Foxd1 activation drives mitogenic activity of the Sonic Hedgehog signaling pathway

Accepted Manuscript Coordinated d-cyclin/Foxd1 activation drives mitogenic activity of Sonic Hedgehog signaling pathway

Dustin M. Fink, Miranda R. Sun, Galen W. Heyne, Joshua L. Everson, Hannah M. Chung, Sookhee Park, Michael D. Sheets, Robert J. Lipinski PII: DOI: Reference:

S0898-6568(17)30327-3 https://doi.org/10.1016/j.cellsig.2017.12.007 CLS 9041

To appear in:

Cellular Signalling

Received date: Revised date: Accepted date:

3 May 2017 30 November 2017 22 December 2017

Please cite this article as: Dustin M. Fink, Miranda R. Sun, Galen W. Heyne, Joshua L. Everson, Hannah M. Chung, Sookhee Park, Michael D. Sheets, Robert J. Lipinski , Coordinated d-cyclin/Foxd1 activation drives mitogenic activity of Sonic Hedgehog signaling pathway. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Cls(2017), https://doi.org/10.1016/ j.cellsig.2017.12.007

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

Coordinated D-Cyclin/Foxd1 activation drives mitogenic activity of Sonic Hedgehog signaling pathway Dustin M. Fink1, Miranda R. Sun1, Galen W. Heyne1, Joshua L. Everson1, 2, Hannah M. Chung1, 2,,

of Comparative Biosciences, School of Veterinary Medicine, University of

IP

1Department

T

Sookhee Park3, Michael D. Sheets3, Robert J. Lipinski1, 2, *

and Environmental Toxicology Center, School of Medicine and Public Health,

University of Wisconsin-Madison, Madison, WI

of Biomolecular Chemistry, School of Medicine and Public Health, University of

AN

3Department

US

2Molecular

CR

Wisconsin-Madison, Madison, WI

M

Wisconsin-Madison, Madison, WI

author:

ED

*Corresponding

PT

Robert J. Lipinski

CE

Department of Comparative Biosciences School of Veterinary Medicine

AC

2015 Linden Dr.

Madison, WI 53706

Phone: (608) 265-4043 FAX: (608) 263-3926 [email protected]

ACCEPTED MANUSCRIPT

Highlights: A novel circuit regulating Sonic Hedgehog-induced proliferation is proposed.

-

Sonic Hedgehog promotes Foxd1 expression which drives downstream mitogenic activity

-

Regulation of Cdkn1c by FOXD1 appears to augment the proliferative response

-

This mechanism appears conserved and operational during craniofacial development

US

CR

IP

T

-

Funding: This work was supported by National Institutes of Health [R00DE022010-02 to

AN

R.J.L., T32ES007015-37 to J.E., T32ES007015-38 to H.C. and R21HD076828 to M.D.S.] Keywords: Sonic Hedgehog signaling; cell proliferation; Cyclins; cyclin-dependent kinase

AC

CE

PT

ED

M

inhibitor; forkhead box

ACCEPTED MANUSCRIPT Abstract Sonic Hedgehog (Shh) signaling plays key regulatory roles in embryonic development and postnatal homeostasis and repair. Modulation of the Shh pathway is known to cause malformations and malignancies associated with dysregulated tissue growth. However, our

T

understanding of the molecular mechanisms by which Shh regulates cellular proliferation is

IP

incomplete. Here, using mouse embryonic fibroblasts, we demonstrate that the Forkhead box

CR

gene Foxd1 is transcriptionally regulated by canonical Shh signaling and required for downstream proliferative activity. We show that Foxd1 deletion abrogates the proliferative

US

response to SHH ligand while FOXD1 overexpression alone is sufficient to induce cellular proliferation. The proliferative response to both SHH ligand and FOXD1 overexpression was

AN

blocked by pharmacologic inhibition of cyclin-dependent kinase signaling. Time-course experiments revealed that Shh pathway activation of Foxd1 is followed by downregulation of

M

Cdkn1c, which encodes a cyclin-dependent kinase inhibitor. Consistent with a direct

ED

transcriptional regulation mechanism, we found that FOXD1 reduces reporter activity of a Fox enhancer sequence in the second intron of Cdkn1c. Supporting the applicability of these

PT

findings to specific biological contexts, we show that Shh regulation of Foxd1 and Cdkn1c is

CE

recapitulated in cranial neural crest cells and provide evidence that this mechanism is operational during upper lip morphogenesis. These results reveal a novel Shh-Foxd1-Cdkn1c

AC

regulatory circuit that drives the mitogenic action of Shh signaling and may have broad implications in development and disease.

ACCEPTED MANUSCRIPT 1. Introduction Sonic Hedgehog (Shh) signaling is a conserved morphogenetic pathway that regulates cellular proliferation and differentiation. During embryonic and fetal development, Shh is required for the morphogenesis of diverse organs and structures including the central nervous system,

T

midface, and limbs. Postnatally, the pathway regulates stem and progenitor cells involved in

IP

tissue healing and repair, and aberrant activation is linked to several types of cancer [1, 2].

CR

Control of cell proliferation appears to be a conserved cellular mechanism across these biological contexts. For example, genetic and chemical pathway perturbations during

US

embryonic development cause birth defects of the forebrain (holoprosencephaly), face (cleft lip and palate), and limbs (ectrodactyly) that are associated with deficient tissue outgrowth [3, 4].

AN

Postnatally, pathway inhibition disrupts tissue healing and regrowth and is employed as a therapeutic treatment for neoplasia, indicating a conservation of pro-mitogenic activity across

M

these biological settings [5].

ED

Shh signaling most often acts in a paracrine fashion, with epithelial secretion of SHH ligand generating a gradient of pathway activity in adjacent mesenchymal or stromal tissues. SHH

PT

ligand binding to the transmembrane receptor Patched1 (PTCH1) relieves repression of the

CE

heptahelical protein Smoothened (SMO). Subsequent translocation of SMO to the primary cilium triggers a complex downstream cascade that culminates in regulation of the GLI

AC

transcription factors. The three GLI proteins can act independently or in coordination to regulate the transcription of conserved and tissue-specific pathway target genes [6]. Basic research efforts to understand the molecular mechanisms of Shh pathway activity have largely focused on morphogenetic mechanisms. Having received less attention, our understanding of how the Shh pathway regulates cell proliferation is incomplete. D-type cyclin genes (Ccnd1 and Ccnd2) have been identified as Shh pathway targets in several biological contexts, but induction of these genes alone is unlikely sufficient for the precise regulation of

ACCEPTED MANUSCRIPT cellular proliferation required for appropriate development and tissue repair. Shh signaling has also been shown to regulate expression of multiple members of the Forkhead (Fox) transcription factor member family in several developmental contexts [7-11]. Fox proteins, defined by characteristic winged helix/forkhead DNA binding domains, are also known to play important roles in cell cycle progression and cell proliferation [12]. Here, we utilized a tractable cell-based

IP

T

system to demonstrate that Shh and Fox signals, along with downstream targets, act to coordinately regulate cell proliferation. We then show that this mechanism identified through

CR

cell-based assays is operational in a specific biological context.

US

2. Materials and methods

AN

2.1. Plasmids

Precision LentiORF FOXD1 transfer plasmid from GE Dharmacon (#OHS5897-202616573) and

M

pLenti CMV Blast (w263-1) empty vector provided by Dr. Eric Campeau (Addgene plasmid

ED

#17486) [13] were used for lentiviral infection of wild-type immortalized mouse embryonic fibroblasts (iMEFs). A pX458-Dual-Cas9-GFP plasmid was used for CRISPR/Cas9 gene editing.

