Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer

Oral Oncology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology

Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer Sandy Z. Liu a,⇑, Dan P. Zandberg b,c, Lisa M. Schumaker c, John C. Papadimitriou a, Kevin J. Cullen b,c a

Department of Pathology, University of Maryland School of Medicine, Baltimore, MD, United States Department of Medicine, Division of Medical Oncology, University of Maryland School of Medicine, Baltimore, MD, United States c University of Maryland Marlene and Stewart Greenebaum Cancer Center, Baltimore, MD, United States b

a r t i c l e

i n f o

Article history: Received 8 May 2015 Accepted 28 June 2015 Available online xxxx Keywords: HPV p16 linear array Oropharyngeal squamous cell carcinoma

s u m m a r y Objectives: Examine the effect of concordance between p16 overexpression and HR (high risk) HPV DNA status on overall survival in a large series of oropharyngeal squamous cell carcinoma (OPSCC) cases. Materials and methods: A total of 185 patients with primary OPSCC had genomic DNA tested by PCR for the HPV16 E6 and E7 oncogenes. 184 of 185 patients had p16 IHC performed. Linear array HPV genotyping was performed in all 21 HPV16/p16 discordant cases (HPV16+/p16 or HPV16 /p16+) as well as in 43 control cases. Results: 73 of 185 patients were positive for HR HPV (39%). Six of 73 HPV infections were due to HR HPV types other than HPV16: types 31 (1), 33 (2), 51 (1), 58 (1), and 59 (1); all 6 cases were p16 positive. p16 IHC was concordant with HR HPV testing in 169 of 184 cases (92%), and had a sensitivity and specificity of 92% and 92%. HR HPV+/p16+ and discordant HR HPV/p16 patients had significantly improved overall survival compared to HR HPV /p16 patients. Conclusion: p16 IHC is a reliable surrogate marker for HR HPV testing in OPSCC. Prognostically favorable HR HPV genotypes other than HPV16 are reflected in p16 positivity. Ó 2015 Elsevier Ltd. All rights reserved.

Introduction Squamous cell carcinoma of the head and neck (HNSCC) accounts for 3% of all new cancer (53,000) diagnoses in the US annually [1]. Epidemiological data from the Surveillance, Epidemiology, and End Results Program (SEER) show that while overall incidence of HNSCC has decreased in conjunction with a decrease in smoking and drinking, oropharyngeal squamous cell cancers (OPSCC) have increased both in the United States and other developed nations internationally [2,3]. Human papillomavirus is now recognized as an important etiologic factor in OPSCC and the increase in incidence and prevalence of OPSCC is being driven by an increase in HPV associated oropharyngeal cancer over time. HPV16 accounts for 90–95% of HPV positive OPSCC [4–8]. HPV is also an important prognostic factor, as numerous prospective and retrospective trials have shown that patients with HPV positive OPSCC have a significantly better overall survival than patients with HPV negative OPSCC [9–13]. P16INK4A (p16) expression ⇑ Corresponding author at: University of Maryland Greenebaum Cancer Center, 22 South Greene Street, Room N9E21, Baltimore, MD 21201, United States. Tel.: +1 410 328 5555; fax: +1 410 328 5508. E-mail address: [email protected] (S.Z. Liu).

assessed through immunohistochemistry (IHC) is increasingly recognized as a reliable surrogate marker for HPV testing [9,10,14,15]. Expression of p16 is increased in HPV infection by HPV E7 oncoprotein inactivation of pRB tumor suppressor, with a resulting loss of p16 suppression. HPV status and its correlation with p16 IHC in OPSCC varies depending on the molecular test used. HPV DNA in situ hybridization (ISH) has a higher rate of discordance with p16 IHC in reported studies, due to lower sensitivity of HPV DNA ISH compared to HPV DNA PCR testing [13,16,17]. HPV RNA in situ hybridization is a novel method of testing; the few studies that have utilized it show an improved correlation compared to DNA ISH [18–21]. HPV DNA PCR has a high correlation with p16 IHC due to high sensitivity and specificity, with most OPSCC studies reporting a discordance of less than 20% with p16 IHC [22–29]. The prognostic significance of discordant results has not been elucidated. At least one study has shown that HPV+/p16+ patients have the best outcome, while HPV /p16+ have an intermediate prognosis compared to HPV /p16 patients [32]. In another study, patients discordant for HPV and p16 had no disease relapse [30,31]. It therefore may be clinically important to detect HPV-associated cancers with a test showing the highest correlation between HPV status and p16 IHC.

