Cooled perch effects on performance and well-being traits in caged White Leghorn hens

Cooled perch effects on performance and well-being traits in caged White Leghorn hens J. Y. Hu,∗ P. Y. Hester,∗,1 M. M. Makagon,∗ G. Vezzoli,∗ R. S. Gates,† Y. J. Xiong,† and H. W. Cheng‡,2 ∗

Department of Animal Sciences, Purdue University, West Lafayette IN 47907; † Agricultural and Biological Engineering Department, University of Illinois, Urbana, IL 61801; and ‡ USDA-Agricultural Research Service, Livestock Behavior Research Unit, West Lafayette, IN 47907

Key words: laying hen, heat stress, cooled perch, performance, behavior 2016 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pew248

INTRODUCTION

and Orme-Evans, 2015), and may be anticipated to increase in severity with climate change. In India, for example, hen mortalities climbed from an average of 3 to 10% due to recent frequent and severe heat waves (Kesireddy, 2015). In the United States, heat stress was estimated to cost $0.24 billion annually in the poultry industry (St-Pierre et al., 2003). Adult chickens are homoeothermic animals. Without sweat glands, they use shallow breathing or panting as a major means for cooling themselves (Richards, 1970). In addition, when exposed to high ambient temperatures, chickens attempt to reduce internal body heat by changing their behaviors such as reducing eating and increasing drinking and panting as well as wing-spreading to enhance convective heat loss (Mack et al., 2013). The heat stress-induced reduction in feed intake consequently retards essential maintenance functions in chickens, and causes reproductive failure in laying hens with impaired egg quality and poor skeletal health (Ethes et al., 1995; Mashaly

Heat stress is one of the most important environmental stressors facing the poultry industry globally. Most egg laying strains of chickens are housed in climates where, at some point in their egg laying cycle, they are likely to be exposed to high temperatures. Animal health and welfare of all livestock, including hens, is affected by heat waves (Black et al., 2008; Koneswaran and Nierenberg, 2008; Lara and Rostagno, 2013; Shields

Published by Oxford University Press on behalf of Poultry Science Association 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US. Received March 28, 2016. Accepted June 6, 2016. 1 Corresponding author: [email protected] 2 Current address: Department of Animal Science, University of California, Davis, CA

1

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

proportion of hens per cage perching, feeding, drinking, panting, and wing spreading was evaluated over one d every 5 wks and on the d of acute heat stress. There were no treatment effects on the measured physiological and production traits except for nail length. Nails were shorter for cooled perch hens than control (P = 0.002) but not air perch hens. Panting and wing spread were observed only on the day of acute heat stress. The onset of both behaviors was delayed for cooled perch hens, and they perched more than air perch hens following acute heat stress (P = 0.001) and at the age 21.4 wk (P = 0.023). Cooled perch hens drank less than control (P = 0.019) but not air perch hens at the age 21.4 wk. These results indicate that thermally cooled perches reduced thermoregulatory behaviors during acute heat stress, but did not affect their performance and physiological parameters under the ambient temperature imposed during this study.

ABSTRACT We assessed the effects of chilled water cooling perches on hen performance and physiological and behavioral parameters under “natural” high temperatures during the 2013 summer with a 4-hour acute heating episode. White Leghorns at 16 wk of age (N = 162) were randomly assigned to 18 cages (n = 9) arranged into 3 units. Each unit was assigned to one of the 3 treatments through 32 wk of age: 1) cooled perches, 2) air perches, and 3) no perches. Chilled water (10◦ C) was circulated through the cooled perches when cage ambient temperature exceeded 25◦ C. At the age of 27.6 wk, hens were subjected to a 4-hour acute heating episode of 33.3◦ C and plasma corticosterone was determined within 2 hours. Egg production was recorded daily. Feed intake and egg and shell quality were measured at 5-week intervals. Feather condition, foot health, adrenal and liver weights, plasma corticosterone, and heat shock protein 70 mRNA were determined at the end of the study at 32 wk of age. The

2

HU ET AL.

MATERIALS AND METHODS Chickens and Experimental Design The study was conducted from June to September of 2013 in West Lafayette, Indiana. All hens used in this experiment were housed and cared for under the protocol approved by the Animal Care and Use Committee of Purdue University (PACUC#: 1302000813). At 16 wk of age, 162 Hy-Line W36 White Leghorns were transported to the Layer Research Unit at Purdue University Poultry Research Farm and randomly assigned to one of 3 units. All 3 units were inside of a light-tight room under exact same environmental conditions. A unit consisted of 3 deck levels with 2 cages per deck. Nine birds were housed in each cage (439 cm2 /hen). In the perch groups, each deck level had 2 perches that were connected to form a continuous loop for each deck. For the cooled perch group, a manifold was used to supply chilled water in each loop, which was independently controlled by cage air temperature via thermal sensors and pumps (Figure 1, Gates et al., 2014). The cage provides 439 cm2 stocking density, 16.9 cm perch space/chicken, and 8.4 cm feeder space/chicken, respectively. (Hester et al., 2013b). Temperature and relative humidity (T/RH) data loggers (model ZW-007 for cages with perches and model ZW-003 for cages without perches, Onset Computer Co., Bourne, MA) were installed in each deck (Figure 1a-c). Two resistance temperature detector (RTD) temperature sensors were installed in each cooled perch loop of each tier to measure the supply and return water temperature; similarly, a single point for the air perch also was measured. Room and cage temperature and room relative humidity were measured and recorded at one-min intervals throughout the experimental period. Temperature and relative humidity data were averaged every 10 min for analysis. The units were randomly assigned to one of the 3 treatments: cages with 1) thermally cooled perches (Figure 1a), 2) perches with ambient air (Figure 1b), and 3) no perches (Figure 1c). Chilled water (10o C) was circulated through the thermally cooled perch loops when cage ambient temperature reached 25◦ C. Details on the design of the cooled perches and the instrumentation for monitoring the caging environments were provided by Gates et al. (2014). Room temperature was based on the natural climate and ranged from 17.7 to 32.5o C at night to about 19.5 to 33.1o C during daytime, except at 27.6 wk when hens were subjected to a 4-hour acute heating episode (1,000 to 1,400) during which room temperature was set to an average of 33.7o C (room temperature reached a peak within one h and remained consistent for 3 h, ranging from 32 to 34.6o C).