2.2. Reagents

CE

by Dr. Juhee Jeong [14].

PT

Firefly luciferase constructs with Cdkn1c cis-regulatory elements (enh1 and enh2) were provided

AC

Cells were treated with SHH-N peptide (R&D Systems #1845-SH) dissolved in PBS with 5 mg/ml BSA. The SMO inhibitor, vismodegib, was purchased from LC Laboratories (CAS No 879085-55-9) and dissolved in DMSO. The CCND:CDK4/6 inhibitor, palbociclib, was purchased from Selleckchem (CAS No 827022-32-2) and dissolved in DMSO.

ACCEPTED MANUSCRIPT 2.3. Cell culture Immortalized wild-type, Gli2-/-3-/-, and stably transfected iMEFs were maintained as described previously [15] in 10% fetal calf serum (FCS) DMEM (with L-glutamine, 4.5 g/L glucose, without sodium pyruvate) with 1% Penicillin-Streptomycin. Primary mouse embryonic fibroblasts

IP

cranial neural crest and Ptch1-/- cells were cultured as described [16]

T

(MEFs) were isolated and maintained as previously described [6]. Immortalized O9-1 mouse

CR

2.4. Cell treatment

US

iMEFs (including those stably transfected and CRISPR/Cas9 edited), MEFs, or O9-1 cells were plated at 5 x 105 cells/mL (0.4 mL per well in a 24-well plate) and allowed to attach in full 10%

AN

(or 15% for O9-1) FCS media for 24 hrs before media were replaced with DMEM containing 1% FCS. Cells were treated with SHH ligand at 0.4 μg/mL ± vismodegib at 100 nM or ± palbociclib

M

at 100 nM. As a vehicle control, cells were also treated with equal volumes of PBS with 5 mg/ml

ED

BSA and DMSO. Cells were harvested at 48 hours (unless otherwise indicated) following treatment for either RNA extraction or counting by hemocytometer.

PT

2.5. RNA extraction and real time RT-PCR

CE

RNA was extracted using GE Illustra RNAspin kits (GE Healthcare) and cDNA was synthesized from 500 ng of total RNA using Promega GoScript reverse transcription reaction kits.

AC

Singleplex RT-PCR was conducted as previously described [17] using SSoFast EvaGreen Supermix (BioRad Laboratories) and a BioRad CFX96 Touch thermocycler. Gene-specific RT-PCR primers (Table S1) were designed using IDT PrimerQuest (http://www.idtdna.com/primerquest). Primers were resuspended as stock solutions of 100 µM in TE buffer at pH=7.0 (Ambion). Working stocks were made as 10 µM solutions containing both forward and reverse primers. Gapdh was used as the housekeeping gene, and analyses were conducted with the 2-ddCt method.

ACCEPTED MANUSCRIPT 2.6. CellTrace™ proliferation assay Cells were plated at 5 x 105 cells/mL (1.6 mL per well in a 6-well plate) and allowed to attach for 24 hrs. Media were removed and CellTrace™ Far Red (Invitrogen) diluted 1:1000 in DMEM without antibiotics and FCS was added to each well. Cells were incubated at 37 °C for 20 min

T

and replaced with DMEM with 10% FCS for 5 min. Cells were then treated for 48 hrs with

IP

DMEM containing 1% FCS ± SHH ligand. Additional unstained cells and cells stained

CR

immediately prior to harvest were used for flow cytometry gating. Trypsinized cells were washed in FACS buffer and fixed in 2% paraformaldehyde. Cells were analyzed using a BD

US

LSRFortessa flow cytometer (BD Biosciences). Data were analyzed by FlowJo® software (TreeStar, Ashland, OR).

AN

2.7. Establishment of stable cell lines

M

GFP and SMOM2-GFP overexpressing iMEFs were generated as described [6, 15]. A pIRES

ED

shuttle vector carrying coding sequences for GFP and SMOM2-GFP was used to retrovirally infect wild-type iMEF cells. Cells were plated at subconfluence in DMEM with 10% FCS. Cells were

PT

then incubated with viral-conditioned media at 37°C for 6 hrs. Following a 72-hr propagation period, a BD FACSAriaIII fluorescence-activated cell sorter was used to isolate appropriate

CE

GFP+ populations. Wild-type iMEFs were also lentivirally transfected as previously described [18] with the LentiORF FOXD1 transfer plasmid and pLenti CMV Blast empty vector. Briefly,

AC

FOXD1 and pLenti transfer plasmids were packaged by 293T cells by FuGENE® 6 (Promega #E2691) transfection with envelope plasmid pCMV-VSV-G (Addgene plasmid #8454) and packaging plasmid(s) pCMV-dR8.2 dvpr (Addgene plasmid #8455) or pRSV-REV/pMDLg-RRE (Addgene #12253, 12251), respectively. After lentivirus production, target cells were infected with 8 µg/ml protamine sulfate (Sigma #P3369) twice for 4 hrs each. Infected cells were selected by Blasticidin S (Fisher Scientific, CAS No 3513-03-9) 24 hrs post-infection. Cells were then aliquoted, frozen, and stored in liquid nitrogen.

ACCEPTED MANUSCRIPT 2.8 CRISPR/Cas9 gene editing Chopchop 2.0 and Deskgen were used to design two guide RNAs (gRNAs): gRNA-10 TTGGTGCAGAGTCCCCAGCGCGG and gRNA-4 GCTCAGGGTCATAGCTGGGGCGG that recognize genomic regions that flank the Foxd1 coding region. DNAs encoding gRNA-10 and

T

gRNA-4 were respectively cloned into the BbsI and BsaI sites of the pX458-Dual-Cas9-GFP

IP

plasmid. Plasmids (10 µg) with and without inserts were separately electroporated into WT

CR

iMEFs (1 x 107 cells) at 200 V and 950 µF in 2 mm cuvettes. Following a 48-hr recovery period, a BD FACSAriaIII fluorescence-activated cell sorter was used to isolate appropriate GFP+

US

populations. Single cells were individually sorted into wells of a 96-well plate and remaining cells were pooled into the wells of a 6-well plate. Deletion in Foxd1 was confirmed by a decrease

AN

in amplicon size by PCR using primers (forward: CGTTTCTAGATTCTCACTCCTC, reverse: TCCACTGTGGTCCCTTTA) targeting a 1,285-bp region containing the lone exon in Foxd1. Cell

M

lines with confirmed deletions were used for downstream assays. An equal number of GFP+ cell

ED

lines electroporated with plasmids without inserts were used as controls.

PT

2.8. Luciferase reporter experiments

FOXD1-overexpressing and pLenti negative control iMEFs were plated at 1.25 x 105 cells/mL

CE

(0.4 ml per well in a 24-well plate) in duplicate. After 24 hrs, media were changed to DMEM with 1% FCS and transiently transfected with 0.75 µL Lipofectamine® 3000, 1 µL P3000™

AC

reagent, and 125 ng of Cdkn1c-enh1 or Cdkn1c-enh2 in Opti-MEM® following manufacturer’s instructions. To normalize transfection efficiency, all plated cells were cotransfected with 62.5 ng SV40-driven renilla plasmid. After 48 hrs, cell lysates were collected and analyzed by the Dual-Luciferase® Reporter Assay System (Promega).