http://dx.doi.org/10.1016/j.oraloncology.2015.06.014 1368-8375/Ó 2015 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Liu SZ et al. Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer. Oral Oncol (2015), http://dx.doi.org/10.1016/j.oraloncology.2015.06.014

2

S.Z. Liu et al. / Oral Oncology xxx (2015) xxx–xxx

The purpose of the present study is to correlate p16 expression determined by IHC with HPV16 DNA status determined by E6/E7 DNA PCR and analyze the prognostic significance of the combined marker results. As noted above, HR HPV types other than HPV16 have been reported to account for 5–10% of HPV OPSCC cancers. Therefore we used the Roche LINEAR ARRAYÒ HPV Genotyping Test (‘‘LAHPV test’’; Roche, Indianapolis, USA) to resolve discrepant HPV16 DNA PCR and p16 IHC results. The LAHPV test is capable of detecting 37 high and low risk HPV genotypes, including co-infections, [32] has demonstrated high general and typespecific reproducibility in cervical samples, and has successfully identified high-risk HPV genotypes in OPSCC [22,33–36]. To date no large study has utilized LINEAR ARRAY HPVÒ Genotyping in OPSCC to detect and resolve all HPV16 and p16 discrepancies.

Methods and materials Study population All patients with a first primary diagnosis of oropharyngeal squamous cell carcinoma between 1992 and 2007 at University of Maryland Greenebaum Cancer Center (UMGCC) were retrospectively reviewed (n = 467). The inclusion criteria were no prior history of oropharyngeal cancer and available pre-treatment biopsy material for analysis. 185 patients met the inclusion criteria. Data collected from review of patients medical records included: age, race, gender, tobacco and alcohol use, tumor, nodal, metastasis stage (TNM stage), and overall survival. Tobacco and alcohol use were assigned as a binary value of positive or negative based on clinical records. TNM and clinical staging was defined according to the 7th edition of AJCC Cancer Staging manual. All patients were treated with curative intent with surgery and/or chemoradiation. p16 Immunohistochemistry Formalin-fixed, paraffin embedded (FFPE) primary-site tissue blocks were cut to 5 lm sections. p16 IHC was performed using commercially available antibodies (clone JC8, Santa Cruz Biotechnologies, California). Positive controls consisted of HPV16+ tonsillar squamous carcinomas with strong p16 expression. p16 IHC was scored for cytoplasmic and nuclear staining by a consensus of two blinded pathologists. Only tumor cells with moderate or high intensity were counted. Proportional scoring was semi-quantified as follows: 0, <10% staining; 1+, 10–49% staining; 2+, 50–70% staining; 3+, >70% staining. Scores of 2 or 3+ were defined as positive. HPV16 PCR PCR was performed for the E6 (forward ATGTTTCAGGACC CACAGGA, reverse CAGCTGGGTTTCTCTACGTGTT) and E7 (forward ATGCATGGAGATACACCTAC, reverse CATTAACAGGTCTTCCAAAG) genes of HPV16. Using 2 ng DNA, 40 cycles of standard three-step PCR (annealing temperature 55 °C) was performed. A negative control (no DNA) was included in every PCR run. Beta actin was amplified as well to indicate sample adequacy. Only cases positive for both E6 and E7 were scored HPV16 positive. In the case of ambiguity interpreting either product, both genes were amplified again from a freshly diluted DNA aliquot using the following different primer sets to amplify products overlapping but not nested within the originally amplified products (to eliminate the possibility of amplifying contaminating PCR products): E6 forward AAACTAAGGGCGTAACCGAAA, E6 reverse TAGTTGTTT GCAGCTCTGTGC and E7 forward ACAAGCAGAACCGGACAGAG, E7

