Control of Cdc14 activity coordinates cell cycle and development in Caenorhabditis elegans

MECHANISMS OF DEVELOPMENT

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/modo

Control of Cdc14 activity coordinates cell cycle and development in Caenorhabditis elegans Sarah H. Roy a b

a,1,2

, Joseph E. Clayton

a,1

, Jenna Holmen a, Eleanor Beltz a, R. Mako Saito

b,*

Department of Genetics, Dartmouth Medical School, Hanover, NH 03755, USA Norris Cotton Cancer Center, Lebanon, NH 03756, USA

A R T I C L E I N F O

A B S T R A C T

Article history:

Much of our understanding of the function and regulation of the Cdc14 family of dual-spec-

Received 4 March 2011

ificity phosphatases originates from studies in yeasts. In these unicellular organisms Cdc14 is

Received in revised form

an important regulator of M-phase events. In contrast, the Caenorhabditis elegans homolog,

15 June 2011

cdc-14, is not necessary for mitosis, rather it is crucial for G1/S regulation to establish devel-

Accepted 16 June 2011

opmental cell-cycle quiescence. Despite the importance of integrating cdc-14 regulation with

Available online 24 June 2011

development, the mechanisms by which this coordination occurs are largely unknown. Here, we demonstrate that several processes conspire to focus the activity of cdc-14. First, the cdc-14

Keywords: Caenorhabditis elegans Development Cell cycle Quiescence Cdc14

locus can produce at least six protein variants through alternative splicing. We find that a single form, CDC-14C, is the key variant acting during vulva development. Second, CDC-14C expression is limited to a subset of cells, including vulva precursors, through post-transcriptional regulation. Lastly, the CDC-14C subcellular location, and thus its potential interactions with other regulatory proteins, is regulated by nucleocytoplasmic shuttling. We find that the active export of CDC-14C from the nucleus during interphase is dependent on members of the Cyclin D and Crm1 families. We propose that these mechanisms collaborate to restrict the activity of cdc-14 as central components of an evolutionarily conserved regulatory network to coordinate cell-cycle progression with development. Ó 2011 Elsevier Ireland Ltd. All rights reserved.

1.

Introduction

Strict control of cell division during metazoan development is an important means of ensuring that cells are generated in the appropriate numbers and at the proper time to transmit or receive developmental signals. Caenorhabditis elegans development provides an excellent experimental system to reveal the mechanisms that coordinate the cell cycle with other developmental processes since the timing of cell divisions is highly reproducible between individual animals (Sulston and Horvitz, 1977). The development of the hermaphrodite vulva is particularly amenable for study since it

is a relatively simple organ that is not required for viability (Sternberg, 2005). Importantly, the cells that give rise to the vulva, the vulva precursor cells (VPCs), display a highly regulated cell division pattern during development. The VPCs are formed in the first larval stage (L1) but unlike their neuroblast siblings, the VPCs temporarily exit the cell cycle. This period of cell-cycle quiescence ends in the third larval stage (L3) when the VPCs resume cell divisions and differentiate as either hypodermis (skin) or vulva cells. Several studies have identified genes necessary for the establishment or maintenance of the L1-to-L3 period of cell-cycle quiescence during vulva development (Kirienko et al., 2010).

* Corresponding author. Tel.: +1 603 650 1110; fax: +1 603 650 1188. E-mail address: [email protected] (R.M. Saito). 1 These authors contributed equally to this work. 2 This author was previously known as Sarah H. Buck. 0925-4773/$ - see front matter Ó 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mod.2011.06.001

318

MECHANISMS OF DEVELOPMENT

A forward genetic screen for genes necessary for the temporary cell-cycle arrest during VPC development isolated a mutation of cdc-14, the sole C. elegans Cdc14 homolog (Clayton et al., 2008; Saito et al., 2004). cdc-14 null-mutant animals are viable and fertile but display subtle cell-cycle quiescence defects in the post-embryonic development of several organs such as the vulva and intestine. Although the molecular connection has not been elucidated, the cell-cycle quiescence activity of cdc-14 requires the activity of cki-1, a Cip/Kip homolog. In stark contrast, a study relying on RNAi treatment to inhibit cdc-14 described defects in cytokinesis that led to early embryonic lethality (Gruneberg et al., 2002). This phenotype supports functional conservation between the nematode cdc-14 and fungal Cdc14. In order to achieve a better understanding of Cdc14 function, contradicting conclusions such as these must be resolved. While the majority of fungal Cdc14 studies focus on its role in the regulation of late mitotic events, diverse functions have been attributed to the Cdc14 family members of higher eukaryotes (Mocciaro and Schiebel, 2010). Unlike the single Cdc14 family member encoded by the C. elegans genome, vertebrate genomes encode at least two orthologs, Cdc14A and Cdc14B. Several early studies relying on siRNA or dominant negative proteins corroborated the requirement for Cdc14 during mitosis of human cells (Kaiser et al., 2002; Mailand et al., 2002). However, more recent data obtained using genetic knockout strategies in human (Berdougo et al., 2008; Mocciaro et al., 2010) and chicken (Berdougo et al., 2008; Mocciaro et al., 2010) cell lines indicate that individual Cdc14 family members are dispensable for completion of normal cell cycles. Indeed, comprehensive analyses have demonstrated that hCdc14B can inhibit centriole amplification (Wu et al., 2008), Skp2 stability, p27 degradation and G1 progression (Rodier et al., 2008). Metazoan Cdc14s have also been found to play roles in the cellular response to DNA damage (Bassermann et al., 2008; Mocciaro et al., 2010). Interestingly, cdc-14 was identified in a genome-wide RNAi screen for genes displaying genome-protective activity (Pothof et al., 2003) indicating that a DNA damage response function is possibly conserved in C. elegans. Given the range of processes in which Cdc14 activity has been implicated, the biological function of the Cdc14 family likely cannot be summarily classified. Here, we re-examine the role of Cdc14 in C. elegans and confirm that cdc-14 is not necessary for mitotic function. Furthermore, little is known about the cellular processes that regulate Cdc14 activity in metazoans. Extensive studies in fungi have elaborated intricate networks that control Cdc14 localization and activity (D’Amours and Amon, 2004; De Wulf et al., 2009); however, this regulatory pathway does not appear to be functionally conserved with higher eukaryotes, including C. elegans (Gruneberg et al., 2002). Using C. elegans as a model system to investigate the developmental mechanisms controlling Cdc14, we uncover evidence of a developmental network that controls cdc-14 through both tissue-specific expression and subcellular localization.

2.