ACCEPTED MANUSCRIPT 2.9. Statistics Paired, two-tailed t-tests were used for analysis of gene expression changes, proliferation, and luciferase reporter assays. Based upon predicted directional changes from these experiments, one-tailed t-tested were used for SMOM2-GFP overexpressing iMEFs and Gli2-/-3-/-iMEFs gene

T

expression results. Graphpad Prism 6 was used for all statistical analyses. An alpha value of

IP

0.05 was maintained for determination of significance for all experiments.

CR

2.10. Animals

US

This study was conducted in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was

AN

approved by the University of Wisconsin School of Veterinary Medicine Institutional Animal Care and Use Committee (protocol number G005396). C57BL/6J mice were purchased from

M

The Jackson Laboratory and housed under specific pathogen-free conditions in disposable,

ED

ventilated cages (Innovive, San Diego, CA). Rooms were maintained at 22 ± 2° and 30–70% humidity on a 12 hour light, 12 hour dark cycle. Mice were fed 2920x Irradiated Harlan Teklad

PT

Global Soy Protein-Free Extruded Rodent Diet until day of plug, when dams received 2919 Irradiated Teklad Global 19% Protein Extruded Rodent Diet. Mice were set up for timed

CE

pregnancies as previously described [19].

AC

2.11. In situ hybridization (ISH) Embryos at gestational day (GD) 11 were dissected in PBS and fixed in 4% paraformaldehyde in PBS overnight. Embryos then underwent graded dehydration (1:3, 1:1, 3:1 v/v) into 100% methanol and stored at -20°C indefinitely for subsequent ISH analysis. In situ hybridization was performed as previously described [11, 17]. Embryo sections were imaged using a Nikon Eclipse E600 microscope. Gene-specific ISH riboprobe primers were designed using IDT PrimerQuest (http://www.idtdna.com/primerquest) and affixed with the T7 polymerase

ACCEPTED MANUSCRIPT consensus sequence plus a 5-bp leader sequence (CGATGTTAATACGACTCACTATAGGG) to the reverse primer (Table S2). 2.12. Immunohistochemistry GD10.25 embryos were fixed in 4% paraformaldehyde in PBS overnight prior to graded

T

dehydration into methanol and storage at -20°C. Embryos were subsequently rehydrated into

IP

PBS and 100 μm frontal sections were obtained using a vibrating microtome. Sections were

CR

blocked in 5% normalized goat serum (NGS) and 1% DMSO in PBSTx for 1 hr, incubated in monoclonal rabbit anti-Ki67 (1:250, Cell Signaling cat#9027, [20]), washed, and transferred to

US

monoclonal goat anti-rabbit-Alexafluor594 secondary antibody (1:1000, Thermo Scientific cat#R37117) in PBSTx + 5% NGS for 1 hr at room temperature. Finally, sections were incubated

AN

with DAPI (1:1000 Thermo Scientific) in PBS for 6 mins and imaged using a Leica SP8 confocal

ED

M

microscope.

PT

3. Results

3.1. Canonical Shh signaling drives proliferation in iMEFs.

CE

We have shown previously that SHH ligand elicits a robust transcriptional response in wild-type

AC

(WT) immortalized mouse embryonic fibroblasts (iMEFs) that is consistent with the classic paracrine pathway signaling model [15]. We first examined whether WT iMEFs also model the proliferative response to SHH stimulation. After 48 hrs, treatment with SHH ligand resulted in a 63% increase in cell number compared to vehicle treatment (Fig 1A). This response was completely blocked by addition of vismodegib, a potent pharmacologic inhibitor of the SMO protein. Addition of vismodegib alone had no effect on cell count, suggesting an absence of basal Shh signaling activity in WT iMEFs (Fig. S1). We next tested whether the proliferative response to SHH ligand is dependent upon the GLI transcription factors. As opposed to WT

ACCEPTED MANUSCRIPT iMEFs, no change in cell number was observed following SHH stimulation in Gli2-/-3-/- iMEFs. The mitogenic activity of SHH ligand was further examined using CellTrace™ proliferation dye [21]. Relative to vehicle treatment, SHH stimulation of WT iMEFs caused a leftward shift in fluorescent intensity, indicative of increased cell division (Fig 1B).

T

3.2. Foxd1 is a target of canonical Sonic Hedgehog signaling.

IP

We next examined the effect of SHH stimulation on the expression of Forkhead box family

CR

genes, which have been implicated as pathway target genes in multiple developmental contexts including gut, central nervous system and orofacial development [8-11]. Treatment with SHH

US

ligand resulted in a significant induction of the conserved pathway target Gli1, as well as Foxd1 in WT iMEFs (Fig 2A). Responsiveness of Foxd1 appeared specific, as the expression of three

AN

other Fox family members expressed in these cells and associated with cell proliferation (Foxm1,

M

Foxo1, and Foxp1) was unchanged by SHH stimulation (Fig S2). Consistent with the proliferative response of WT iMEFs to SHH stimulation, Foxd1 induction was blocked by

ED

addition of the SMO inhibitor vismodegib. We further examined the specificity of Foxd1

PT

regulation by Shh signaling utilizing Ptch1-/- iMEFs, which demonstrate ligand-independent constitutive pathway activation [16]. Expression levels of both Gli1 and Foxd1 were significantly

CE

higher in Ptch1-/- cells relative to WT iMEFs, and expression of both genes was reduced by the addition of vismodegib (Fig. 2B). Because blocking SMO activity with vismodegib inhibited

AC

Foxd1 expression, we next tested whether SMO overexpression could induce Foxd1 expression. Overexpression of a mutant form of SMO (SMOM2) that generates constitutive downstream pathway activity [22] was sufficient to induce both Gli1 and Foxd1 expression to levels approximating SHH ligand stimulation (Fig 2C). In Gli2-/-3-/- iMEFs, treatment with SHH ligand did not change Foxd1 expression, suggesting that its induction by SHH ligand requires the GLI transcription factors (Fig. 2D).

ACCEPTED MANUSCRIPT 3.3. Foxd1 drives proliferative activity that is sensitive to CDK-cyclin inhibition. We next deleted Foxd1 using CRISPR/Cas gene editing to test its requirement for the proliferative response of iMEFs to SHH ligand stimulation. WT iMEFs were transfected with gRNAs targeting the single Foxd1 exon or with control plasmid alone, then sorted and plated as

T

single cells to produce two Foxd1 deletion and two control monoclonal lines. Deletion of Foxd1

IP

was confirmed both by genotyping and RT-PCR (Fig. 3A, Fig. S3). As opposed to the control

CR

lines, SHH ligand stimulation did not increase cell count in either Foxd1 deletion line (Fig. 3B). These results suggest that FOXD1 is necessary for the proliferative response of iMEFs to SHH

US

ligand stimulation.

Several Fox family members have been shown to regulate cyclin-dependent kinase inhibitor

AN

(CDKI) proteins [14, 23-25]. We therefore tested whether Shh-induced proliferation in iMEFs is

M

CDK-dependent and sensitive to the potent pharmacologic CDKI, palbociclib. Initial control experiments showed that treatment with 10 nM palbociclib reduced but did not eliminate

ED

proliferation in cells grown in 10% FCS and had no effect on cells grown in 1% FCS media (Fig

PT

S4). Palbociclib treatment efficiently blocked the SHH-induced increase in cell number but had no effect in the absence of SHH (Fig 3C). We next generated WT iMEFs with stable

CE

overexpression of human FOXD1. Cell number was increased by 40% in FOXD1 overexpressing cells relative to the negative control (pLenti), suggesting that FOXD1 is sufficient to drive cell

AC

proliferation. This increase was completely blocked by the addition of palbociclib (Fig 3D), demonstrating that both SHH- and FOXD1-induced proliferation is highly sensitive to CyclinCDK inhibition.