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

et al., 2004; Yahav, 2009; Ebeid et al., 2012; MignonGrasteau et al., 2015). Under high-temperature conditions, chickens also modify their endocrine profiles to regulate body temperature. In the case of hot weather, the hypothalamus elevates responses to alter metabolism so that heat production is reduced and heat loss is increased (van Theinhoven et al., 1979; Dawson and Whittow, 2000; Tabarean et al., 2010). The hypothalamic-pituitary-adrenal axis is one of the most important systems activated in response to stress stimuli, resulting in increased corticosterone release from the adrenal glands (Siegel, 1980; Cook et al., 2009). During stress, corticosterone redistributes glucose and proteins to more critical tissues needed for survival such as the respiratory, cardiovascular, and renal systems and inhibits the uptake of glucose by less critical tissues such as the reproductive, skeletal, and immune systems (Savory and Mann, 1997; Carsia and Harvey, 2000; Virden et al., 2007; Wang et al., 2013). Stress in chickens also may induce adrenal gland hypertrophy, which has been used as a common stress indicator (Siegel, 1980). In addition, multiple studies have shown that heat shock proteins (HSP), specifically HSP70, protect cells from stress-induced damage, including heat stress (Zulkifil et al., 2009; Felver-Gant et al., 2012). Protein levels and mRNA expression of HSP70 are increased in the blood and organs of chickens in response to high ambient temperatures (Gabriel et al., 1996; Wang and Edens, 1998; Felver-Gant et al., 2012). It is estimated that 94 and 90% of the egg laying hen population in the United States and the world, respectively, are housed in conventional cages (United Egg Producers, 2014). The European Union has banned the use of conventional cages since 2012, and furnished cages are the only cage system permitted (CEC, 1999). Similarly, the U.S. egg industry is introducing furnished cages as a more hen welfare friendly housing system to replace conventional cages (Greene and Cowan, 2012). The furnished cage system provides hens with more space allowance, perch, nest box, and scratch areas to meet their behavioral needs. In addition to allowing for roosting behavior, the provision of perches also has positive effects on skeletal development, bone mineralization, and bone strength (Tactacan et al., 2009; Enneking et al., 2012; Hester et al., 2013a). Studies of broiler chickens have shown that perches could be modified as cooling devices to improve bird thermal comfort during the summer hot months (Reilly et al., 1991; Okelo et al., 2003). However, to date no assessment of benefits of cooled perches to laying hens has been undertaken. The objective of this study was to determine if chilled water cooling perches prevent the deleterious effects of heat stress in caged laying hens by assessing performance, egg quality, feather condition, foot health, and behavioral and physiological parameters.

COOLED PERCHES AND HEN WELFARE

3

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

Figure 1. Cage unit design and dimensions for the 3 treatments of cooled perch cages (1a), air perch cages (1b), and control cages with no perches (1c). Two perches were installed in each layer cage in parallel arrangement to each other. Perch height for both perches was 8.9 cm (3.5 inch) from the cage floor. There was a distance of 15 cm (6 in) between the 2 perches and a distance of 18 cm (7 in) between the front perch and the feed trough. Between the rear perch and the back of the cage, there was a distance of 15 cm (6 in). For the cooled perch treatment, a manifold was used to supply perch lines with chilled water in a continuous loop for each deck. Perch loops were independently controlled by cage air temperature of each deck via thermal sensors and pumps. Printed with permission from the American Society of Agricultural and Biological Engineers (Gates et al., 2014).

A pre-lay diet with 20.0% CP, 3,009 kcal ME/kg, 1.0% Ca, and 0.45% non-phytate phosphorus was fed from 16 to 17 wk of age followed by a laying diet with 18.3% CP, 2,890 kcal ME/kg, 4.2% Ca, and 0.3% non-

phytate phosphorus. Hens had free access to food and water throughout the experiment. The lighting schedule was gradually stepped up to 16L:8D, which was achieved at 30 wk of age.

4

HU ET AL.

Physical and Physiological Sampling

Egg Production and Quality Eggs were recorded daily during the study. Hen-day egg production was calculated as: the total number of eggs produced per cage/number of live hens per cage x 100. The percentage of cracked eggs and dirty eggs (egg with blood and/or feces) per cage were calculated, respectively. Five intact hard-shelled eggs were randomly collected from each cage (30 eggs/treatment) during 2 consecutive d at 23, 26, and 29 wk of age, respectively. Each collected egg was weighed individually. The eggs were frozen to crack the shell. The yolk and albumen were removed from each egg after thawing and discarded. The shell with intact shell membranes was rinsed with water and dried at 60o C. The dried shell weight was recorded. Shell thickness and % shell mass were determined as described by Klingensmith and Hester (1985).

Plasma Corticosterone Plasma corticosterone concentration was measured using a commercially available radioimmunoassay kit (MP Biomedicals, Orangeburg, NY). Total plasma corticosterone concentrations were analyzed in duplicate following the protocol described by Cheng et al. (2001).

Heat Shock Protein Heat shock protein 70 (HSP70) mRNA expression in the liver was detected by real-time PCR, using the primers (5 -3 Forward: CACCATCACTGGCCTTAACGT; Reverse: TTATCCAAGCCATAGGCAATAGC) and the probe (5 -3 ATGCGTATTATCAATGAGCCCA) from Applied Biosystems (Foster City, CA); and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene (Felver-Gant et al., 2012).

Behavioral Observation Hen behavior was evaluated using a combination of live and video observations. Live observations were conducted at 1000 to 1100, 1400 to 1500, 1800 to 1900, and 2300 to 2400 h when hens were 16.6, 21.4, 26.6, and 31.3 wks old. From each time point, the same trained observer walked through the room twice counting the number of hens per cage perching, and whether at least one hen was panting or wing spreading. The starting point of each observation was randomized, and 12 minutes were allotted between the 2 observations. Feeding and drinking behaviors were collected from the videos recorded from 1000 to 1600 h on the d of live observations using 5 s of video stream at 15 min intervals.