Results

2.1.

cdc-14 is not required for mitosis in C. elegans

Mutations of cdc-14, the sole C. elegans member of the Cdc14 phosphatase family, were identified in a genetic screen

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

for developmental regulators of cell-cycle quiescence (Saito et al., 2004). In this study cdc-14(RNAi) also produced extra cell divisions during vulva and intestine development. However, another group concluded that cdc-14 is required for cytokinesis after observing that cdc-14(RNAi) caused M-phase arrest and early embryonic lethality (Gruneberg et al., 2002). One proposed explanation for the phenotypic discrepancy is that one of the strains used in the RNAi experiment carried a mutation in zen-4, a member of the kinesin family (Raich et al., 1998), thus providing a sensitized genetic background (McCollum, 2004). In order to readdress the genetic enhancement of the zen-4 temperature-sensitive lethal phenotype by loss of cdc-14 function, we used the null allele, cdc-14(he141), instead of RNAi. At the zen-4(or153ts) permissive temperature of 15 °C, the cdc-14(he141); zen-4(or153ts) and cdc-14(he141); zen-4(or153ts); xsEx6[zen-4::GFP] mutant combinations did not result in early embryonic lethality previously reported for the cdc-14(RNAi); zen-4(or153ts) animals (Fig. 1A and Section 4). Notably, no enhancement of the incompletely penetrant lethality was observed at the semi-permissive temperature of 20 °C. Additionally, no evidence of a genetic interaction between zen-4(or153ts) and cdc-14(he141) was detected in the regulation of G1/S progression during vulva development (Fig. 1B). Taken together, these data demonstrate that cdc-14 and zen-4 do not exhibit a genetic interaction. Moreover, since the Zen-4(ts) lethal mitotic arrest defect was not enhanced by the cdc-14(he141) null mutation,

A

viability, % 50

100

cdc-14(he141)

zen-4(or153) 0

cdc-14(he141); zen-4(or153)

0

VPCs undergoing extra cell division, % 20 40 60

B cdc-14(he141) zen-4(or153)

0

cdc-14(he141); zen-4(or153)

Fig. 1 – cdc-14 and zen-4 do not display genetic interaction. (A) The cdc-14(he141) null mutation does not enhance the lethality of zen-4(or153ts) at the permissive or semipermissive temperatures. The average viability of progeny produced by the indicated genotypes grown at 15 °C (light gray bars), 20 °C (dark gray bars) and 25 °C (black bars) is presented. Bars indicate mean value ± s.d. (n P 4 broods per experiment). (B) zen-4(or153ts) does not effect the cdc14(he141) extra VPC division defect at 15 °C. The percentages of VPCs undergoing an extra cell division in animals of the indicated genotypes are shown. Bars indicate mean value ± s.e.m. (n P 20 animals per experiment) for each genotype. VPCs were examined at the L2/L3 molt.

MECHANISMS OF DEVELOPMENT

we find no evidence supporting a role for cdc-14 function during mitosis. Therefore, we focused our analyses of cdc-14 on its role as a regulator of temporary G1 arrest during development.

2.2. CDC-14C is the primary alternative splice form controlling VPC cell-cycle quiescence The cdc-14 locus can generate at least six potential protein products through alternative splicing, referred to as CDC-14A through CDC-14F (Fig. 2A). The two previously described cdc14 mutations, he118 and he141, disrupt all six variants and result in cell-cycle quiescence defects in several cell types, including the VPCs and intestine (Saito et al., 2004). The C. elegans knockout Consortium isolated a third mutation, cdc14(ok1407), that we have determined is a substitution of 1144 bp with 10 consecutive adenines (Fig. 2B). Despite this disruption to the locus, the cdc-14(ok1407) mutation did not perturb cell-cycle quiescence of the VPCs as no extra divisions were observed in the cdc-14(ok1407) animals (n = 20). Similarly, the intestines of cdc-14(ok1407) animals also did not display defects in developmental control of cell cycles (n = 80). The apparent wild type development of these animals is particularly interesting because the cdc-14(ok1407) mutation disrupts all splice forms except CDC-14C (Fig. 2B). However, the lack of

A

he141

ok1407

CDC-14C(wt) CDC-14C(he141)

C

1.0

2.0

cdc-14(ok1407) MW

gpd-2 WT Δ

CDC-14C WT

Δ

1.0 kb

CDC-14C(ok1407)

relative CDC-14C level

WT

D

appropriate antibodies limited our ability to measure the expression of the truncated variants. It is unlikely that cdc14 function was maintained in the cdc-14(ok1407) mutant animals by a mechanism involving compensatory overexpression of CDC-14C, since the CDC-14C relative mRNA expression level was not significantly increased (Fig. 2C and D). Therefore, the absence of a cdc-14(ok1407) mutant phenotype suggested that CDC-14C alone may be sufficient for the cdc-14 function in regulating developmental cell-cycle quiescence. The cdc-14 locus may produce the six alternative splice products in order to generate proteins with a variety of unique activities. To assay the in vivo G1/S regulatory activity of each CDC-14 variant, we monitored cell-cycle quiescence of cdc14(he141) mutant animals expressing a single alternatively spliced CDC-14 cDNA. All six identified variants utilize the identical start site followed by the four 5 0 -most exons which encode the phosphatase domain. Alternative use of 3 0 exons generates the unique C-terminal sequences. cDNAs of each splice form were fused in-frame with GFP to allow visualization and expressed from transgenes using identical regulatory sequences. We first examined the GFP–CDC-14 chimeric proteins for complementation of the cdc-14(he141) cell-cycle quiescence defects in the intestine (Fig. 2E). While wild-type animals pro-