3.4. SHH suppresses Cdkn1c expression. D-type cyclins (CCNDs) complex with cyclin-dependent kinases 4 and 6 (CDK4/6) to progress the cell forward through the cell cycle. Palbociclib acts comparably to CDKI proteins by inhibiting CCND:CDK4/6 complexes. We therefore examined the expression profiles of D-type

ACCEPTED MANUSCRIPT cyclins and CDKIs in iMEFs treated with SHH ligand. Pathway activation increased Ccnd1 mRNA levels, while expression of Cdkn1c (p57) was reduced following SHH ligand stimulation. Transcriptional targeting of Ccnd1 and Cdkn1c appeared relatively specific in this system, as the expression of other D-type cyclins (Ccnd2 and Ccnd3) and CDKIs (Cdkn1a and Cdkn1b) was not changed by the addition of SHH ligand. As observed for pathway regulation of Foxd1

IP

T

transcription and cell proliferation, SHH-stimulated changes in Ccnd1 and Cdkn1c expression were completely blocked by the SMO inhibitor vismodegib (Fig 4A). Similarly, vismodegib

CR

treatment of Ptch1-/- iMEFs reduced expression of Ccnd1 while increasing Cdkn1c expression

US

(Fig. 4B). Overexpression of SMOM2 resulted in a significant increase in Ccnd1 expression while almost completely ablating expression of Cdkn1c (Fig 4C). SHH-regulation of Ccnd1 and Cdkn1c

/-

AN

also appeared dependent upon the GLI transcription factors, as SHH ligand addition in Gli2-/-3iMEFs did not change their expression (Fig 4D). We next investigated the temporal sequence

M

of transcriptional changes following SHH stimulation. Expression of Gli1 was significantly

ED

increased as early as 6 hrs following ligand addition, whereas Foxd1 expression was not increased until 24 h. While unchanged 24 hrs following SHH ligand addition, expression of

PT

Cdkn1c was significantly downregulated at 48 and 72 hrs (Fig 4E).

CE

3.5. FOXD1 regulates activity of a Fox enhancer element in Cdkn1c. The temporal sequence of transcriptional changes following SHH ligand stimulation implicates

AC

Foxd1 as a direct pathway target, which may then regulate Cdkn1c expression. This hypothesis is supported by the recent identification of two FOX enhancer sequences in the Cdkn1c locus [14]. We tested whether FOXD1 directly binds these enhancer sequences using established luciferase reporter constructs. As shown in Fig 5A, enh1 is in the second intron of Cdkn1c while enh2 is located in the 3’ UTR. Luciferase reporter constructs were transfected into iMEFs stably overexpressing FOXD1 or a negative control vector. FOXD1-expressing cells exhibited higher

ACCEPTED MANUSCRIPT activity of enh1-driven luciferase than negative controls while no difference was observed in luciferase activity driven by enh2 (Fig 5B). 3.6. Conservation of the Shh-Foxd1-Cdkn1c circuit. We next examined whether the regulatory circuit defined in iMEFs is conserved in other SHH-

T

responsive cells. To test this paradigm without potential influences of cell immortalization, we

IP

first examined primary mouse embryonic fibroblasts (MEFs). In WT MEFs, SHH stimulation

CR

increased expression of Gli1, Foxd1, and Ccnd1 while modestly but significantly decreasing Cdkn1c expression, suggesting that findings observed in iMEFs are not influenced by the cell

US

immortalization process (Fig 6A). We next examined a mouse cranial neural crest cell line (O91) that was recently shown to be transcriptionally and proliferatively responsive to SHH ligand

AN

[26]. In this developmentally-defined cell line, SHH-induced changes in Gli1, Foxd1, Ccnd1, and

M

Cdkn1c closely paralleled those observed in both MEFs and iMEFs (Fig 6A).

ED

Among the derivatives of cranial neural crest cells is the mesenchyme of the growth centers that form the midface, including the upper lip. We have shown previously that Shh signaling is

PT

required for upper lip closure and that pathway inhibition results in cleft lip stemming from deficient outgrowth of the medial nasal processes (MNPs) [26, 27]. We therefore tested whether

CE

the observed regulatory circuit mediating SHH-induced cell proliferation is operational in upper lip morphogenesis. The expression domains of Gli1, Foxd1, and Cdkn1c were defined in GD11.0

AC

mouse embryos with focus placed on the distal portion of the MNP, which must grow outward to meet and fuse with the maxillary process to close the upper lip. Gli1 and Foxd1 exhibited parallel expression domains that opposed that of Cdkn1c (Fig 6B). Staining for Ki67 in parallel sections revealed proliferating cells in more abundance in the medial Foxd1-expressing domain than in the lateral Cdkn1c expressing domain of the MNP.

ACCEPTED MANUSCRIPT 4. Discussion Our study is the first to demonstrate that canonical Shh signaling regulates Foxd1 transcription and that FOXD1 expression is sufficient to recapitulate the proliferative response to SHH ligand addition. We also provide the first evidence linking the mitogenic activity of Shh-Foxd1

T

signaling to regulation of cyclin-dependent kinase activity. Based upon the collective results

IP

reported herein, we propose a novel Shh-initiated circuit that regulates proliferation through

CR

coordinated activation of Ccnd1 and FOXD1-mediated suppression of Cdkn1c (Fig 7). Finally, we show evidence that this regulatory circuit is operational during embryonic development. Our

US

findings suggest that Shh acts through independent, parallel mechanisms to drive cell cycle progression through the CyclinD:CDK4/6 complex. While Shh signaling has long been

AN

considered pro-mitogenic, our understanding of the underlying molecular mechanisms is incomplete. Gene expression profiling identified Ccnd2 as one of the first bona fide Shh target

M

genes while studies of Shh signaling in development and malignancy showed that both Ccnd1

ED

and Ccnd2 are relatively conserved pathway targets that promote G1 to S cell cycle progression [28-33]. However, a mechanism limited to Shh upregulation of D-type cyclins appears overly

PT

simplistic. For example, CyclinD:CDK4/6 complexes are negatively regulated by several CDKIs, such that Shh-mediated upregulation of D-type Cyclins alone would likely be insufficient to

CE

advance the cell cycle from G1 to S in the presence of CDKI proteins. The circuit identified

AC

herein resolves this by showing that induction of Ccnd1 is coupled with Fox-mediated suppression of Cdkn1c. However, our data also suggests that suppression of Cdkn1c augments but is not necessary for the Shh proliferative response. Specifically, we observed loss of Cdkn1c expression in both monoclonal control and Foxd1 deletion lines (Fig, S5). This may result from selection of cells in which the anti-mitogenic Cdkn1c is downregulated. While SHH stimulation of control monoclonal lines cause a significant increase in cell count, the proliferative response was muted relative to the original polyclonal population in which Cdkn1c is expressed at much higher levels.