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

Feed intake of each cage was determined at 20, 25, and 30 wk of age. The feed was weighed at the beginning and end of each experimental wk, and the average daily feed intake per hen was calculated as reported previously (Hester et al., 2013b). At the age of 27.6 wk, blood collection from hens began at 2 h after the initiation of a 4-hour acute heating episode and was completed just before the heating episode ended. To minimize effects of circadian variation on the measured parameters, blood samples were collected from one hen from each of the 3 treatment groups. One hen was sampled from a cooled, air, and no perch cage. This pattern was repeated until the end. A 4-mL blood sample was collected randomly from 2 hens per cage (n = 12 hens per treatment) via the brachial vein within 2 min of removing hens from their cages. None of the hens used for blood collection had an egg in the shell gland as determined through uterine palpation. To avoid any variation that might be caused by sampling time, one hen was sampled from each treatment consecutively until all 36 hens had been sampled. A ring was placed on the leg of each of the bled hens so as to avoid using the same hens in subsequent blood sampling. The blood samples were centrifuged at 700 x g for 20 min at 4◦ C. The supernatant plasma was collected and stored at −80◦ C until analysis. Blood samples were collected again from previously non-sampled hens at the end of the study when they were 32 wk of age following the same procedure with the exception that hens were sedated with sodium pentobarbital (30 mg of pentobarbital/kg of BW injected into the brachial vein) and a 5-mL blood sample was collected from each hen through cardiac puncture (n = 12 hens per treatment). Hens were euthanized via cervical dislocation immediately following blood collection, and individual BW was recorded. Hen feather score was measured following euthanasia at 5 different parts of the body: neck, breast, back, wings, as well as the vent and tail area, using a 4point scoring system with 1 being the worst condition and 4 representing the best condition with few worn or deformed feathers (Tauson et al., 2005; Hester et al., 2013b). The footpads and all toes were scored for hyperkeratosis condition using a 1 to 4 scoring system described by Tauson (1984). A score of 1 represented severe hyperkeratosis, i.e., footpads and toes had deep and large epithelial lesions; whereas, a score of 4 represented healthy feet and toes with no lesions. The scores of both feet and feathers were averaged, respectively, for each hen. The 8 nail lengths of each hen were measured using a flexible measuring tape, and the mean length was calculated per hen (Hester et al., 2013b). The whole liver was collected from each hen and weighed. An approximate one cm3 of tissue was collected from the same location of segment VIII of the right liver lobe of each sampled hen and placed immediately on dry ice. The right adrenal gland of each

sampled bird was dissected with connective tissue removed and weighed. Relative liver and right adrenal weights were calculated as g or mg/100 g of BW, respectively.

5

COOLED PERCHES AND HEN WELFARE Table 1. Behavioral ethogram. Behavior

Definition

Feeding Drinking Perching Panting Wing spreading

Bird’s head is located inside feeder. Bird’s beak is in contact with drinker. Both of the bird’s feet are on the perch. Bird is displaying quick and shallow breathing with beak open. A space can be seen between bird’s wings (both wings) and body.

Table 2. Effect of cooled perches on egg production traits of White Leghorn hens from 16 to 32 wk of age in the summer of 2013. Treatment Cooled perch Air perch No perch n3 P-value

Hen-day egg production1 (%)

Cracked eggs1 (%)

Dirty eggs1 (%)

Egg weight2 (g)

Shell weight2 (g)

Proportion of shell2 (%)

Shell thickness2 (mm)

73.8 ± 1.2 76.1 ± 2.1 73.9 ± 1.8 24 0.62

0.49 ± 0.11 0.04 ± 0.19 0.24 ± 0.17 24 0.13

3.3 ± 0.4 3.4 ± 1.2 3.6 ± 0.6 24 0.94

55.2 ± 0.5 53.3 ± 0.7 54.3 ± 0.7 90 0.10

4.83 ± 0.05 4.82 ± 0.05 4.86 ± 0.05 89 0.83

8.71 ± 0.08 8.74 ± 0.09 8.96 ± 0.08 89 0.06

0.358 ± 0.003 0.354 ± 0.009 0.361 ± 0.005 90 0.82

2

Live and video observations were additionally made at 15-min intervals on the d of the heat stress episode from 1015 to 1245 h and 1445 to 1630 h and post-heat stress from 1800 to 1830 h and 2300 to 2330 h. To standardize the number of observations made per h, data analyses focused on the proportion of hens perching, drinking, and feeding at 1015 to 1045, 1115 to 1145, 1215 to 1245, 1500 to 1530, 1800 to 1830, 2300 to 2330 h. Descriptions of the recorded behaviors can be found in Table 1.

Statistical Analysis Data from the randomized design were subjected to an ANOVA using the GLIMMIX procedure for behavior analysis or MIXED method for other parameters of SAS 9.3 software (SAS Institute Inc., Cary, NC, 2011). Repeated measures were used for behavioral and performance traits with deck of cages within treatment serving as the experimental unit. Each of the 2 cages within a deck of a treatment served as a subsample. Fixed effects were treatment and age of the hens. Subsampling error terms included cages within deck and hens within cages within deck. Pooling of error terms occurred when P > 0.25. A one-way ANOVA was used for the remaining data in the study using hen within cage within deck as an additional subsample. If data lacked homogenous variances, transformations of arcsine square root were used and the data reanalyzed. Because statistical trends were similar for both transformed and untransformed data, the untransformed results are presented. Corticosterone and HSP measurements were tested in duplicate with CV ≤ 10%. Tukey-Kramer was used to partition differences among means due to significant treatment effects. Significant statistical differences were reported when P < 0.05.

RESULTS Daily mean room ambient temperature ranged from 19.7 to 28.5o C (average of 23.9o C), and the daily room relative humidity was in the range of 40 to 90% (average of 70%) throughout the entire experimental period. The heat index, calculated using the formula of the Bridges and Gates (2009), was approximately 78. During the acute heating episode when hens were 27.6 wk of age, temperature peaked one h after initiation of the heat treatment and remained consistent for the remaining 3 h, ranging from 32 to 34.6o C (average of 33.7o C). Egg production (% hen-day, cracked, and dirty eggs), egg weight, shell weight, % shell, shell thickness (Table 2), feed intake, BW, relative liver and adrenal weights (Table 3), feather score, hyperkeratosis score of the feet, plasma corticosterone, and mRNA HSP70 (Table 4) did not differ among hens with access to thermally cooled perches and hens with access to air perches or controls without perches. Only nail length was affected with hens given access to cooled perches having shorter nails than the control hens with no perch. Hens with access to air perches had nails that were intermediate in length between the cooled perch hens and control hens (Table 4. P = 0.002). Behavioral results are summarized in Table 5 and Figure 2. Main effects of treatment were found at the ages of 21.4 and 26.6 wk, and on the d of acute heat stress. Not surprisingly, behavior was affected by time of day. The effect of time was similar across treatments as very few time by treatment interactions were identified. At the age of 21.4 wk, hens housed with cooled perches perched more than hens housed with the air perches (P = 0.02) and drank less often than hens housed without perches (P = 0.02). Hens housed with air perches also drank less often than hens housed without perches (P = 0.03). There was no difference between

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

Values represent least square means ± standard errors averaged over 16 wks of egg production. Values represent least square means ± standard errors averaged over 3 ages (23, 26, and 29 wk of age) with 5 eggs collected from each cage (30 egg/treatment) at each age. 3 Average number of observations per least square mean. 1

6

HU ET AL.