B

CDC-14A CDC-14B CDC-14C CDC-14D CDC-14E CDC-14F

319

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

E cDNA CDC-14A CDC-14B CDC-14C CDC-14D CDC-14E CDC-14F no cDNA

F

Intestinal nuclei, number

30

40

50

cDNA CDC-14A CDC-14B CDC-14C CDC-14D CDC-14E CDC-14F

extra VPC divisions, %

50

100

Fig. 2 – The CDC-14C alternative splice form is a developmental regulator of cell-cycle quiescence. (A) Alternative splice patterns of identified mRNA variants. Filled boxes indicate exons; lines indicate intervening introns. (B) Schematic representation of cdc-14 genomic locus (upper) and CDC-14C mRNA products (lower). Lines at top delineate regions deleted by indicated mutations. Gray shaded boxes indicate exons used in CDC-14C mRNA; open boxes indicate exons used in other splice forms. Potential CDC-14C open reading frames are indicated below as gray bars, vertical lines indicate exon–exon junctions. (C) Quantitative real-time PCR analysis of steady-state CDC-14C mRNA expression. Of three experiments performed, the greatest observed difference between wild type and cdc-14(ok1407) mutant animals is shown (P = 0.63291). (D) Semi-quantitative PCR demonstrating that the cdc-14(ok1407) mutation, indicated as D, does not disturb CDC-14C expression. The control gene, gpd-2 (Higashibata et al., 2006), and the 100–500 basepair region of the molecular weight standard (MW) are presented. (E) The number of intestinal nuclei in cdc-14(he141) animals expressing the indicated CDC-14 alternative splice forms. Intestinal nuclei were counted during L4, black bars indicate mean value ± s.d. (n P 20 animals per experiment) for each genotype. Wild-type mean value is shown as dotted line. (F) The percentages of VPCs undergoing an extra cell division in cdc-14(he141) animals expressing the indicated CDC-14 alternative splice form transgene. VPCs for each genotype were examined at the L2/L3 molt. Black bars indicate mean percentages of VPCs undergoing extra cell division in transgenic animals compared to non-transgenic siblings. The number of extra cell divisions observed in non-transgenic siblings were set to 100%. Error bars represent standard error (n P 20 animals per experiment).

320

MECHANISMS OF DEVELOPMENT

duced an average of 32.0 ± 1.2 (n = 20) intestinal nuclei, the intestinal nuclei of cdc-14(he141) mutant animals consisted of an average of 43.1 ± 4.2 (n = 40). However, cdc-14(he141) animals that harbored a transgene expressing any of the six CDC-14 alternative splice variants displayed a wild-type complement of intestinal nuclei. Since each was able to independently provide sufficient activity to correct the extra intestinal nuclei in the cdc-14 null mutant animals, we concluded that all six CDC-14 alternative splice variants harbored the ability to regulate G1/S progression. We next analyzed the six CDC-14 alternative splice forms for the ability to regulate G1/S progression during VPC development. During vulva development, the VPCs undergo an L1-to-L3 period of cell-cycle quiescence. Defects in the ability to temporarily arrest cell divisions were measured by the appearance of extra VPCs at the L2/L3 molt (Saito et al., 2004). In contrast to the intestine, VPC development appeared to specifically require CDC-14C activity (Fig. 2F). The incomplete rescue of the extra cell division phenotype was likely the result of mosaic transgene expression arising from the extrachromosomal arrays. Therefore, the finding that the cdc-14(ok1407) mutation disrupted all alternative splice forms except CDC-14C but did not perturb cell-cycle quiescence together with the fact that a CDC-14C transgene was uniquely able to restore control of VPC quiescence indicated that the CDC-14C alternative splice form is the primary regulator of cell-cycle quiescence during VPC development.

2.3. A CDC-14C-specific GFP marker displays a posttranscriptionally restricted expression pattern that correlates with the requirement for cdc-14 activity We previously noted that the cdc-14 promoter supported generalized GFP expression and yet the requirement for cdc14 activity appears to be spatiotemporally limited during development to select blastomeres (Saito et al., 2004). Because a CDC-14C-specific antibody was not available, we produced a transgene that uniquely highlights expression of the CDC-14C alternative splice form. We isolated a 7.3 kb segment of the genome that encompasses the cdc-14 locus, including the entire flanking upstream and downstream intergenic regions. A GFP open reading frame was inserted immediately upstream of the termination codon that is utilized exclusively by CDC14C (Fig. 3A, line 2). Consequently, this transgene encoded all known splice forms, but only the CDC-14C variant was visualized by a GFP fusion product (referred to as CDC-14C– GFP). The CDC-14C-specific transgene displayed general GFP expression in the soma during early embryogenesis (Fig. 3B), similar to the expression previously observed when using the promoter sequences alone or a N-terminal GFP fusion (GFP–CDC-14) to mark all CDC-14 splice forms (Saito et al., 2004; Fig. 3A, line 1). The GFP–CDC-14 expression remained widespread after hatching (Fig. 3D). In contrast, the CDC14C-specific GFP expression became progressively restricted during late embryogenesis and following hatching the transgenic larvae clearly displayed a restricted expression pattern. The most notable tissue-restricted CDC-14C–GFP expression was observed in cells of the V and P lineages, the post-embryonic lineages that contribute the seam cells and VPCs, respec-

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

A

E

V

P

misc 1

1

+

+

+

+2

2

+

+

+

+

+

_

_

_

+

_

_

+/_

3 4

_ _ + +/_ +/ +/

5 let-858

6

1.0 kb

B

F

C

D

+

+

+

+2

E

G

Fig. 3 – Tissue-specific expression pattern of a CDC-14Cspecific GFP transgene is determined post-transcriptionally. (A) Diagram depicting general structures and expression patterns of CDC-14–GFP transgenes. Line 1 displays Nterminal GFP fusion that highlights expression of all known alternative splice forms. Line 2 presents schematic representation of the full-length CDC-14C-specific GFP transgene structure. Lines 3–6 illustrate alterations introduced to the CDC-14C-specific transgene. Exons are indicated as boxes. Black, green and white indicate exons used in CDC-14C, GFP and exons used in other CDC-14 splice forms, respectively. Exon–exon junctions are not indicated for clarity. E, V and P indicate GFP expression observed during general embryogenesis, V cells during the L1 stage and VPCs during the L2 stage, respectively. 1 Indicates that weak GFP expression is observed in the pharynx, neurons in the head region and ventral nerve cord. 2 Indicates strong GFP expression in neurons. (B) CDC-14C– GFP is widely expressed in somatic cells of embryos. (C) Surface view to illustrate V cell expression of CDC-14C–GFP during the L1 stage. (D) Wide expression pattern of GFP– CDC-14 observed from L1 carrying line 1 transgene. (E) CDC14C–GFP expression in VPCs (arrows) at the L2/L3 molt. (F) Weak expression of CDC-14C-specific GFP (line 2 transgene) in the head region. (G) Example of strong expression in the neurons in the head region. In B–G, upper panels are GFP, lower panels are Nomarski optics. All scale bars indicate 10 lm.

tively (Fig. 3C and E). Notably, this CDC-14C–GFP expression pattern overlaps with the spatiotemporal requirement for cdc-14 activity within the developing animal. Interestingly,