ACCEPTED MANUSCRIPT Here, we show that FOXD1 expression is sufficient to drive proliferation in a manner that is sensitive to pharmacologic CDK inhibition. While FOXD1 is a known mesenchymal factor in several developmental contexts, most evidence of its mitogenic role comes from cancer studies. In this context, Foxd1 has yet to be directly linked to Shh signaling. However, Foxd1 has been implicated in several cancer types driven by aberrant Shh pathway signaling, including lung,

IP

T

breast, and prostate [34-37]. FOXD1 is overexpressed in lung, breast, and prostate cancer biopsies, and its depletion suppresses cell proliferation in lung and breast cancer cell lines [34,

CR

38, 39]. Our finding that Shh drives Foxd1 expression in fibroblasts warrants further

US

investigation into whether parallel regulation is operational in Shh pathway-driven cancer. We utilized iMEFs to uncover the Shh-Foxd1-Cdkn1c regulatory circuit and showed that it is

AN

conserved in a cranial neural crest cell line that is relevant to craniofacial development. Two independent studies demonstrated multiple Fox genes downstream of Shh signaling in the

M

cranial neural crest-derived mesenchyme in vivo [7, 11]. While Foxd1 was identified in both

ED

these studies, neither tested whether it is a direct target of Shh signaling. Our cell-based evidence suggests that Foxd1 is directly targeted by canonical Shh signaling, as its response to

PT

SHH ligand requires both SMO and GLI protein function. To test whether this circuit is

CE

operational in a specific developmental context, we chose to examine upper lip morphogenesis because we recently showed that formation of the upper lip is regulated by Shh-Fox signaling

AC

[11]. Specifically, SHH in the surface ectoderm activates pathway activity and expression of multiple Fox genes, including Foxd1, in the adjacent cranial neural crest-derived mesenchyme. Here we show that Foxd1 expression parallels that of canonical Shh target gene Gli1 in the mesenchyme of the medial portion of the medial nasal process. Cdkn1c is also present in the mesenchymal compartment of the medial nasal process and its expression is restricted to the lateral aspect directly opposing the domain of Foxd1 expression. In accordance with our in vitro findings, more proliferating cells were observed in the medial, Foxd1-expressing domain than in the lateral, Cdkn1c-expressing domain of the medial nasal process. These findings support the

ACCEPTED MANUSCRIPT premise that FOXD1 suppresses expression of Cdkn1c to promote cell proliferation in vitro and in vivo. Whether Shh signaling regulates Foxd1 in other developmental contexts is unclear. The most well-described role of Foxd1 is in kidney development. Global inactivation of both Foxd1 and

T

Shh results in hypoplastic and fused kidneys, though likely through distinct mechanisms [40,

IP

41]. Shh expression is restricted to the distal collecting ducts that arise from the first branches

CR

of the uteric bud and activates pathway activity in subjacent mesenchyme while Foxd1 is strongly expressed in the cortical stroma [40, 41]. Both Shh signaling and Foxd1 are also

US

independently required for formation of the optic chiasm [42]. While in this biological context SHH is thought to function primarily as a chemoattractant that directs retinal ganglionic

AN

growth, it may also act by regulating Foxd1 expression. Shh is expressed in the ventral-most region of the diencephalon where it appears to activate pathway activity in retinal ganglionic

M

cells as they are traveling the optic tract [43]. Foxd1 is also expressed in the ventral

ED

diencephalon, and in mice lacking Foxd1 or the SHH co-receptor Boc, an overlapping phenotype of decreased ipsilateral retinal ganglion cell projection is observed. While there is positional

PT

proximity and overlapping functional outcomes, understanding specific regulatory directionality

[44].

CE

between Shh and FOXD1 in these developmental contexts will require additional investigation

AC

The incomplete phenotypic overlap between Shh and Foxd1 null mice argues that the specific Shh-Foxd1-Cdkn1c regulatory circuit described here may not be universal. It is more likely that Shh functions through context-dependent cassettes of Fox and CDKI family members. In fact, several other Fox family members, including Foxa2, Foxe1, Foxf1, Foxf2, and Foxl1 have been identified as targets of Shh signaling in diverse developmental contexts including the gut, central nervous system, and secondary palate [8-11]. Several Fox genes, including Foxd1, Foxm1, and Foxo1, have been shown to regulate CDKN1A (p21) and CDKN1B (p27) [39, 45, 46].

ACCEPTED MANUSCRIPT These observations support the wider applicability of Shh-Fox-Cdkn signaling and suggest that specific contexts may involve unique combinations of individual family members.

Figure Legends

T

Fig 1. Canonical Shh signaling drives proliferation in iMEFs. (A) Wild-type (WT) and

IP

Gli2-/-3-/- iMEFs were cultured ± SHH ligand and ± the SMO antagonist vismodegib (Vis). Cell

CR

number are shown relative to vehicle-treated cells. SHH increased proliferation in WT iMEFs, but not in Gli2-/-3-/- iMEFs. This increase in proliferation was blocked by the addition of

US

vismodegib (n=5). (B) Histogram of fluorescence intensity of cells treated with the cell tracing

AN

reagent CellTrace™ Far Red and analyzed by flow cytometry. SHH treatment resulted in a leftward shift in fluorescence compared to vehicle-treated cells, indicating an increase in cellular

M

divisions (n=1). Significance: *=p<0.05. Error bars show SEM.

ED

Fig 2. Foxd1 is a target of canonical Sonic Hedgehog signaling. (A) Gene expression was determined for WT iMEFs cultured ± SHH ligand and ± the SMO antagonist vismodegib

PT

(Vis). Expression changes are shown as a fold change from vehicle-treated cells. SHH treatment resulted in an increase in Gli1 and Foxd1 expression, which was blocked by the

CE

addition of vismodegib (n=6). (B) Expression of Gli1 and Foxd1 is increased in Ptch1-/- iMEFs

AC

relative to wild-type (inset) and significantly reduced by vismodegib treatment. (C) Expression of Gli1 and Foxd1 is increased in iMEFs overexpressing a constitutively active form of human Smoothened (SMOM2). Expression changes are shown as a fold change from cell overexpressing GFP (n=5). Insert shows SMO expression. (D) Expression of Gli1 and Foxd1 is not significantly changed in Gli2-/-3-/- iMEFs treated with SHH ligand (n=4). Significance: *=p<0.05, **=p<0.01, ***=p<0.001. Error bars show SEM.

ACCEPTED MANUSCRIPT Fig 3. Shh-Foxd1 drives proliferative activity that is sensitive to CDK-cyclin inhibition. (A) Schematic of the Foxd1 locus in mouse genome with target sites of CRISPR/Cas9 gRNAs and genotyping primers (arrowheads). A shortened PCR amplicon (~758 bp) in CRISPR Foxd1 Deletion (Del) lines compared to full-length amplicons (2,064 bp) in WT iMEF and CRISPR Control lines indicate successful CRISPR/Cas9 gene editing. (B) CRISPR

IP

T

Control and Foxd1 Deletion lines were cultured ± SHH ligand. SHH treatment increased cell number in control lines relative to vehicle treatment but not in Foxd1-deleted cell lines (n=6-7).

CR

(C) WT iMEFs were cultured ± CCND:CDK4/6 inhibitor palbociclib (Palbo) and ± SHH ligand.

US

Cell numbers are shown relative to vehicle-treated negative control cells (pLenti). In low serum, SHH increased proliferation while palbociclib blocked this increase. Palbociclib alone did not

AN

change proliferation in low serum (n=5). (D) iMEFs stably overexpressing empty pLenti construct and FOXD1 were cultured ± the CDK4/6 inhibitor palbociclib in low serum (1% FCS).