Table 3. Effect of cooled perches on feed utilization and body and organ weights of 32-week-old White Leghorn hens. Organ weights Treatment Cooled perch Air perch No perch n3 P-value 1 2 3

Feed utilized1 (g/hen/d)

BW2 (g)

Relative liver2 (g/100 g of BW)

Relative right adrenal2 (mg/100 g of BW)

86.7 ± 3.6 87.5 ± 3.6 85.7 ± 3.6 18 0.59

1440 ± 31 1468 ± 31 1456 ± 31 12 0.81

2.5 ± 0.1 2.6 ± 0.2 2.5 ± 0.1 12 0.99

5.0 ± 0.3 5.1 ± 0.3 5.1 ± 0.3 12 0.96

Values represent least square means ± standard errors averaged over 3 ages (20 to 21, 25 to 26, and 30 to 31 wk of age). Values represent least square means ± standard errors collected from 32-week-old-hens. Number of observations per least square mean.

Table 4. Effect of cooled perches on feather score, hyperkeratosis, nail length, corticosterone levels, and heat shock proteins (HSP) 70 mRNA expression of White Leghorn hens at 27.6 or 32 wk of age. Foot health at 32 wk of age

Cooled perch Air perch No perch n4 P-value

Plasma corticosterone(ng/mL)

Liver

Mean feather score at 32 wk of age1

Hyperkeratosis score2

Nail length (cm)3

27.6 wk of age during acute heat episode

32 wk of age

HSP70 mRNA at 32 wk of age

3.82 ± 0.02 3.83 ± 0.05 3.87 ± 0.04 12 0.60

3.8 ± 0.1 3.9 ± 0.3 3.8 ± 0.2 12 0.96

1.31 ± 0.04b 1.42 ± 0.04a,b 1.53 ± 0.04a 12 0.002

5.7 ± 1.06 5.5 ± 0.97 8.1 ± 0.97 12 0.11

5.2 ± 0.55 4.5 ± 0.58 4.1 ± 0.55 12 0.35

0.17 ± 0.04 0.27 ± 0.06 0.18 ± 0.06 12 0.39

Least square means ± standard errors within a column lacking common superscript differ (P < 0.05). Scores for feather condition ranged from 1 to 4, with 4 signifying no damage to the feathers and 1 signifying severe damage. 2 Scores for hyperkeratosis from 1 to 4. A score of 1 represented severe hyperkeratosis and a score of 4 represented healthy, normal feet. 3 Average of right and left nail length of 4 nails per foot each for a total of 8 measurements per hen. 4 Number of observations per least square mean. a-b 1

Table 5. Effect of cooled perches on behavior of White Leghorn hens between 16 and 32 wks of age. P-value2 Behavior

Perch1

Feed1

Drink1

Observation (wk) 16.0 21.4 26.6 31.3 Acute HS 27.6 16.0 21.4 26.6 31.3 Acute HS 27.6 16.0 21.4 26.6 31 Acute HS 27.6

Cooled perch (%) 72.5 71.6a 61.3 56.3 64.2a 7.1 14.0 19.0 18.2 16.0 1.4 3.4b 3.6b 7.1 3.7

± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

6.0 3.4 3.5 1.8 2.7 1.2 1.7 2.0 1.5 3.1 0.4 0.6 0.6 1.0 1.1

Air perch (%) 77.6 54.1b 55.4 59.0 48.3b 5.9 12.6 24.2 24.3 22.1 2.7 3.7b 6.9a 5.9 5.4

± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

6.0 3.4 3.6 1.7 2.7 1.2 1.7 2.0 1.5 3.1 0.4 0.6 0.6 1.0 1.1

No perch (%)

6.4 14.2 22.5 20.1 19.3 3.0 6.3a 5.4a,b 6.4 5.3

± ± ± ± ± ± ± ± ± ±

1.2 1.7 2.0 1.5 3.1 0.4 0.6 0.6 1.0 1.1

Treatment

Time

Interaction

Mean cage temperature (o C)3

Maximum cage temperature (o C)3

0.58 0.02 0.32 0.34 0.001 0.80 0.75 0.24 0.07 0.43 0.07 0.04 0.03 0.71 0.49

< 0.0001 <0.0001 < 0.0001 < 0.0001 < 0.0001 < 0.001 0.65 0.43 0.17 0.002 0.002 0.004 0.02 0.01 0.08

0.01 0.12 0.06 0.1 NS 0.94 0.91 0.38 0.02 NS 0.93 0.44 0.64 0.03 NS

22.2 28.8 25.0 20.7 30.5 22.2 28.8 25.0 20.7 30.5 22.2 28.8 25.0 20.7 30.5

26.0 32.7 28.5 24.1 34.7 26.0 32.7 28.5 24.1 34.7 26.0 32.7 28.5 24.1 34.7

Least square means ± standard errors within a column lacking common superscript differ (P < 0.05). Percent of hens per cage engaged in the behavior is represented as the least square means ± standard errors. 2 P-value associated with the effect of treatment, time, and their interaction on observed behavior. 3 Measured at center of each tier between 1000 and 2300 h on observation day. a-b 1

incidences of drinking by cooled versus air perch hens (P > 0.05). At the age of 26.6 wk, hens with cooled perches drank less often than both hens housed with air perches (P = 0.01) but not those without perches (P = 0.09). Time of d affected the proportion of hens perching at all time points (all P < 0.001), with hens perching more when the lights were out (1800 and 2300 h observations) than at other times (data not shown). Similarly, the proportion of hens observed drinking was

typically higher later in the d (at 1500 and 1600; all P < 0.05), except on the d of acute heat stress when no time effects were found (P = 0.08; data not shown). Cooled perches were used more than air perches by heat stressed hens (P = 0.001). Panting and wing spreading was observed only on the d of acute heat stress, but the onset of these behaviors was delayed in hens by cooled perches (Figure 2). At least one hen was observed panting in all 6 air perch cages and

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

Treatment

COOLED PERCHES AND HEN WELFARE

7

5 no perch cages immediately after the temperatures exceeded 30o C (1100 h observation). Similarly, wing spreading was noted in all 6 air perch and 5 no perch cages within 15 min of temperatures exceeding 30o C (1115 h observation). Panting and wing spreading was not observed in any cooled perch cages until 1130 h, and did not affect hens in more than 5 of the cooled perch cages until 1230 h.