MECHANISMS OF DEVELOPMENT

2.4. Disruption of XPO-1-mediated nuclear export reveals dynamic nucleocytoplasmic shuttling of CDC-14C In yeasts, sequestration through control of subcellular localization is an important means to regulate Cdc14 activity (De Wulf et al., 2009; Mocciaro and Schiebel, 2010; Queralt and Uhlmann, 2008). To better visualize the relationship between CDC-14C localization and the cell cycle during C. elegans development, we used the col-10 promoter sequences to express the functional GFP–CDC-14C fusion protein (Fig. 2) within the relatively large cells of the V lineage (Wightman et al., 1993). The dynamic localization of this GFP–CDC-14C marker mimicked the cell cycle-dependent pattern previously seen

with a transgene marking the amino-terminus of all CDC-14 alternative splice forms with GFP (Saito et al., 2004). Based on several observations, we hypothesized that a small, dynamic pool of CDC-14C located within the nucleus regulates G1/S progression. We observed an increase of the nuclear pool during developmental quiescence induced by starvation (Fig. 4A and D) compared to the predominantly cytoplasmic localization of CDC-14C during normal interphase (Fig. 4B and D). Therefore, CDC-14C appeared to be subjected to regulated transport across the nuclear membrane. Thus, we examined potential regulators of CDC-14C nucleocytoplasmic shuttling. The exportin Crm1 has been demonstrated to mediate nuclear export of both human Cdc14 orthologs, Cdc14A and Cdc14B (Bembenek et al., 2005). We examined the requirement of the C. elegans Crm1 homolog, xpo-1 (Nakamura et al., 2005), in nuclear export of CDC-14C using RNAi. Whereas control animals expressed the GFP– CDC-14C within the cytoplasm during interphase (Fig. 4B and D), xpo-1(RNAi) treatment resulted in nuclear accumula-

B

A

D

E

CDC-14C-GFP, N/C ratio

weak expression of this CDC-14C-specific reporter was observed within the intestine (not shown), possibly reflecting the lack of a CDC-14C-specific requirement. The restricted larval expression pattern suggested that the CDC-14C-specific GFP reporter retained the sequences necessary for the endogenous post-transcriptional regulation. The CDC-14C-specific GFP transgene was used as a starting point to identify potential cis-acting regulatory sequences. We specifically focused on CDC-14C–GFP expression within the V cells and VPCs. First, elimination of intron sequences using a mini-gene construct (wherein the normal genomic sequence was replaced by the CDC-14C cDNA; Fig. 3A, line 3) resulted in normal expression during embryogenesis, but very weak expression during larval development. These results were consistent with previous studies in C. elegans demonstrating a generally weaker expression of intronless transgenes (Okkema et al., 1993). A construct containing the three 5 0 -most introns (Fig. 3A, line 4) did not restore wild-type expression despite the fact that it was predicted to generate only CDC-14C since the introns presumed to carry the information necessary to produce other splice forms were absent. Interestingly, a construct containing the three 3 0 -most introns (Fig. 3A, line 5) restored CDC-14C–GFP expression to the V cells and VPCs although the information to produce all alternative splice forms was present. These data indicated that a regulatory element(s) that specifically promotes CDC-14C expression is encoded within the 3 0 introns. We next examined the contribution of the 3 0 -untranslated region (UTR) of CDC-14C in determining the restricted expression pattern. The sequences 3 0 of the CDC-14C termination codon were replaced with the 3 0 -UTR from the let-858 gene (Fig. 3A, line 6), which is generally permissive for expression (Kelly et al., 1997). In addition to the normal expression within the V and VPCs, this 3 0 -UTR substitution allowed an increase of the weak expression of CDC-14C–GFP within cells that do not strongly express the transgene using endogenous cdc-14 regulatory elements (Fig. 3A). The most obvious change with the 3 0 -UTR substitution was an increase in neuronal expression, particularly in the head region (Fig. 3F and G). Since the reporter transgenes were otherwise identical, this result suggests that an element within the CDC-14C 3 0 -UTR negatively regulates expression of the CDC-14C transcript in these cells. Together, these experiments indicated that a combination of elements located within the 3 0 introns and the 3 0 UTR cooperate to direct the proper spatial and temporal expression of CDC-14C.

321

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

1.4

WT(starve)

C

WT

xpo-1(RNAi)

1.2 1.0 0.8

Ce CDC-14 Sc Cdc14 Hs Cdc14A Hs Cdc14B consensus

LVNQVDDINL LIS-LEEYRL ILSFLEEMSI LLSGVDDISI Φ XXXΦ XXΦ XΦ

Fig. 4 – The cytoplasmic localization of CDC-14C is xpo-1dependent. The localization of GFP–CDC-14C within V cells of (A) starved wild-type, (B) developing wild-type and (C) xpo-1(RNAi) animals. Images showing GFP (top panels), Nomarski (middle panels) and GFP/DNA staining merge (bottom panels) are presented. DAPI-stained DNA in bottom panels is false-colored red. Autofluorescence and adjacent nuclei are also visible. Scale bar for all images indicates 5 lm. (D) Box and whisker plot comparison between nuclear-to-cytoplasmic ratios of GFP–CDC-14C in starvation arrested wild-type (n = 14) and late L1 wild-type and xpo1(RNAi) animals (n = 20 for each experiment). The top, intermediate and lower lines of the boxes represent the upper quartile, median and lower quartile values, respectively. Whiskers indicate the entire range of observed values. (E) Alignment of nuclear export sequences from Cdc14 family members. Gray shading indicates consensus residues. Amino acids mutated to disrupt NES activity in C. elegans are highlighted in bold.

322

MECHANISMS OF DEVELOPMENT

tion (Fig. 4C and D). Despite the increased accumulation within the nucleus, CDC-14C appeared to be excluded from the nucleolus. In contrast, the nucleolus is used to sequester Cdc14 in budding yeast (Shou et al., 1999; Visintin et al., 1999) and nucleolar localization was observed in terminally arrested cells such as muscle and neurons in C. elegans (Saito et al., 2004). To confirm the xpo-1-dependent export of CDC14C, we introduced Ala substitution mutations to disrupt the putative nuclear export signal (NES) sequence. CDC-14C contains a sequence located between leu372 and leu381 that conforms to the consensus binding site of Crm1 (Kutay and Guttinger, 2005) and the relative position is conserved among other Cdc14 family members (Fig. 4E). Comparable to the localization within xpo-1 deficient animals, GFP–CDC-14C harboring point mutations to disrupt the candidate NES (GFP–CDC-14CDNES) localized within the nucleus (Fig. 5B and D). Together the requirement of both xpo-1 and the conserved XPO-1 binding site of CDC-14C indicated that XPO-1 is a regulator of CDC-14C nuclear export. Moreover, since CDC-14C