M

Cell numbers are shown relative to vehicle-treated pLenti expressing cells. iMEFs expressing

ED

FOXD1 resulted in increased cell number, which was blocked by the addition of palbociclib (n=3). Significance: *=p<0.05. Error bars show SEM.

PT

Fig 4. SHH suppresses Cdkn1c expression. (A) Gene expression was determined for wild-

CE

type (WT) iMEFs cultured ± SHH ligand and ± the SMO antagonist vismodegib (Vis). Expression changes are shown as a fold change from vehicle-treated cells. SHH treatment

AC

resulted in an increase in Ccnd1 and a decrease in Cdkn1c expression, both of which were blocked by the addition of vismodegib. Expression changes are shown as a fold change from vehicle-treated cells. (n=9). (B) Expression of Ccnd1 is increased in Ptch1-/- iMEFs relative to WT (inset). Vismodegib treatment Ptch1-/- iMEFs results in decreased Ccnd1 expression and increased Cdkn1c expression (C) Expression of Gli1 and Foxd1 is not significantly changed in Gli2-/-3-/- iMEFs treated with SHH ligand (n=4). (C) In iMEFs overexpressing a constitutively active form of human Smoothened (SMOM2), expression of Ccnd1 was increased while Cdkn1c expression was decreased. Expression changes are shown as a fold change from cells

ACCEPTED MANUSCRIPT overexpressing GFP (n=5). (D) To determine the temporal sequence of gene expression changes, WT cells were harvested at 6, 12, 24, 48, and 72 hrs after treatment ± SHH ligand. Gli1 expression (white arrow) is significantly increased by 6 hrs followed by increased Foxd1 expression (black arrow) by 24 hrs, and Cdkn1c expression (gray arrow) is not significantly decreased until 48 hrs post-treatment. Expression changes are shown as a fold change from

IP

T

vehicle-treated cells at respective time points (n=5). Significance: *=p<0.05, **=p<0.01,

CR

***=p<0.001, ****=p<0.0001. Error bars show SEM.

Fig 5. FOXD1 regulates activity of a Fox enhancer element in Cdkn1c. (A) Schematic

US

of the Cdkn1c locus in mouse genome adapted from Cesario et al. [14]. enh1 is located between exons 2 and 3. enh2 is located in the 3’ UTR of the Cdkn1c gene. (B) Firefly luciferase reporter

AN

assay driven by Cdkn1c enhancer elements, enh1 and enh2, in iMEFs overexpressing empty pLenti construct or FOXD1. Firefly luciferase activity relative to renilla luciferase activity is

M

shown as a fold change from pLenti negative control (n=6). (C) A model for the mechanism of

ED

hedgehog-induced cellular proliferation through Foxd1-mediated suppression of Cdkn1c.

PT

Significance: *=p<0.05. Error bars show SEM. Fig 6. Conservation of the Shh-Foxd1-Cdkn1c circuit. (A) Gene expression was

CE

determined ± SHH ligand in primary mouse embryonic fibroblasts (MEFs) or O9-1 cranial neural crest cells. Expression changes are shown as a fold change from vehicle-treated cells.

AC

SHH treatment resulted in an increase in expression of Gli1, Foxd1, and Ccnd1, while expression of Cdkn1c was decreased in both cell types. Significance: *=p<0.05, **=p<0.01. Error bars show SEM. (B) Frontal sections of gestational day 11 embryos were generated to show expression patterns of Gli1, Foxd1, and Cdkn1c in tissues of the developing face. Note that the region with Gli1 and Foxd1 expression corresponds with higher Ki67 positive staining (white dashed outline) than the adjacent region with Cdkn1c expression (dashed yellow outline).

ACCEPTED MANUSCRIPT Fig 7. Proposed Shh-Foxd1-Cdkn1c signaling model. Binding of SHH ligand to the transmembrane protein PTCH1 triggers activation of SMO and GLI2-mediated transcription of pathway target genes, including Ccnd1 and Foxd1. FOXD1 binds to a FOX-binding site in the Cdkn1c gene. Downregulation of CDKN1C relieves repression of the CyclinD:CDK4/6 complex.

T

Fig S1. Vismodegib has no effect on proliferation in wild-type iMEFs. Wild-type (WT)

IP

iMEFs were cultured ± the SMO antagonist vismodegib (Vis). Cell numbers are shown relative

CR

to vehicle-treated cells in 1% FCS. There was no change in proliferation due to vismodegib treatment (n=4). Error bar shows SEM.

US

Fig S2. Other Fox, D-type cyclins, and CDKI genes are not regulated by Shh signaling in iMEFs. Expression of canonical hedgehog target gene, Ptch1, in addition to

AN

Ccnd1, Foxd1, and Cdkn1c was significantly changed in iMEFs with the addition of SHH ligand.

M

However, Foxm1, Foxo1, Foxp1, Ccnd2, Ccnd3, Cdkn1a, and Cdkn1b expression was not significantly changed ± SHH (n=3-6). Significance: *=p<0.05, **=p<0.01, ***=p<0.001. Error

ED

bars show SEM.

PT

Fig S3. Foxd1 expression is abolished in Foxd1 deletion cell lines. The lack of Foxd1 mRNA expression in both of the CRISPR Foxd1 deletion lines confirms the success of

CE

CRISPR/Cas9 gene editing (n=6 or 7). Error bars show SEM.

AC

Fig S4. Palbociclib treatment in low serum does not decrease proliferation in iMEFs. Wild-type iMEFs (WT) were cultured ± CCND:CDK4/6 inhibitor palbociclib (Palbo) in either 1% or 10% FCS. Cell numbers are shown relative to vehicle-treated cells in 1% FCS. At 10% FCS, palbociclib decreased the relative cell number compared to vehicle treated cells (n=3). Significance: **=p<0.01. Error bars show SEM.

ACCEPTED MANUSCRIPT Fig S5. Monoclonal CRISPR lines exhibit reduced Cdkn1c expression. Cdkn1c expression in both the CRISPR Control and Foxd1 Deletion cell lines are substantially reduced compared to the expression in wild-type (WT) iMEFs (n=5-9). Error bars show SEM.

IP

T

Abbreviations Cyclin D1

CDK

Cyclin-dependent kinase

CDKI

Cyclin-dependent kinase inhibitor

Cdkn1c

Cyclin-Dependent Kinase Inhibitor 1C (aka p57, Kip2)

Foxd1

Forkhead Box d1

iMEF

Immortalized mouse embryonic fibroblast

MEF

Primary mouse embryonic fibroblast

MNP

Medial nasal process

SHH

Sonic Hedgehog

SMO

Smoothened

AC

CE

PT

ED

M

AN

US

CR

Ccnd1

Author Contributions RJL, DMF, MDS and GWH conceived and designed the studies. DMF, MRS, GWH, SP, JLE, and HMC carried out experiments and analyzed the data. RJL and DMF wrote the manuscript.