reverse GATGGGGCACACAATTCCTA. HPV16 status could be scored for all 185 cases. Roche LINEAR ARRAY HPV Genotyping TestÒ The LAHPV test detects 37 high and low risk HPV types including all 12 types classified as carcinogenic (IARC Group 1: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 and 59), the single type classified as probably carcinogenic (IARC Group 2A: 68), 7 types classified as possibly carcinogenic (IARC Group 2B: 26, 53, 66, 67, 70, 73 and 82) and 17 other types. All tests were run with manufacturer’s positive and negative controls. The genotyping test was run in all 21 cases discordant between HPV16 DNA and p16 IHC as well as 34 cases that were HPV16 /p16 and 9 cases that were HPV16+/p16+ to ensure integrity of the genotyping test. In further analyses, the HPV status of any discordant HPV16/p16 case was reclassified according to the result of the LINEAR ARRAYÒ genotype test. Statistical analysis All statistical analyses were performed using JMP 10.0 software (SAS Institute, Cary, NC). Fisher’s exact test and Pearson’s Chi Squared test were used to analyze clinical categorical data for significant association(s). Correlation coefficient (R2) between HR HPV and p16 categorical results was calculated using Pearson’s Chi Squared test. A t-test was used to analyze continuous numeric data for significant difference in means. Overall survival and hazard ratios were calculated from Kaplan–Meier analysis, Log Rank method. Overall survival was defined from date of pathological diagnosis to death or last date known alive. Clinicopathological variables that were significant by univariate analysis were included in multivariate Cox proportional hazards modeling. Patients with an unknown clinicopathologic characteristic were excluded from the corresponding analysis. All statistical tests were two-sided and a p value of less than 0.05 was considered significant. Results Patient population A total of 185 primary index cases had available tissue for HPV DNA testing, and p16 IHC was evaluable in 184 of 185 cases. The clinicopathologic characteristics by HPV status are summarized in Table 1. A total of 67 of 185 patients were positive for HPV16 (36%), 73 of 185 were positive for any high risk HPV (HR HPV) (39%), and p16 IHC was positive in 75 of 184 patients (41%). 114 patients (62%) were Caucasian, 70 patients were African–American (38%), and 1 patient was Asian (<1%). There was a strong association of HR HPV+ OPSCC with white compared to black race (53% vs. 17%, p < 0.0001), male gender (p = 0.0019), no previous tobacco use (p = 0.0344), no previous alcohol use (p < 0.0001), lower T stage (p < 0.0001), higher N stage (p = 0.0109), improved median OS (p < 0.0001), and p16 positivity (p < 0.0001). Black race had a strong association with HR HPV negativity, (83% vs. 47%, p < 0.0001), p16 negativity (p < 0.0001), younger mean age (54.7 vs. 58.0 years, p = 0.0306), positive alcohol use (p = 0.0138), higher T stage (p < 0.0037), decreased median OS (14.1 vs. 39.9 months, p = 0.0005), and a trend towards a lower nodal stage (p = 0.0535) and positive tobacco use (p = 0.0879) (Table 1). Univariate and multivariate analysis Univariate analyses of clinicopathologic variables associated with adverse prognosis are summarized in Table 2. Significant

Please cite this article in press as: Liu SZ et al. Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer. Oral Oncol (2015), http://dx.doi.org/10.1016/j.oraloncology.2015.06.014

3

S.Z. Liu et al. / Oral Oncology xxx (2015) xxx–xxx Table 1 Clinicopathologic variables by HPV status and race. HPV Status Total

HPV

HPV16+

HR HPV+

P-value

White

114 (62%) 70 (38%) 1 (0.5%) 56.75 ± 10.60 34.88–93.47 41.95 ± 42.50

54 (48.2%) 58 (51.8%) 0 57.51 ± 11.54 34.88–93.47 25.20 ± 26.51

55 (82.0%) 11 (16.4%) 1 (1.5%) 55.02 ± 9.21 36.30–84.09 67.62 ± 50.62

60 (82.1%) 12 (16.4%) 1 (1.4%) 55.41 ± 9.09 36.30–84.09 67.65 ± 49.27

<0.0001

114 (61.6%)

150 (79%) 35 (21%)

84 (75%) 28 (25%)

60 (89.6%) 7 (10.4%)

66 (90.4%) 7 (9.6%)