A

protein product, diagram

GFP::CDC-14C

GFP::CDC-14C GFP::CDC-14C GFP::CDC-14C GFP::CDC-14C GFP::CDC-14C GFP::CDC-14C

C

GFP

1

P

2 E

subcellular location 3

Δ94-681

C N

Δ379-681

N

Δ605-681

C

Δ1-367

C

Δ1-387

N

Δ1-424

N

Δ1-465

N

Δ1-660

N

D CDC-14C-GFP, N/C ratio

GFP::CDC-14C

B

was normally found in the cytoplasm, the nuclear accumulation observed upon disruption of export suggested that the CDC-14C cytoplasmic location during interphase was the result of active nuclear export activity. We used the Pcol-10::GFP::CDC-14C transgene based localization assay to identify the residue(s) necessary for import. Deletion and truncation mutations identified three regions necessary or sufficient for nuclear import in addition to the single export signal (Fig. 5A). To test the requirement of the three putative nuclear import sequences, tentatively referred to as NLS1 through NLS3, Lys and Arg codons were substituted with Ala (Supplementary material Table 1). CDC-14C harboring mutations to disrupt all three NLS sequences was predominantly observed within the cytoplasm and was indistinguishable from wild-type protein. In order to investigate nuclear import of GFP–CDC-14C, NLS activity was analyzed in combination with the DNES mutation that disrupts nuclear export and results in nuclear accumulation (Fig. 5B and D). For example, the combination of mutations to disrupt

protein product, name

GFP::CDC-14C

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

E

WT

ΔNES

ΔNLS1,2,3 ΔNLS2 ΔNLS1,3 ΔNES ΔNES ΔNES

1.4 1.2 1.0 0.8

P

I E

Fig. 5 – CDC-14C nucleocytoplasmic shuttling requires NLS and NES activities. (A) Truncation mutations help to identify regions necessary for nuclear import and export of CDC-14C. Diagram summarizing the predominant subcellular GFP location observed for the chimeric protein is indicated as either cytoplasm (C) or nucleus (N). The phosphatase domain (P), putative nuclear import sequences (numbered) and nuclear export sequence (E) of CDC-14C are indicated by the black, light gray and dark gray boxes, respectively. NLS1 through NLS3 are located at positions Lys88 to Arg92, Lys366 to Arg371 and Arg676 to Lys681, respectively. N-terminal GFP fusion is indicated by the striped box. (B) Site-directed substitution mutations to disrupt the NES result in nuclear accumulation of GFP–CDC-14CDNES. (C) Cytoplasmic location of GFP–CDC-14CDNLS1,2,3DNES with mutations to disrupt the NES and all three NLS sequences. In (B) and (C), upper panels show GFP epifluorescence, lower panels are Nomarski and scale bar indicates 5 lm. (D) Box and whisker plots display ratios of average GFP pixel values observed within the nucleus and cytoplasm, n P 11 V cells for each construct. (E) Schematic illustration of the general structure of CDC-14C. P, I and E indicate phosphatase domain, nuclear import and export sequences, respectively.

MECHANISMS OF DEVELOPMENT

A

promotes

the

cytoplasmic

To examine the coordination of CDC-14C localization with regulation of the cell cycle, we determined the localization pattern of GFP–CDC-14C in cyd-1(he112) mutant animals. In the cyd-1(he112) mutant animals, the cells that normally divide during larval development were unable to progress through G1 (Boxem and van den Heuvel, 2001). Unlike the cytoplasmic location observed in control cells (Fig. 6A), in cyd-1(he112) mutant animals the GFP–CDC-14C was strongly accumulated within the nucleoplasm of the arrested V cells (Fig. 6A and B). To determine if the nuclear accumulation in cyd-1(he112) mutant animals was a direct result of cyd-1 deficiency or an indirect consequence of G1 phase arrest, we simultaneously inhibited lin-35 and cki-1 by RNAi. Loss of lin-35 and cki-1 activities, which respectively encode C. elegans Retinoblastoma and Cip/Kip homologs, was demonstrated to partially suppress the Cyd-1 cell-cycle arrest phenotype with many of the earlier larval divisions proceeding in the cyd1(he112); lin-35(RNAi); cki-1(RNAi) animals (Boxem and van den Heuvel, 2001). Strikingly, the GFP–CDC-14C remained nuclear localized within these animals (Fig. 6C), supporting a more direct role for cyd-1 activity in promoting CDC-14C nuclear export. We performed a genetic epistasis analysis with cyd-1 and cdc-14 to test the hypothesis that cyd-1 may promote cell-cycle progression in part through the nuclear export and inhibition of CDC-14C. Since cyd-1(lf) mutant animals were defective in post-embryonic development and therefore did not produce VPCs (Boxem and van den Heuvel, 2001; Park and Krause, 1999), the analysis used an intestine-based cell-cycle assay. Newly hatched wild-type animals contain 20 intestinal cells, however during late L1 stage approximately 10–14 nuclei divide to yield a total of 30–34 nuclei (Sulston and Horvitz, 1977). In contrast, cyd-1(he112) mutant animals hatch with 16 intestinal nuclei that do not undergo further divisions (Boxem and van den Heuvel, 2001). Simultaneous loss of lin35 and cki-1 was able to partially suppress the cyd-1(he112) division defects indicating that cyd-1 likely promoted G1

WT cyd-1(he112) CDC-14C-GFP, N/C ratio

the NES and all three putative NLS sequences resulted in a predominantly cytoplasmic localization (Fig. 5C and D). The inhibition of nuclear accumulation by the addition of DNLS1,2,3 mutations suggested a block in the ability of GFP– CDC-14CDNLS1,2,3DNES to be imported into the nucleus. We determined that NLS2, located between residues Lys366 and Arg371, was solely required for import since the GFP–CDC14CDNLS2DNES protein, containing mutations of NLS2 and the NES, remained localized within the cytoplasm. Conversely, introduction of the DNLS1DNLS3DNES mutations (GFP–CDC14CDNLS1,3DNES) did not appreciably inhibit nuclear import and subsequent accumulation. Since NLS1 and NLS3 did not contribute to nuclear import of full-length CDC-14C, we suspected that the truncation analyses of CDC-14C exposed irrelevant NLS-related sequences. We concluded that only NLS2 was necessary and sufficient for CDC-14C nuclear translocation. Therefore, the adjacently located nuclear import and export sequences of CDC-14C (Fig. 5E) likely counteract each other to determine the subcellular localization within the cell.