DISCUSSION With the exception of the brief 4-hour acute heating episode at the age of 27.6 wk, hens in the current study were within their thermoneutral zone for the majority of the 16 wk trial. There were no heat stress effects on hens’ production and physiological homeostasis as the summer of 2013 in central Indiana was very mild. However, presence of cooled perches during acute heat stress affected perch use and the onset of thermoregulatory behaviors observed. As suggested by Lustick (1983), behavioral adjustments can occur rapidly and

at less cost to the birds than most physiological adjustments. The cooled perch hens in this study used the perches more than hens housed with air perches when temperature exceeded 30o C (at the age of 26.4 wks and on the d of 4-hour acute heat stress), but not on d when temperature remained within the thermoneutral zone. Additionally, cooled perch hens had delayed incidences of panting and wing spreading as compared to both air perch and no perch hens during the acute heat episode. The peak number of cages with hens exhibiting these heat stress-associated behaviors also was delayed in cooled perch hens. The analysis of drinking and feeding behavior was inconclusive, as there were no consistent differences in the observed feeding and drinking behaviors of hens across the treatment groups. Information on the amount of feed and water consumed would help the interpretation of these results and should be included in future research. In all, the behavioral results provide evidence that cooled perches helped hens coping with heat stimulation. Previous studies have indicated that heat stress

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

Figure 2. Heat stress-associated behavioral data. The number of cages per treatment (out of a maximum of 6) in which at least one hen was observed panting (A.) or wing spreading (B.) during the acute heating episode. The dashed line indicates the average temperature (◦ C) recorded in the cages. Note: The maximum behavioral response seen in the cooled perch hens was 90 min after onset compared to both air perch hens and no perch hens.

8

HU ET AL.

Heat stress results in reduced liver weight (Wolfenson et al., 1981; Felver-Gant et al., 2014) due to blood redistribution. Under heat exposure, hens increase their panting behavior to remove body heat through evaporative cooling in order to avoid an increase in inner core body temperature (Etches et al., 1995). In the current study, panting was noted only on the d of acute heat stress, and its onset was mitigated by the presence of cooled perches. The excessive water excretion through panting and redistribution of blood volumes within the body may contribute to the decreased liver weight. The effects of heat stress on liver function also could be examined by measuring HSP70 mRNA (Lagana et al., 2013; Felver-Gant et al., 2014; Wolf et al., 2014; Zheng et al., 2015). Heat shock proteins including HSP70 have been used as biomarkers of animals’ response to stressful conditions including heat stress (Riezman, 2004). The heat shock response was increased under acute heat stress, resulting in an explosion of HSP synthesis and gene expression (Feder and Hofmann, 1999; Xie et al., 2014). Thermal stress induces protein denaturation causing them to partially unfold leading to possible aggregation. The HSP bind temporarily to hydrophobic sections of the denaturing protein, repairing the protein to refold. The HSP70, as an example, increased in blood and various organs in response to various stressors, including high thermal temperatures (Gabriel et al., 1996; Wang and Edens, 1998; Shin et al., 2000; Felver-Gant et al., 2012). Hens were within their thermal comfort zone during the majority of the current study, which may explain why the use of cooled perches as compared to controls (hens with access to air perches or no perches) did not show significant benefits with respect to liver weight and HSP70 mRNA expression at 32 wk of age. Feathers inhibit sensible heat loss from most parts of the hen’s body. Broilers experience a loss in feather coverage in order to adapt to high environmental temperature (Cooper and Washburn, 1998). In laying hens, feather loss is commonly seen at the neck, breast, and back regions, especially in aged hens (Hughes, 1978; Bilcik and Keeling, 1999). One study reported that at end of lay when hens were 71 wk of age, perches in cages caused poorer breast and tail feathers due to the contact and rubbing of these areas on the metal perch but better plumage of the back as compared to hens without access to perches during the egg laying phase (Hester et al., 2013b). In the current study, no effect of perch treatment on plumage quality was anticipated as hens were only 32 wk of age when this study was terminated and were very early in their egg laying cycle. The shorter nail length as a result of access to cooled perches as compared to control hens is in agreement with the previous study indicating that metal perches help to keep the nails trimmed (Hester et al., 2013b). Less usage of the air perches as compared to the thermally cooled perches during the 16-week trial may have contributed to the slightly longer, but

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

response can be elicited when ambient temperature exceeds 30◦ C (Donoghue et al., 1989; Ensminger et al., 1990). Respiratory evaporation of water is the major pathway of chickens to lose heat (Donoghoe, 1989; Renaudeau et al., 2012). Farrell and Swain (1977) indicated that every 2◦ C increase in temperature induces the panting proportion of heat loss to a maximum of 100% at 35◦ C for the un-acclimated chickens. Panting will lead to respiratory alkalosis and consequently cause diminished egg and shell quality (Calder and Schmidt-Nielsen, 1968; Koelkebeck, 1999; Chukwuka et al., 2011). Increased water intake will be accompanied by the increased evaporative heat loss, which explains the fewer drinking behaviors observed in the cooled perch hens. Numerous studies have reported that heat stress in laying hens reduces BW, egg production, egg weight, shell weight, shell thickness, and feed intake (Muiruri and Harrison, 1991; Balnave and Muheereza, 1997; Hester et al., 1996; Mashaly et al., 2004; Lin et al., 2006; Yahav, 2009). Adult chickens gain more heat than they ◦ can lose when ambient temperatures exceed 37.8 C in still air, elevating hen body core temperature and leading to hyperthermia and potentially death (Sahin et al., 2009). If ambient temperatures are not too high, chickens have the ability to partially habituate, cope, and adapt to heat stress. As an example of habituation, feed intake of White Leghorns was greatly decreased after 3 d of heat stress (33◦ C), but it rebounded from 6 to 8 d during heat stress, even though it was still lower than control hens in their comfort zone at 24◦ C (Felver-Gant et al., 2014). Another example of habituation is that egg production in laying hens was not affected when ambient temperature was increased gradually from 25 to 35◦ C over a one-week period although egg weight and shell traits were reduced by the increase in ambient temperature (Yahav et al., 2000). During chronic heat stress, egg production and eggshell quality are detrimentally affected due to a variety of reasons, at least partially associated with the hens’ coping mechanism, such as 1) reduced feed intake to limit the production of metabolic heat (Kadzere et al., 2002), causing less availability of dietary Ca for eggshell formation; 2) redirection of blood from the inner core of the body to the surface of the skin, combs, and wattles, resulting in inadequate delivery of blood Ca to the uterus, reducing Ca eggshell deposition (Nolan et al., 1978; Wolfenson et al., 1978, 1981); 3) decrease of the digestive system’s blood circulation, leading to reduced absorption of Ca as well as other nutrients (Bonnet et al., 1997); 4) respiratory alkalosis due to excessive panting or hyperventilation, leading to lower circulating levels of Ca and bicarbonate (Odom et al., 1986; Mahmoud et al., 1996; Ebeid et al., 2012); and 5) suppressed ovulatory hormones such as serum luteinizing hormone levels and hypothalamic content of luteinizing hormone-releasing hormone, reducing egg production (Donoghue et al., 1989; Etches et al., 1995).