ACCEPTED MANUSCRIPT Acknowledgements The authors wish to thank Dr. Juhee Jeong for enhancer reporter constructs, Drs. Mamoru Ishii and Robert Maxson for providing O9-1 cells, Dr. Eric Campeau for pLenti lentiviral transfer plasmid, Debra Rugowski and Dr. Lisa Arendt for assistance with lentiviral transfections, Jerry

T

Gipp and Dr. Wade Bushman for retroviruses, and Dr. Ruth Sullivan for thoughtful review of the

IP

manuscript. We would also like to thank the UW-Madison Carbone Cancer Center Flow

CR

Cytometry Laboratory for FACS, the UW-Madison School of Veterinary Medicine Flow Core especially Brandon Neldner for technical help with CellTrace™ assay, the UW-Madison Biotron

AC

CE

PT

ED

M

AN

US

Laboratory, and the UW-Madison Research Animals Resource Center.

ACCEPTED MANUSCRIPT References [1] S. Ahn, A.L. Joyner, In vivo analysis of quiescent adult neural stem cells responding to Sonic hedgehog, Nature 437(7060) (2005) 894-7. [2] R. Petrova, A.L. Joyner, Roles for Hedgehog signaling in adult organ homeostasis and repair,

T

Development 141(18) (2014) 3445-57.

IP

[3] E. Roessler, E. Belloni, K. Gaudenz, P. Jay, P. Berta, S.W. Scherer, L.C. Tsui, M. Muenke,

CR

Mutations in the human Sonic Hedgehog gene cause holoprosencephaly, Nat Genet 14(3) (1996) 357-60.

US

[4] G.W. Heyne, C.G. Melberg, P. Doroodchi, K.F. Parins, H.W. Kietzman, J.L. Everson, L.J. Ansen-Wilson, R.J. Lipinski, Definition of critical periods for Hedgehog pathway antagonist-

AN

induced holoprosencephaly, cleft lip, and cleft palate, PLoS One 10(3) (2015) e0120517. [5] T.K. Rimkus, R.L. Carpenter, S. Qasem, M. Chan, H.W. Lo, Targeting the Sonic Hedgehog

M

Signaling Pathway: Review of Smoothened and GLI Inhibitors, Cancers (Basel) 8(2) (2016).

ED

[6] R.J. Lipinski, J.J. Gipp, J. Zhang, J.D. Doles, W. Bushman, Unique and complimentary activities of the Gli transcription factors in Hedgehog signaling, Exp Cell Res 312(11) (2006)

PT

1925-38.

CE

[7] J. Jeong, J. Mao, T. Tenzen, A.H. Kottmann, A.P. McMahon, Hedgehog signaling in the neural crest cells regulates the patterning and growth of facial primordia, Genes Dev 18(8)

AC

(2004) 937-51.

[8] B.B. Madison, L.B. McKenna, D. Dolson, D.J. Epstein, K.H. Kaestner, FoxF1 and FoxL1 link hedgehog signaling and the control of epithelial proliferation in the developing stomach and intestine, J Biol Chem 284(9) (2009) 5936-44. [9] T. Eichberger, G. Regl, M.S. Ikram, G.W. Neill, M.P. Philpott, F. Aberger, A.M. Frischauf, FOXE1, a new transcriptional target of GLI2 is expressed in human epidermis and basal cell carcinoma, J Invest Dermatol 122(5) (2004) 1180-7.

ACCEPTED MANUSCRIPT [10] H. Sasaki, C. Hui, M. Nakafuku, H. Kondoh, A binding site for Gli proteins is essential for HNF-3beta floor plate enhancer activity in transgenics and can respond to Shh in vitro, Development 124(7) (1997) 1313-22. [11] J.L. Everson, D.M. Fink, J.W. Yoon, E.J. Leslie, H.W. Kietzman, L.J. Ansen-Wilson, H.M. Chung, D.O. Walterhouse, M.L. Marazita, R.J. Lipinski, Sonic hedgehog regulation of Foxf2

IP

T

promotes cranial neural crest mesenchyme proliferation and is disrupted in cleft lip morphogenesis, Development 144(11) (2017) 2082-2091.

CR

[12] B.C. Jackson, C. Carpenter, D.W. Nebert, V. Vasiliou, Update of human and mouse

US

forkhead box (FOX) gene families, Hum Genomics 4(5) (2010) 345-52. [13] E. Campeau, V.E. Ruhl, F. Rodier, C.L. Smith, B.L. Rahmberg, J.O. Fuss, J. Campisi, P.

AN

Yaswen, P.K. Cooper, P.D. Kaufman, A versatile viral system for expression and depletion of proteins in mammalian cells, PLoS One 4(8) (2009) e6529.

M

[14] J.M. Cesario, A. Landin Malt, L.J. Deacon, M. Sandberg, D. Vogt, Z. Tang, Y. Zhao, S.

ED

Brown, J.L. Rubenstein, J. Jeong, Lhx6 and Lhx8 promote palate development through negative regulation of a cell cycle inhibitor gene, p57Kip2, Hum Mol Genet 24(17) (2015) 5024-39.

PT

[15] R.J. Lipinski, M.F. Bijlsma, J.J. Gipp, D.J. Podhaizer, W. Bushman, Establishment and

(2008) 49.

CE

characterization of immortalized Gli-null mouse embryonic fibroblast cell lines, BMC Cell Biol 9

[16] J. Taipale, J.K. Chen, M.K. Cooper, B. Wang, R.K. Mann, L. Milenkovic, M.P. Scott, P.A.

AC

Beachy, Effects of oncogenic mutations in Smoothened and Patched can be reversed by cyclopamine, Nature 406(6799) (2000) 1005-9. [17] G.W. Heyne, J.L. Everson, L.J. Ansen-Wilson, C.G. Melberg, D.M. Fink, K.F. Parins, P. Doroodchi, C.M. Ulschmid, R.J. Lipinski, Gli2 gene-environment interactions contribute to the etiological complexity of holoprosencephaly: evidence from a mouse model, Dis Model Mech 9(11) (2016) 1307-1315.

ACCEPTED MANUSCRIPT [18] P.J. Keller, L.M. Arendt, A. Skibinski, T. Logvinenko, I. Klebba, S. Dong, A.E. Smith, A. Prat, C.M. Perou, H. Gilmore, S. Schnitt, S.P. Naber, J.A. Garlick, C. Kuperwasser, Defining the cellular precursors to human breast cancer, Proc Natl Acad Sci U S A 109(8) (2012) 2772-7. [19] G.W. Heyne, E.H. Plisch, C.G. Melberg, E.P. Sandgren, J.A. Peter, R.J. Lipinski, A Simple and Reliable Method for Early Pregnancy Detection in Inbred Mice, J Am Assoc Lab Anim Sci

IP

T

54(4) (2015) 368-71.

[20] J. Gerdes, U. Schwab, H. Lemke, H. Stein, Production of a mouse monoclonal antibody

CR

reactive with a human nuclear antigen associated with cell proliferation, Int J Cancer 31(1)

US

(1983) 13-20.

[21] J. Zolnierowicz, M. Ambrozek-Latecka, J. Kawiak, D. Wasilewska, G. Hoser, Monitoring cell

AN

proliferation in vitro with different cellular fluorescent dyes, Folia Histochem Cytobiol 51(3) (2013) 193-200.

M

[22] J. Xie, M. Murone, S.M. Luoh, A. Ryan, Q. Gu, C. Zhang, J.M. Bonifas, C.W. Lam, M.

ED

Hynes, A. Goddard, A. Rosenthal, E.H. Epstein, F.J. de Sauvage, Activating Smoothened mutations in sporadic basal-cell carcinoma, Nature 391(6662) (1998) 90-2.