2.5. Cyclin D activity localization of CDC-14C

323

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

1.4 1.2 1.0 0.8

C

B

intestinal nuclei

D 40 20

cyd-1

+/-

RNAi

control

-/-

-/-/-/cdc-14 lin-35 cdc-14 + lin-35

Fig. 6 – cyd-1 promotes nuclear export of CDC-14C and inhibits cdc-14-dependent cell-cycle quiescence. (A) Box and whisker plot comparison of nuclear-to-cytoplasmic ratios of GFP–CDC-14C in wild-type and cyd-1 mutant animals. GFP– CDC-14C accumulates in the V cell nuclei of both (B) cyd1(he112) and (C) cyd-1(he112); lin-35(RNAi); cki-1(RNAi) mutant animals. V cells are indicated by arrows and scale bar indicates 5 lm. (D) The number of intestinal nuclei produced by cyd-1(+/) (shaded bar) and cyd-1(/) (white bars) animals was determined during L4 stage following the indicated RNAi treatments. Bars indicate mean values ± s.d. (n = 20 animals per experiment).

progression through negative regulation of lin-35 and cki-1 (Boxem and van den Heuvel, 2001). In a similar manner, we found that inhibition of neither cdc-14 nor lin-35 alone was able to significantly rescue the intestinal division defect of cyd-1(he112) mutant animals, while simultaneous inhibition through injection of both cdc-14 and lin-35 double-stranded RNAs resulted in a wild-type complement of nuclei (Fig. 6D). These data support a model wherein cyd-1 promotes G1/S progression by inhibiting parallel processes requiring cdc-14 and lin-35 activities.

3.

Discussion

3.1.

The role of cdc-14 in the cell cycle

What is the function of the Cdc14 phosphatase in C. elegans? The cdc-14(he141) null mutation does not by itself cause mitotic arrest nor does it enhance the zen-4(or153ts) lethal phenotype. As the enhancement of the Zen-4(ts) lethality by cdc-14(RNAi) was the basis of the conclusion that cdc-14 played a critical role in mitotic progression (Gruneberg et al., 2002), we conclude that cdc-14 does not play a critical function during mitosis. Our data, obtained from experiments using a genetic knockout mutation, support the hypothesis that the lethality arising from defective cytokinesis previously observed following cdc-14(RNAi) was due to off-target effects,

324

MECHANISMS OF DEVELOPMENT

likely a result of the high concentrations of the doublestranded RNA used in that study (Kipreos, 2004). Our data are consistent with a previous conclusion that cdc-14 mainly functions as a developmental regulator of cell-cycle quiescence (Saito et al., 2004). Indeed, the demonstration that cdc14 acts in parallel with lin-35 to negatively regulate cell cycle progression downstream of cyd-1 further supports that cdc14 functions as a key positive regulator of cell-cycle quiescence during C. elegans development.

3.2.

Developmental control of cdc-14

The regulation of cdc-14 activity during development is not accomplished by a single cellular process. Rather, we present evidence that several developmental mechanisms collaborate to regulate CDC-14C, the primary alternative splice form that regulates cell-cycle quiescence during vulva development. Initially, cdc-14 is widely transcribed but CDC-14C protein expression is restricted through post-transcriptional fine-tuning. Our data show that specific introns and 3 0 -UTR are necessary for the normal CDC-14C expression pattern, indicating that alternative splicing and mRNA stability and/or translational regulation play important roles in directing spatiotemporal expression. Once CDC-14C is expressed within the appropriate cells, the subcellular location is established through control of nucleocytoplasmic shuttling. Interestingly, disruption of the NES within CDC-14C resulted in nuclear accumulation but the cells were able to continue divisions, demonstrating that forced nuclear accumulation of CDC-14C alone is not sufficient to cause ectopic arrest in the V cells. In contrast, over-expression of CDC-14C using a heat-shock induction system can induce the intestine to undergo a cki1-dependent cell-cycle arrest (Saito et al., 2004). The steadystate location shift from cytoplasm to nucleus suggests that the normal location within the cytoplasm is the result of dynamic import into the nucleus counteracted by active export. Moreover, these data indicate that unlike Cdc14p in budding yeast, CDC-14C activity is not regulated by nucleolar sequestration. Future studies to describe the developmental expression patterns of Cdc14 family members in higher metazoans are necessary to determine if the regulatory mechanisms observed in C. elegans are evolutionarily conserved.

3.3.

Conservation of function within the Cdc14 family

C. elegans cdc-14 displays several characteristics that place it between fungal and higher metazoan Cdc14 family members. The Cdc14 family of dual specificity phosphatases is characterized by a highly conserved N-terminal catalytic domain. By contrast, the C-terminal sequences contain an NES but overall display greater divergence between species. Not surprisingly, sequence-based phylogenetic analyses place cdc-14 intermediate between fungal and higher metazoan Cdc14 sequences (Mocciaro and Schiebel, 2010). Our functional analyses of the CDC-14C structure support the sequence-based analysis. In addition to the previously noted similarities, the C-termini of both Cdc14p of Saccharomyces cerevisiae (Mohl et al., 2009) and CDC-14C can support nuclear import. Interestingly, we note the following similarities between CDC-14C and the metazoan Cdc14A orthologs. First,

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

the nucleolar targeting sequence found at the N-termini of vertebrate Cdc14B (Kaiser et al., 2002; Mailand et al., 2002; Mocciaro et al., 2010) is absent from CDC-14C. Consistent with the absence of the signal sequence, we do not observe significant nucleolar accumulation of CDC-14C in interphase cells. Second, CDC-14C is located within the cytoplasm of interphase cells, similar to the localization observed for hCdc14A (Kaiser et al., 2002; Mailand et al., 2002). Third, the Cdc14A cytoplasmic location is the result of active Crm1-dependent nuclear export (Mailand et al., 2002; Bembenek et al., 2005). Fourth, CDC-14C harbors a sequence, NLS1, that can support nuclear import and its position is conserved with the NLS of human Cdc14A (Mailand et al., 2002). These similarities suggest conservation with Cdc14A, however, our observations of cdc-14 function are more consistent with the reported role of human Cdc14B in the control of G1 progression (Rodier et al., 2008). Since Cdc14B has also been associated with DNA-damage checkpoint (Bassermann et al., 2008), meiotic progression (Schindler and Schultz, 2009), centriole replication (Wu et al., 2008) and most recently, ciliogenesis (Clement et al., 2011), it will be interesting to see if similar defects are revealed in cdc-14 mutant worms. Since C. elegans cdc-14 acts as a component of a larger regulatory network, we expect that future studies of Cdc14 in higher organisms will connect specific developmental pathways to cell-cycle regulation and provide further insights into the coordination of development and cell cycle progression.

4.

Experimental procedures

4.1.