COOLED PERCHES AND HEN WELFARE

non-significant, nail length (means of 1.42 vs. 1.31, respectively, SEM = 0.04, Table 4). In conclusion, cooled perches assisted hens with thermoregulation during acute heat stress as measured by behavior adjustments, but did not affect production performance, plumage quality, foot health (specifically, hyperkeratosis), and physiological parameters of White Leghorn hens as the applied thermal levels during the summer of 2013 in central Indiana and a 4-hour acute heating episode failed to reach the threshold needed for pathophysiological changes. Future studies will be conducted to examine the effects of cooled perches on hens under more severe heat conditions.

ACKNOWLEDGMENTS

REFERENCES Balnave, D., and S. K. Muheereza. 1997. Improving eggshell quality at high temperatures with dietary sodium bicarbonate. Poult. Sci. 76:558–593. Bilcik, B., and J. K. Keeling. 1999. Changes in feather condition in relation to feather pecking and aggressive behaviors in laying hens. Br. Poult. Sci. 40:1466–1799. Black, P. F., J. G. Murray, and M. J. Nunn. 2008. Managing animal disease risk in Australia: The impact of climate change. Rev. Sci. Tech. 27:563–580. Bonnet, S., P. A. Geraert, M. Lessire, B. Carre, and S. Guillaumin. 1997. Effect of high ambient temperature on feed digestibility in broilers. Poult. Sci. 76:857–863. Bridges, T. C., and R. S. Gates. 2009. Chapter 7: Modeling of Animal Bioenergetics for Environmental Management Applications. Pages 151–179. In: Livestock Energetics and Thermal Environmental Management, DeShazer J. A., ed. ASABE: St. Joseph, MI. 209 pp. Calder, W. A., and K. Schmidt-Nielsen. 1968. Panting and blood carbon dioxide in birds. Am. J. Physiol. 215:477–482. Carsia, R. V., and S. Harvey. 2000. Adrenals. Pages 489–537 in Sturkie’s Avian Physiology, 5th ed. G. C. Whittow, ed. Academic Press, London. Cheng, H. W., G. Dillworth, P. Singleton, Y. Chen, and W. M. Muir. 2001. Effects of group selection for productivity and longevity on blood concentrations of serotonin, catecholamines, and corticosterone of laying hens. Poult. Sci. 80:1278–1285. Chukwuka, O. K., I. C. Okili, N. J. Okeudo, A. B. I. Udedibie, I. P. Ogbuewu, N. O. Aldi, O. O. M. Iheshiulor, and A. A. Omede. 2011. Egg quality defects in poultry management and food safety. Asian J. Agric. Res. 5:1–16. Cook, N. J., R. Renema, C. Wilkinson, and A. L. Schaefer. 2009. Comparisons among serum, egg albumin and yolk concentrations of corticosterone as biomarkers of basal and stimulated adrenocortical activity of laying hens. Br. Poult. Sci. 50:620–633.