152 (88.4%) 20 (11.6%) 13

98 (92.4%) 8 (7.6%) 6

49 (80.3%) 12 (19.7%) 6

54 (81.8%) 12 (18.2%) 7

125 (72.6%) 47 (27.3%) 19

90 (84.9%) 16 (15.1%) 6

32 (52.5%) 29 (47.5%) 6

35 (53.0%) 31 (47.0%) 7

6 21 37 55 64 2

4 8 13 32 53 2

2 13 18 23 11 0

2 13 24 23 11 0

7 37 21 20 44 31 21

5 31 14 8 24 17 11

2 5 6 10 18 14 10

2 6 7 12 20 14 10

7 174 4

5 104 3

2 64 1

2 70 1

7 5 5 25 117 22 4 26.84

5 5 3 17 67 12 3 16.39

2 0 1 7 46 10 1 102.5

2 0 2 8 50 10 1 102.51

109 75

103 9

6 60

HPV 16 Negative Positive

118 67

118 –

HR HPV Status Negative Positive

112 73

112 –

Race White Black Other Mean Age (yrs ± st. dev.) Range Mean F/U (mos ± st. dev.) Gender Males Females Significant tobacco use Positive Negative Unknown Significant alcohol use Positive Negative Unknown Tumor stage (T)^ Tx T1 T2 T3 T4a T4b Nodal Stage (N)# Nx N0 N1 N2a N2b N2c N3 Metastasis (M) Mx M0 M1 Clinical Stage Unknown I II III IVa IVb IVc Median OS (mos) p16 Status Negative Positive

^ #

Race Black

P-value

70 (37.8%) 0.1552

58.04 ± 10.12 36.44–93.47 50.01 ± 44.30

54.70 ± 11.22 34.88–84.08 29.34 ± 36.28

90 (79%) 24 (21%)

59 (84%) 11 (16%)

89 (84.8%) 16 (15.2%) 9

62 (93.9%) 4 (6.1%) 4

69 (65.7%) 36 (34.2%)

55 (83.3%) 11 (16.7%)

5 17 27 35 30 0

1 4 10 19 34 2

7 24 13 16 20 22 12

1 13 7 3 24 9 9

1 106 1

6 67 3

6 3 4 15 73 12 1 39.89

0 2 1 10 43 10 3 14.11

6 66

53 60

56 14

– 67

– –

59 55

59 11

<0.0001

– 67

– 73

54 60

58 12

<0.0001

0.0119

0.4413

0.0344

0.0879

<0.0001

0.0138

<0.0001

0.0037

0.0109

0.0535

0.5351

0.3006

0.4139

<0.0001 <0.0001

0.0366

0.5504

0.0005 <0.0001

T1–T2 vs. T3–Tb. N0–N1 vs. N2–N3.

variables (hazard ratio, p-value) associated with adverse prognosis were black race (1.98, <0.0001), female gender (1.55, 0.0443), tobacco use (1.88, 0.045), alcohol use (2.46, 0.0001), higher T stage (T3–T4 vs. T1–T2) (2.09, 0.0002), presence of metastasis (M1 vs. M0) (5.38, 0.0001), negative p16 IHC (3.78, 0.0001), negative HPV16 (3.83, <0.0001) or negative HR HPV (4.26, <0.0001). In multivariate analysis of significant clinicopathologic variables identified in univariate analysis, only drinking history, metastasis (M1), and HPV-16 status were significant in Cox Regression model (Table 3).

Correlation of p16 IHC with HPV status A total of 67 of 185 patients were positive for HPV16 DNA (36%) and p16 IHC was positive in 75 of 184 patients (41%). Among the p16+ cases, 28 were scored 2+(50–70% of tumor cells positive) and 47 were scored 3+(>70% of tumor cells positive). HPV and p16 IHC correlation results are summarized in Fig. 1. The correlation coefficient (R2) between HPV16 and p16 IHC was 0.48 (p < 0.0001). 163 of 184 HPV16 and p16 results were concordant (89%, Fig. 1). The correlation coefficient (R2) between p16 IHC

Please cite this article in press as: Liu SZ et al. Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer. Oral Oncol (2015), http://dx.doi.org/10.1016/j.oraloncology.2015.06.014

4

S.Z. Liu et al. / Oral Oncology xxx (2015) xxx–xxx

Table 2 Univariate analyses of clinicopathologic variables. Count

Median OS (mos)

P-value

Hazard ratio

CI (95%)

Race White Black Other

185 114 (61.6%) 70 (37.8%) 1 (0.5%)

44.45 14.11 NR

0.0001 –

1.00 1.98

1.40–2.78

Age (yrs) >55 <55

95 89

36.14 22.14

0.6524

1.00 1.08

0.77–1.52

Gender Males Females

150 (81.1%) 35 (18.9%)

27.96 12.81

0.0443

1.00 1.55

– 1.01–2.31

Significant tobacco use Positive Negative

152 (88.4%) 20 (11.6%)