C. elegans strains

Worm strains were grown as previously described (Brenner, 1974). The following N2-based alleles, balancers and markers were used in these studies: LGII: cdc-14(he141) (Saito et al., 2004), cdc-14(ok1407), cyd-1(he112) (Boxem and van den Heuvel, 2001), mIn1[dpy-10(e128) + mIs14] (Edgley and Riddle, 2001); LGIV: zen-4(or153ts) (Severson et al., 2000), rtIs14 [elt2::GFP + osm-10::HT150Q] (gift from P.W. Faber and A. Hart), ztIs12[Pcol-10::GFP::CDC14C) + rol-6(su1006)] (this study); and xsEx6[zen-4::gfp + rol-6(su1006)] (Kaitna et al., 2000). The cdc14(he141); zen-4(or153ts) double-mutant strain was produced by selecting non-transgenic self-progeny of a cdc-14(he141); zen-4(or153ts); xsEx6[zen-4::gfp + rol-6(su1006)] strain.

4.2.

C. elegans analyses

The cdc-14(ok1407) strain was obtained from the Caenorhabditis Genetics Center and based on provided information we identified the sequence of the ok1407 molecular lesion as: ACAGAAGCTCTTTTAAAAAAAAAAAAAACAACCAGCCGTA, where the underlined sequence replaces 1144 basepairs found in the wild-type genome. For quantitative PCR of the CDC-14C alternative splice form, RNA was isolated from approximately 800 L2-aged N2 and cdc-14(ok1407) animals with the RNeasy kit (Qiagen) and reverse transcribed using Superscript III (Invitrogen). Relative expression levels were determined as previously described (Buck et al., 2009). CDC-14C mRNA was assayed using the primers: GTGCCTCCTGATTCACCGCATAG and GGTAGTGT

MECHANISMS OF DEVELOPMENT

GTACATTCATCATTTCCGCTCACAAC. Amplification of gpd-2 used the primers: ACCGGAGTCTTCACCACCATC and TTCCTGA TGGTCCGTCAACAG. For quantitative analyses of cell-cycle quiescence phenotypes, VPCs and intestinal nuclei were examined after 24 and 48 h of larval growth at 20 °C, respectively. Percent brood viability was determined by counting viable offspring and unhatched non-viable eggs produced by hermaphrodites grown at the indicated temperatures. Transgenic animals were produced as previously described (Mello et al., 1991; Saito et al., 2004). Plasmids used in transgenes are described in Supplementary material Table 1. To analyze the subcellular localization of GFP–CDC-14C chimeric proteins, V cells of transgenic animals raised at 15 °C for 24 h after feeding were examined. For starvation arrested animals, newly hatched L1s were housed in S-medium without food for 24 h prior to analyses. Images were obtained and analyzed using Zeiss AxioImager microscope, AxioCam camera, and AxioVision software. The average GFP pixel values within the cytoplasm and nucleus (three locations each) were used to calculate a nucleus-to-cytoplasm ratio for each cell. The ratios of at least 11 V cells were determined for each experiment.

4.3.

RNAi and analyses

For injection RNAi experiments, double-stranded RNA corresponding to cdc-14, cki-1 and lin-35 open reading frames were produced using the Megascript in vitro transcription kit (Ambion) and injected into unc-4(e120) cyd-1(he112)/mIn1 II; rtIs14 IV or unc-4(e120) cyd-1(he112)/mIn1 II; ztIs12 hermaphrodites. cyd-1(he112) homozygous progeny were identified on the basis of GFP-negative head regions. For xpo-1(RNAi) experiments, 1012 basepairs of the xpo-1 mRNA was PCR amplified from mixed-stage cDNA using the primers CACTGTGTGTCAGC ATTCTC and CCACGTTTCTGTTCACAGAG, cloned into the RNAi feeding vector, pPD129.36, and transformed into HT115 bacteria (Timmons et al., 2001). Developmentally arrested ztIs12 worms were generated by starvation and induced to synchronously develop by feeding of xpo-1(RNAi) or control bacteria. Animals were allowed to develop for 20 h at 15 °C prior to quantification of GFP signal in V cells. For experiments requiring DNA staining, larvae were stained with 4 0 ,6-diamidino-2-phenylindole (DAPI) prior to mounting.

Acknowledgments We thank Barbara Conradt and Patricia Ernst for critical reading of the manuscript and Erika Artinger for help with realtime PCR. Some nematode strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources (NCRR). This work was funded by the National Institutes of Health Grant R01-GM077031 (R.M.S.).

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.mod.2011.06.001.

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

325

R E F E R E N C E S

Bassermann, F., Frescas, D., Guardavaccaro, D., Busino, L., Peschiaroli, A., Pagano, M., 2008. The Cdc14B–Cdh1–Plk1 axis controls the G2 DNA-damage-response checkpoint. Cell 134, 256–267. Bembenek, J., Kang, J., Kurischko, C., Li, B., Raab, J.R., Belanger, K.D., Luca, F.C., Yu, H., 2005. Crm1-mediated nuclear export of Cdc14 is required for the completion of cytokinesis in budding yeast. Cell Cycle 4, 961–971. Berdougo, E., Nachury, M.V., Jackson, P.K., Jallepalli, P.V., 2008. The nucleolar phosphatase Cdc14B is dispensable for chromosome segregation and mitotic exit in human cells. Cell Cycle 7, 1184– 1190. Boxem, M., van den Heuvel, S., 2001. Lin-35 Rb and cki-1 Cip/Kip cooperate in developmental regulation of G1 progression in C. elegans. Development 128, 4349–4359. Brenner, S., 1974. The genetics of Caenorhabditis elegans. Genetics 77, 71–94. Buck, S.H., Chiu, D., Saito, R.M., 2009. The cyclin-dependent kinase inhibitors, cki-1 and cki-2, act in overlapping but distinct pathways to control cell cycle quiescence during C. elegans development. Cell Cycle 8, 2613–2620. Clayton, J.E., van den Heuvel, S.J., Saito, R.M., 2008. Transcriptional control of cell-cycle quiescence during C. elegans development. Dev. Biol. 313, 603–613. Clement, A., Solnica-Krezel, L., Gould, K.L., 2011. The Cdc14B phosphatase contributes to ciliogenesis in zebrafish. Development 138, 291–302. D’Amours, D., Amon, A., 2004. At the interface between signaling and executing anaphase – Cdc14 and the FEAR network. Genes Dev. 18, 2581–2595. De Wulf, P., Montani, F., Visintin, R., 2009. Protein phosphatases take the mitotic stage. Curr. Opin. Cell Biol. 21, 806–815. Edgley, M.L., Riddle, D.L., 2001. LG II balancer chromosomes in Caenorhabditis elegans: mT1(II;III) and the mIn1 set of dominantly and recessively marked inversions. Mol. Genet. Genomics 266, 385–395. Gruneberg, U., Glotzer, M., Gartner, A., Nigg, E.A., 2002. The CeCDC-14 phosphatase is required for cytokinesis in the Caenorhabditis elegans embryo. J. Cell Biol. 158, 901–914. Higashibata, A., Szewczyk, N.J., Conley, C.A., Imamizo-Sato, M., Higashitani, A., Ishioka, N., 2006. Decreased expression of myogenic transcription factors and myosin heavy chains in Caenorhabditis elegans muscles developed during spaceflight. J. Exp. Biol. 209, 3209–3218. Kaiser, B.K., Zimmerman, Z.A., Charbonneau, H., Jackson, P.K., 2002. Disruption of centrosome structure, chromosome segregation, and cytokinesis by misexpression of human Cdc14A phosphatase. Mol. Biol. Cell 13, 2289–2300. Kaitna, S., Mendoza, M., Jantsch-Plunger, V., Glotzer, M., 2000. Incenp and an aurora-like kinase form a complex essential for chromosome segregation and efficient completion of cytokinesis. Curr. Biol. 10, 1172–1181. Kelly, W.G., Xu, S., Montgomery, M.K., Fire, A., 1997. Distinct requirements for somatic and germline expression of a generally expressed Caernorhabditis elegans gene. Genetics 146, 227–238. Kipreos, E.T., 2004. Developmental quiescence: Cdc14 moonlighting in G1. Nat. Cell Biol. 6, 693–695. Kirienko, N.V., Mani, K., Fay, D.S., 2010. Cancer models in Caenorhabditis elegans. Dev. Dyn. 239, 1413–1448. Kutay, U., Guttinger, S., 2005. Leucine-rich nuclear-export signals: born to be weak. Trends Cell Biol. 15, 121–124. Mailand, N., Lukas, C., Kaiser, B.K., Jackson, P.K., Bartek, J., Lukas, J., 2002. Deregulated human Cdc14A phosphatase disrupts