Cooper, M. A., and K. W. Washburn. 1998. The relationships of body temperature to weight gain, feed consumption, and feed utilization in broilers under heat stress. Poult. Sci. 77:237–242. CEC. 1999 Council Directive 1999/74/EC of 19 July 1999 laying down minimum standards for the protection of laying hens. Official Journal L 203, 03/08/1999 P. 0053–0057. Dawson, W. R., and G. C. Whittow. 2000. Regulation of body temperature. Pages 343–390 in: Sturkie’s Avian Physiology. 5th ed. G. C. Whittow, ed. Academic Press, New York, NY. Donoghue, D. J., B. F. Krueger, B. M. Hargis, A. M. Miller, and M. el Halawani. 1989. Thermal stress reduces serum luteinizing hormone and bioassayable hypothalamic content of luteinizing hormone-releasing hormone in hens. Biol. Reprod. 41:419–424. Ebeid, T. A., T. Suzuki, and T. Sugiyama. 2012. High ambient temperature influences eggshell quality and calbindin-D28k localization of eggshell gland and all intestinal segments of laying hens. Poult. Sci. 91:2282–2287. Enneking, S. A., H. W. Cheng, K. Y. Jefferson-Moore, M. E. Einstein, D. A. Rubin, and P. Y. Hester. 2012. Early access to perches in caged white leghorn pullets. Poult. Sci. 91:2114–2120. Ensminger, M. E., J. E. Oldfield, and W. W. Heinemann. 1990. Feeds and Nutrition Digest: formerly, Feeds and Nutrition–abridged. 2nd ed. The Ensminger Publishing Company, Clovis, CA. Etches, R. J., T. M. John, and G. A. M. Verrinder-Gibbins. 1995. Behavioural, physiological, neuroendocrine and molecular responses to heat stress. Pages 31–66 In Poultry Production in Hot Climates. N. J. Daghir, ed. CAB International, Cambridge, United Kingdom. Farrell, D. J., and S. Swain. 1977. Effects of temperature treatments on the heat production of starved chicken. Br. Poult. Sci. 18:725– 734. Feder, M. E., and G. E. Hofmann. 1999. Heat-shock proteins, molecular chaperones, and the stress response: Evolutionary and ecological physiology. Annu. Rev. Physiol. 61:243–282. Felver-Gant, J. N., R. L. Dennis, J. Zhao, and H. W. Cheng. 2014. Effects of dietary antioxidant on performance and physiological responses following heat stress in laying hens. Int. J. Poult. Sci. 13:260–271. Felver-Gant, J. N., L. A. Mack, R. L. Dennis, S. D. Eicher, and H. W. Cheng. 2012. Genetic variations alter physiological responses following heat stress in 2 strains of laying hens. Poult. Sci. 91:1542– 1551. Gabriel, J. E., J. A. Ferro, R. M. Stefani, M. I. Ferro, S. L. Gomes, and M. Macari. 1996. Effect of acute heat stress on heat shock protein 70 messenger RNA and on heat shock protein expression in the liver of broilers. Br. Poult. Sci. 37:443–449. Gates, R. S., S. A. Enneking, Y. Xiong, P. Y. Hester, M. M. Makagon, and H. W. Cheng. 2014. Design and Performance of Cooled Perches for Alternative Egg Laying Production Systems. Paper No. 141901235. American Society of Agricultural and Biological Engineers, ASABE and CSBE/SCGAB Annual International Meeting, Montreal. 13–16 July. St. Joseph, MI. Greene, J. L., and T. Cowan. 2012. Table egg production and hen welfare: The UEP-HSUS Agreement and H.R. 3798. Congressional Research Service. Accessed Jan. 2015. http://www.fas.org/sgp/crs/misc/R42534.pdf. Hester, P. Y., S. A. Enneking, B. K. Haley, H. W. Cheng, M. E. Einstein, and D. A. Rubin. 2013a. The effect of perch availability during pullet rearing and egg laying on musculoskeletal health of caged White Leghorn hens. Poult. Sci. 92:1972–1980. Hester, P. Y., S. A. Enneking, K. Y. Jefferson-Moore, M. E. Einstein, H. W. Cheng, and D. A. Rubin. 2013b. The effect of perches in cages during pullet rearing and egg laying on hen performance, foot health, and plumage. Poult. Sci. 92:310–320. Hester, P. Y., W. M. Muir, J. V. Craig, and J. L. Albright. 1996. Group selection for adaptation to multiple-hen cages: Production traits during heat and cold exposures. Poult. Sci. 75: 1308–1314. Hughs, B. O. 1978. The frequency of neck movements in laying hens and the improbability of cage abrasion causing feather wear. Br. Poult. Sci. 19:289–293. Kadzere, C. T., M. R. Murphy, N. Silanikove, and E. Maltz. 2002. Heat stress in lactating dairy cows: A review. Livest. Prod. Sci. 77:59–91.

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

We would like to thank the staff and graduate students of the Agricultural Research Service, Livestock Behavior Research Unit, and the Department of Animal Sciences of Purdue University for their assistance in conducting this study. Partial funding was provided by the National Institute of Food and Agriculture, U.S. Department of Agriculture under Award No. 201367021-21094. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement of the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.

9

10

HU ET AL. Savory, C. J., and J. S. Mann, 1997. Is there a role for corticosterone in expression of abnormal behavior in restricted-fed fowls? Physiol. Behav. 62:7–13. Shields, S., and G. Orme-Evans. 2015. The Impacts of Climate Change Mitigation Strategies on Animal Welfare. Animals. 5:361– 394. Shin, D. H., H. J. Kim, H. Y. Lee, K. H. Lee, G. S. Jeon, J. H. Seo, S. H. Baik, and S. S. Cho. 2000. Distribution of heat shock protein 108 mRNA in the chicken central nervous system. Neurosci. Lett. 283:181–184. Siegel, H. S. 1980. Physiological stress in birds. Biosci. 30:529–534. St-Pierre, N. R., B. Cobanov, and G. Schnitkey. 2003. Economic losses from heat stress by US livestock industries. J. Dairy Sci. 86:E52–E77. Tabarean, I., B. Morrison, M. C. Marcondes, T. Bartfai, and B. Conti. 2010. Hypothalamic and dietary control of temperaturemediated longevity. Ageing Res. Rev. 9:41–50. Tactacan, G. B., W. Guenter, N. J. Lewis, J. C. RodriguezLecompte, and J. D. House. 2009. Performance and welfare of laying hens in conventional and enriched cages. Poult. Sci. 88:698– 707. Tauson, R. 1984. Plumage condition in SCWL laying hens kept in conventional cages of different designs. Acta. Agric. Scand. 34:221–230. Tauson, R., J. Kjaer, G. A. Maria, R. Cepero, and K. E. Holm. 2005. Applied scoring of integument and health in laying hens. Anim. Sci. Pap. Rep. 23:153–159. United Egg Producers. 2014. United Egg Producers Animal Husbandry Guidelines for U.S. Egg Laying Flocks, 2014 Edition. United Egg Producers, Alpharetta, GA. Accessed May 2015. http://www.uepcertified.com/pdf/UEP-Animal-WelfareGuidelines-2014.pdf. van Theinhoven, A., N. R. Scott, and P. E. Hillman. 1979. The hypothalamus and thermoregulation: A review. Poult. Sci. 58:1633– 1639. Virden, W. S., M. S. Liburn, J. P. Thaxton, A. Corzo, D. Hoehler, and M. T. Kidd. 2007. The effect of corticosteron-induced stress on amino acid digestibility in Ross broilers. 86:338–342. Wang, S., and F. W. Edens. 1998. Heat conditioning induces heat shock proteins in broiler chickens and turkey poults. Poult. Sci. 77:1636–1645. Wang, X. J., Y. Li, Q. Q. Song, Y. Y. Guo, H. C. Jiao, Z. G. Song, and H. Lin. 2013. Corticosterone regulation of ovarian follicular development is dependent on the energy status of laying hens. J. Lipid Res. 54:1860–1876. Wolf, J. H., T. R. Bhatti, S. Fouraschen, S. Chakravorty, L. Wang, S. Kurian, D. Salomon, K. M. Olthoff, W. W. Hancock, and M. H. Levine. 2014. Heat shock protein 70 is required for optimal liver regeneration after partial hepatectomy in mice. Liver Transpl. 20:376–385. Wolfenson, D., A. Berman, Y. F. Feri, and N. Snapir. 1978. Measurement of blood flow distribution by radioactive microspheres in the laying hen (Gallus domesticus). Comp. Biochem. Physiol. A Physiol. 61:549–554. Wolfenson, D., Y. F. Frei, N. Snapir, and A. Berman. 1981. Heat stress effects on capillary blood flow and its redistribution in the laying hen. Pfl¨ ugers Archiv. 390:86–93. Xie, J. J., L. Tang, L. Lu, L. Zhang, L. Xi, H. C. Liu, J. Odle, and X. Luo. 2014. Differential expression of heat shock transcription factors and heat shock proteins after acute and chronic heat stress in laying chickens (Gallus gallus). PLoS ONE:9:e102204. Yahav, S. 2009. Alleviating heat stress in domestic fowl: Different strategies. Int. J. Poult. Sci. 65:719–732. Yahav, S., D. Shinder, V. Razpakovski, M. Rusal, and A. Bar. 2000. Lack of response of laying hens to relative humidity at high ambient temperature. Br. Poult. Sci. 41:660–663. Zheng, K., W. Wang, S. S. O. Hung, and D. F. Deng. 2015. Feeding rates affect expression of heat-shock protein 70 in Green Sturgeon Fry. N. Am. J. Aquac. 77:206–210. Zulkifil, I., A. Al-Aqil, A. R. Omar, A. Q. Sazili, and M. A. Rajion. 2009. Crating and heat stress influence blood parameters and heat shock protein 70 expression in broiler chickens showing short or long tonic immobility reactions. Poult. Sci. 88:471–476.

