Brouwer M, van Loosdrecht MCM, Heijnen JJ. One reactor system for ammonium removal via nitrite. STOWA report 96-01. The Netherlands: STOWA, Utrecht; 1996. [17] Karakashev D, Schmidt JE, Angelidaki I. Innovative process scheme for removal of organic matter, phosphorus and nitrogen from pig manure. Water Res 2008;42:4083–90. [18] Peng YZ, Yang Q, Liu XH, Zeng W, Mino T, Satoh H. Achieve nitrogen removal via nitrite form municipal wastewater at low temperatures using real-time control to optimize nitrifying communities. Environ Sci Technol 2007;41(23): 8159–64. [19] Zeng W, Peng YZ, Wang SY, Peng CY. Process control of an alternating aerobicanoxic sequencing batch reactor for nitrogen removal via nitrite. Chem Eng Technol 2008;31(4):582–7. [20] van Dongen U, Jetten MSM, van Loosdrecht MCM. The SHARON-ANAMMOX process for treatment of ammonium rich wastewater. Water Sci Technol 2001;44(1):153–60. [21] Garrido JM, van Benthum WAJ, van Loosdrecht MCM, Heijnen JJ. Influence of dissolved oxygen concentration on nitrite accumulation in a biofilm airlift suspension reactor. Biotechnol Bioeng 1997;53:168–78. [22] Pollice A, Tandoi W, Lestingi C. Influence of aeration and sludge retention time on ammonium oxidation to nitrite and nitrate. Water Res 2002;36:2541–6. [23] Ruiz G, Jeison D, Chamy R. Nitrification with high nitrite accumulation for the treatment of wastewater with high ammonia concentration. Water Res 2003;37:1371–7. [24] Peng YZ, Chen Y, Peng CY, Liu M, Wang SY, Song XQ, Cui YW. Nitrite accumulation by aeration controlled in batch reactors treating domestic wastewater. Water Sci Technol 2005;50(10):35–43.

[25] Wang SY, Gao DW, Peng YZ, Wang P, Yang Q. Nitrification–denitrification via nitrite for nitrogen removal from high nitrogen soybean wastewater with online fuzzy control. Water Sci Technol 2004;49(5–6):121–7. [26] APHA. Standard methods for the examination of water and wastewater. 19th ed. Washington, DC, USA: American Public Health Association; 1998. [27] Amann R, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 1995;59:143–69. [28] Loy A, Horn M, Wagner M. Probe base—an online resource for rRNA-targeted oligonucleotide probes. Nucleic Acids Res 2003;31:514–6. [29] Mobarry BK, Wagner M, Urbain V, Rittmann BE, Stahl DD. Phylogenetic probes for analyzing abundance and spatial organization of nitrifying bacteria. Appl Environ Microbiol 1996;62:2156–62. [30] Daims H, Nielsen P, Nielsen JL, Juretschko S, Wagner M. Novel nitrospira-like bacteria as dominant nitrite-oxidizers in biofilms from wastewater treatment plants: diversity and in situ physiology. Water Sci Technol 2000;41(4–5):85–90. [31] Purkhold U, Wagner M, Timmermann G, Pommerening-Röser A, Koops HP. 16S rRNA and amoA-based phylogeny of 12 novel betaproteobacterial ammoniaoxidizing isolates: extension of the dataset and proposal of a new lineage within the nitrosomonads. Int J Syst Evol Microbiol 2003;53:1485–94. [32] Daims H, Ramsing NB, Schleifer KH, Wagner M. Cultivation-independent, semiautomatic determination of absolute bacterial cell numbers in environmental samples by Fluorescence In Situ Hybridization. Appl Environ Microbiol 2001;67(12):5810–8. [33] Leonidia MCD, Eloísa P, Eugenio F, Fabio AC. Removal of ammonium via simultaneous nitrification–denitrification nitrite-shortcut in a single packed-bed batch reactor. Bioresour Technol 2009;100(3):1100–7. [34] Tsushima I, Ogasawara Y, Kindaichi T, Satoh H, Okabe S. Development of highrate anaerobic ammonium-oxidizing (anammox) biofilm reactors. Water Res 2007;41:1623–34. [35] Anthonisen AC, Loehr RC, Prakasam TBS, Srinath EG. Inhibition of nitrification by ammonia and nitrous acid. J Water Pollut Control Fed 1976;48:835–52. [36] You SJ, Hsu CL, Chuang SH, Ouyang CF. Nitrification efficiency and nitrifying bacteria abundance in combined AS-RBC and A2 O systems. Water Res 2003;37:2281–90. [37] Pynaert K, Smets BF, Wyffels S, Beheydt D, Siciliano SD, Verstraete W. Characterization of an autotrophic nitrogen-removing biofilm from a highly loaded lab-scale rotating biological contactor. Appl Environ Microbiol 2003;69(6):3626–35. [38] Guisasola A, Jubany I, Baeza JA. Respirometric estimation of the oxygen affinity constants for biological ammonium and nitrite oxidation. J Chem Technol Biotechnol 2005;80(4):388–96. [39] Fux C, Boehler M, Huber P, Brunner I, Siegrist H. Biological treatment of ammonium-rich wastewater by partial nitritation and subsequent anaerobic ammonium oxidation (anammox) in a pilot plant. J Biotechnol 2002;99(3):295–306.