326

MECHANISMS OF DEVELOPMENT

centrosome separation and chromosome segregation. Nat. Cell Biol. 4, 317–322. McCollum, D., 2004. Cytokinesis: the central spindle takes center stage. Curr. Biol. 14, R953–R955. Mello, C.C., Kramer, J.M., Stinchcomb, D., Ambros, V., 1991. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10, 3959–3970. Mocciaro, A., Schiebel, E., 2010. Cdc14: a highly conserved family of phosphatases with non-conserved functions? J. Cell Sci. 123, 2867–2876. Mocciaro, A., Berdougo, E., Zeng, K., Black, E., Vagnarelli, P., Earnshaw, W., Gillespie, D., Jallepalli, P., Schiebel, E., 2010. Vertebrate cells genetically deficient for Cdc14A or Cdc14B retain DNA damage checkpoint proficiency but are impaired in DNA repair. J. Cell Biol. 189, 631–639. Mohl, D.A., Huddleston, M.J., Collingwood, T.S., Annan, R.S., Deshaies, R.J., 2009. Dbf2–Mob1 drives relocalization of protein phosphatase Cdc14 to the cytoplasm during exit from mitosis. J. Cell Biol. 184, 527–539. Nakamura, K., Kim, S., Ishidate, T., Bei, Y., Pang, K., Shirayama, M., Trzepacz, C., Brownell, D.R., Mello, C.C., 2005. Wnt signaling drives WRM-1/beta-catenin asymmetries in early C. elegans embryos. Genes Dev. 19, 1749–1754. Okkema, P.G., Harrison, S.W., Plunger, V., Aryana, A., Fire, A., 1993. Sequence requirements for myosin gene expression and regulation in Caenorhabditis elegans. Genetics 135, 385–404. Park, M., Krause, M.W., 1999. Regulation of postembryonic G1 cell cycle progression in Caenorhabditis elegans by a cyclin D/CDKlike complex. Development 126, 4849–4860. Pothof, J., van Haaften, G., Thijssen, K., Kamath, R.S., Fraser, A.G., Ahringer, J., Plasterk, R.H., Tijsterman, M., 2003. Identification of genes that protect the C. elegans genome against mutations by genome-wide RNAi. Genes Dev. 17, 443–448. Queralt, E., Uhlmann, F., 2008. Cdk-counteracting phosphatases unlock mitotic exit. Curr. Opin. Cell Biol. 20, 661–668. Raich, W.B., Moran, A.N., Rothman, J.H., Hardin, J., 1998. Cytokinesis and midzone microtubule organization in

1 2 8 ( 2 0 1 1 ) 3 1 7 –3 2 6

Caenorhabditis elegans require the kinesin-like protein ZEN-4. Mol. Biol. Cell 9, 2037–2049. Rodier, G., Coulombe, P., Tanguay, P.L., Boutonnet, C., Meloche, S., 2008. Phosphorylation of Skp2 regulated by CDK2 and Cdc14B protects it from degradation by APC(Cdh1) in G1 phase. EMBO J. 27, 679–691. Saito, R.M., Perreault, A., Peach, B., Satterlee, J.S., van den Heuvel, S., 2004. The CDC-14 phosphatase controls developmental cell-cycle arrest in C. elegans. Nat. Cell Biol. 6, 777–783. Schindler, K., Schultz, R.M., 2009. CDC14B acts through FZR1 (CDH1) to prevent meiotic maturation of mouse oocytes. Biol. Reprod. 80, 795–803. Severson, A.F., Hamill, D.R., Carter, J.C., Schumacher, J., Bowerman, B., 2000. The aurora-related kinase AIR-2 recruits ZEN-4/CeMKLP1 to the mitotic spindle at metaphase and is required for cytokinesis. Curr. Biol. 10, 1162–1171. Shou, W., Seol, J.H., Shevchenko, A., Baskerville, C., Moazed, D., Chen, Z.W., Jang, J., Charbonneau, H., Deshaies, R.J., 1999. Exit from mitosis is triggered by Tem1-dependent release of the protein phosphatase Cdc14 from nucleolar RENT complex. Cell 97, 233–244. Sternberg, P.W., 2005. Vulval development. The C. elegans Research Community. WormBook, pp. 1551–8507. Sulston, J.E., Horvitz, H.R., 1977. Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev. Biol. 56, 110–156. Timmons, L., Court, D.L., Fire, A., 2001. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263, 103–112. Visintin, R., Hwang, E.S., Amon, A., 1999. Cfi1 prevents premature exit from mitosis by anchoring Cdc14 phosphatase in the nucleolus. Nature 398, 818–823. Wightman, B., Ha, I., Ruvkun, G., 1993. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75, 855–862. Wu, J., Cho, H.P., Rhee, D.B., Johnson, D.K., Dunlap, J., Liu, Y., Wang, Y., 2008. Cdc14B depletion leads to centriole amplification, and its overexpression prevents unscheduled centriole duplication. J. Cell Biol. 181, 475–483.