Downloaded from http://ps.oxfordjournals.org/ at Cornell University Library on October 9, 2016

Kesireddy, R. R. 2015. Heat waves in south claim 70 lakh birds, poultry industry suffers Rs 100 crore loss. The Economic Times. Accessed July 2015. http://articles.economictimes.indiatimes.com/ 2015-05-25/news/62624524 1 poultry-farms-poultry-industrybirdflu-outbreak. Klingensmith, P. M., and P. Y. Hester. 1985. Effects of and induced molt and shell quality on the physical dimensions and mineral composition of eggs and intrauterine pH. Poult. Sci. 64:2368– 2376. Koelkebeck, K. W. 1999. What is Egg Quality and Conserving it? University of Illinois. http://www.traill.uiuc.edu/ poultrynet/paperDisplay.cfm?ContentID=522. Koneswaran, G., and D. Nierenberg. 2008. Global farm animal production and global warming: Impacting and mitigating climate change. Environ Health Perspect. 116:578–582. Lagana, S. M., M. Saloma, F. Bao, R. K. Moreira, J. H. Lefkowitc, and H. E. Remotti. 2013. Utility of an immunohistochemical panel consisting of Glypican-3, heat-shock protein-70, and glutamine synthetase in the distinction of low-grade hepatocellular carcinoma from hepatocellular adenoma. Appl. Immunohistochem. Mol. Morphol. 21:170–176. Lara, L. J., and M. H. Rostagno. 2013. Impact of heat stress on poultry production. Animals. 3:356–369. Lin, H., H. C. Jiao, J. Buyse, and E. Decuypere. 2006. Strategies for preventing heat stress in poultry. Int. J. Poult. Sci. 62:71–85. Lustick, S. I. 1983. Cost benefit of thermoregulation in birds: Influences of posture, microhabitat selection, and color. Pages 265–294 in Behavioral Energetics. W. Aspey, and S. I. Lustick, eds. Ohio State University Press, Columbus, Ohio, Mack, L. A., J. N. Felver-Gant, R. L. Dennis, and H. W. Cheng. 2013. Genetic variations alter production and behavioral responses following heat stress in 2 strains of laying hens. Poult. Sci. 92:285– 294. Mahmoud, K. A., M. M. Beck, S. E. Scheideler, M. F. Forman, K. P. Anderson, and S. D. Kachman. 1996. Acute high environmental temperature and calcium-estrogen relationships in the hen. Poult. Sci. 75:1555–1562. Mashaly, M. M., G. L. Hendricks, III, M. A. Kalama, A. E. Gehad, A. O. Abbas, and P. H. Patterson. 2004. Effect of heat stress on production parameters and immune responses of commercial laying hens. Poult. Sci. 83:889–894. Mignon-Grasteau, S., U. Moreri, A. Narcy, C. Rousseau, T. B. Rodenburg, M. Tixier-Boichard, and T. Zerjal. 2015. Robustness to chronic heat stress in laying hens: a meta-analysis. Poult. Sci. 94:586–600. Muiruri, H. K., and P. C. Harrison. 1991. Effect of roost temperature on performance of chickens in hot ambient environments. Poult. Sci. 70:2253–2258. Nolan, W. F., W. W. Weathers, and P. D. Sturkie. 1978. Thermally induced peripheral blood flow changes in chickens. J. Appl. Physiol. 44:81–84. Odom, T. W., P. C. Harrison, and W. G. Bottje. 1986. Effects of thermal-induced respiratory alkalosis on blood ionized calcium levels in the domestic hen. Poult. Sci. 65:570–573. Okelo, P. O., L. E. Carr, P. C. Harrison, L. W. Douglas, V. E. Byrd, C. W. Wabeck, P. D. Schreuders, F. W. Wheaton, and N. G. Zimmerman. 2003. Effectiveness of a novel methodto reduce heat stress in broilers: A cool roost system. Trans. ASAE. 46:1675– 1683. Reilly, W., K. Koelkebeck, and P. Harris. 1991. Performance evaluation of heat-stressed commercial broilers provided water-cooled floor perches. Poult. Sci. 70:1699–1703. Renaudeau, D., A. Collin, S. Yahv, V. de Basilio, J. L. Gourdine, and R. J. Collier. 2012. Adaptation to hot climate and strategies to alleviate heat stress in livestock production. Animal. 6:707–728. Richards, S. A. 1970. The biology and comparative physiology of thermal panting. Biol. Rev. 45:223–263. Riezman, H. 2004. Why do cells require heat shock proteins to survive heat stress? Cell cycle. 3:61–63. Sahin, K., N. Sahin, O. Kucuk, A. Hayirli, and A. S. Prasad. 2009. Role of dietary zinc in heat-stressed poultry: A review. Poult. Sci. 88:2176–2183. SAS Institute. SAS Proprietary Software. Version 9.3. SAS Inst. Inc., Cary, NC. 2011.