PT

[23] E. Leishman, J.M. Howard, G.E. Garcia, Q. Miao, A.T. Ku, J.D. Dekker, H. Tucker, H. Nguyen, Foxp1 maintains hair follicle stem cell quiescence through regulation of Fgf18,

CE

Development 140(18) (2013) 3809-18. [24] H.J. Evans-Anderson, C.M. Alfieri, K.E. Yutzey, Regulation of cardiomyocyte proliferation

AC

and myocardial growth during development by FOXO transcription factors, Circ Res 102(6) (2008) 686-94.

[25] D. Milewski, A. Pradhan, X. Wang, Y. Cai, T. Le, B. Turpin, V.V. Kalinichenko, T.V. Kalin, FoxF1 and FoxF2 transcription factors synergistically promote rhabdomyosarcoma carcinogenesis by repressing transcription of p21(Cip1) CDK inhibitor, Oncogene 36(6) (2017) 850-862.

ACCEPTED MANUSCRIPT [26] J.L. Everson, D.M. Fink, J.W. Yoon, E.J. Leslie, H.W. Kietzman, L.J. Ansen-Wilson, H.M. Chung, D.O. Walterhouse, M.L. Marazita, R.J. Lipinski, Sonic Hedgehog regulation of Foxf2 promotes cranial neural crest mesenchyme proliferation and is disrupted in cleft lip morphogenesis (in press), Development, 2017. [27] R.J. Lipinski, C. Song, K.K. Sulik, J.L. Everson, J.J. Gipp, D. Yan, W. Bushman, I.J.

IP

T

Rowland, Cleft lip and palate results from Hedgehog signaling antagonism in the mouse: Phenotypic characterization and clinical implications, Birth Defects Res A Clin Mol Teratol

CR

88(4) (2010) 232-40.

US

[28] J.W. Yoon, Y. Kita, D.J. Frank, R.R. Majewski, B.A. Konicek, M.A. Nobrega, H. Jacob, D. Walterhouse, P. Iannaccone, Gene expression profiling leads to identification of GLI1-binding

AN

elements in target genes and a role for multiple downstream pathways in GLI1-induced cell transformation, J Biol Chem 277(7) (2002) 5548-55.

M

[29] A.M. Kenney, D.H. Rowitch, Sonic hedgehog promotes G(1) cyclin expression and

ED

sustained cell cycle progression in mammalian neuronal precursors, Mol Cell Biol 20(23) (2000) 9055-67.

PT

[30] M. Komada, T. Iguchi, T. Takeda, M. Ishibashi, M. Sato, Smoothened controls cyclin D2 expression and regulates the generation of intermediate progenitors in the developing cortex,

CE

Neurosci Lett 547 (2013) 87-91.

[31] F. Li, M. Duman-Scheel, D. Yang, W. Du, J. Zhang, C. Zhao, L. Qin, S. Xin, Sonic hedgehog

AC

signaling induces vascular smooth muscle cell proliferation via induction of the G1 cyclinretinoblastoma axis, Arterioscler Thromb Vasc Biol 30(9) (2010) 1787-94. [32] M. Ishibashi, A.P. McMahon, A sonic hedgehog-dependent signaling relay regulates growth of diencephalic and mesencephalic primordia in the early mouse embryo, Development 129(20) (2002) 4807-19. [33] Y. Lan, R. Jiang, Sonic hedgehog signaling regulates reciprocal epithelial-mesenchymal interactions controlling palatal outgrowth, Development 136(8) (2009) 1387-96.

ACCEPTED MANUSCRIPT [34] L. van der Heul-Nieuwenhuijsen, N.F. Dits, G. Jenster, Gene expression of forkhead transcription factors in the normal and diseased human prostate, BJU Int 103(11) (2009) 157480. [35] L. Fan, C.V. Pepicelli, C.C. Dibble, W. Catbagan, J.L. Zarycki, R. Laciak, J. Gipp, A. Shaw, M.L. Lamm, A. Munoz, R. Lipinski, J.B. Thrasher, W. Bushman, Hedgehog signaling promotes

IP

T

prostate xenograft tumor growth, Endocrinology 145(8) (2004) 3961-70.

[36] S.S. Karhadkar, G.S. Bova, N. Abdallah, S. Dhara, D. Gardner, A. Maitra, J.T. Isaacs, D.M.

CR

Berman, P.A. Beachy, Hedgehog signalling in prostate regeneration, neoplasia and metastasis,

US

Nature 431(7009) (2004) 707-12.

[37] D.N. Watkins, D.M. Berman, S.G. Burkholder, B. Wang, P.A. Beachy, S.B. Baylin, Hedgehog

AN

signalling within airway epithelial progenitors and in small-cell lung cancer, Nature 422(6929) (2003) 313-7.

M

[38] S. Nakayama, K. Soejima, H. Yasuda, S. Yoda, R. Satomi, S. Ikemura, H. Terai, T. Sato, N.

ED

Yamaguchi, J. Hamamoto, D. Arai, K. Ishioka, K. Ohgino, K. Naoki, T. Betsuyaku, FOXD1 expression is associated with poor prognosis in non-small cell lung cancer, Anticancer Res 35(1)

PT

(2015) 261-8.

[39] Y.F. Zhao, J.Y. Zhao, H. Yue, K.S. Hu, H. Shen, Z.G. Guo, X.J. Su, FOXD1 promotes breast

CE

cancer proliferation and chemotherapeutic drug resistance by targeting p27, Biochem Biophys Res Commun 456(1) (2015) 232-7.

AC

[40] J. Yu, T.J. Carroll, A.P. McMahon, Sonic hedgehog regulates proliferation and differentiation of mesenchymal cells in the mouse metanephric kidney, Development 129(22) (2002) 5301-12. [41] R.S. Levinson, E. Batourina, C. Choi, M. Vorontchikhina, J. Kitajewski, C.L. Mendelsohn, Foxd1-dependent signals control cellularity in the renal capsule, a structure required for normal renal development, Development 132(3) (2005) 529-39.

ACCEPTED MANUSCRIPT [42] E. Herrera, R. Marcus, S. Li, S.E. Williams, L. Erskine, E. Lai, C. Mason, Foxd1 is required for proper formation of the optic chiasm, Development 131(22) (2004) 5727-39. [43] L. Gordon, M. Mansh, H. Kinsman, A.R. Morris, Xenopus sonic hedgehog guides retinal axons along the optic tract, Dev Dyn 239(11) (2010) 2921-32. [44] L. Sánchez-Arrones, F. Nieto-Lopez, C. Sánchez-Camacho, M.I. Carreres, E. Herrera, A.

IP

T

Okada, P. Bovolenta, Shh/Boc signaling is required for sustained generation of ipsilateral projecting ganglion cells in the mouse retina, J Neurosci 33(20) (2013) 8596-607.

CR

[45] A. Sengupta, V.V. Kalinichenko, K.E. Yutzey, FoxO1 and FoxM1 transcription factors have

US

antagonistic functions in neonatal cardiomyocyte cell-cycle withdrawal and IGF1 gene regulation, Circ Res 112(2) (2013) 267-77.

AN

[46] I.C. Wang, Y.J. Chen, D. Hughes, V. Petrovic, M.L. Major, H.J. Park, Y. Tan, T. Ackerson, R.H. Costa, Forkhead box M1 regulates the transcriptional network of genes essential for mitotic

M

progression and genes encoding the SCF (Skp2-Cks1) ubiquitin ligase, Mol Cell Biol 25(24)

AC

CE

PT

ED

(2005) 10875-94.

Graphics Abstract

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12