23.89 NR

0.045 –

1.88 1.00

1.01–4.00 – 1.60–3.94 – –

Significant alcohol use Positive Negative Tumor Stage (T) T1–T2 T3–T4

125 (72.7%) 47 (27.3%)

19.02 96.92

<0.0001 –

2.46 1.00

58 121

33.51 12.45

– 0.0002

1.00 2.09

1.43–3.16

Nodal Stage (N) N0–N1 N2–M3

69 116

27.96 22.14

0.4523 –

1.00 1.13

0.81–1.60

Metastasis (M) M0 M1

175 4

26.84 4.07

0.0093 –

5.38

1.63–13.09

Clinical stage I–II III–IVb IVc

10 164 4

25.94 26.84 4.07

– 0.4523 0.0356

1.00 0.76 4.16

0.41–1.62 1.11–12.95

p16 Status Negative Positive

109 75

14.83 96.92

<0.0001 –

3.78 1.00

2.59–5.63

HPV 16 Negative Positive

118 67

17.00 102.51

<0.0001

3.83 1.00

2.56–5.90

HR HPV status Negative Positive

112 73

16.39 102.51

<0.0001

4.26 1.00

2.86–6.49

Table 3 Multivariate analysis of selected variables.

Race (White vs. Black) Gender Significant tobacco use (pos. vs neg.) Significant alcohol use (pos. vs neg.) T3–T4 vs. T1–T2 M Stage (M1 vs. M0) HPV16 status (pos. vs neg.)* p16 status (pos. vs neg.) *

HPV16+ P value

p16+

0.084 0.153 0.437 0.034 0.062 0.002 0.050 0.094

p16-

By multivariate analysis, any HR HPV was not significant (p = 0.080).

and HR HPV detection was 0.58 (p < 0.0001). 169 of 184 HR HPV and p16 results were concordant (92%, Fig. 1). Among the cases discordant for HPV16 and p16, 15 patients were HPV16 /p16+ and 6 patients were HPV16+/p16 . There was no racial difference in the appearance of HPV16/p16 discordance (HPV16+/p16+ vs HPV16+/p16 , p = 0.99, and vs HPV16 /p16+, p = 0.36). 1/70 black patients was HPV16+/p16 (1.4%) compared to 5/113 whites (4.4%). 4/70 black patients were HPV16 /p16+ (6%) compared to 11/113 whites (10%). LAHPV testing was performed on all HPV16/p16 discordant cases (Fig. 2) and identified HR HPV (types 33, 35, 35, 51, 58, and 59) in 6 of 15 cases that were HPV16 /p16+. LAHPV testing of the six HPV16+/p16 cases confirmed the DNA PCR result for the

HPV16-

HR HPV+

HR HPV-

60

15

66

9

6

103

6

103

Fig. 1. HPV vs. p16.

5 cases with a positive beta-globin control; DNA amplification in the LAHPV test was insufficient in the remaining case. Testing of 43 concordant cases (34 HPV16 /p16 and 9 HPV16+/p16+) revealed no discrepancies between LAHPV testing and HPV16 DNA PCR. No additional HR HPV types were identified in the HPV16+/p16+ control cases. The sensitivity of p16 as a surrogate marker for HPV16 was 91% and for HR HPV was 92%. The specificity of p16 for HPV16 was 87% and for HR HPV was 92%. The positive predictive value (PPV) and negative predictive values (NPV) for p16 as a surrogate for HPV16 infection were 80% and 94%, respectively, and for HR HPV infection 88% and 94% respectively. Survival analysis by HR HPV and p16 status The median overall survival (OS) was risk stratified by HR HPV and p16 status (Fig. 3a). The HR HPV+/p16+ group had the best median OS, 105.43 months, and the HR HPV /p16 group the

Please cite this article in press as: Liu SZ et al. Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer. Oral Oncol (2015), http://dx.doi.org/10.1016/j.oraloncology.2015.06.014

5

S.Z. Liu et al. / Oral Oncology xxx (2015) xxx–xxx

Case 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

HPV16 (PCR) Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg Pos Pos Pos Pos Pos Pos

p16 + + + + + + + + + + + + + + + -

HR HPV (LA) Neg Neg Neg Neg Neg Neg Neg Neg Neg 33 35 35 51 59 58 16 16 16 16 16 *

HR HPV patients, black race was associated with significantly worse OS (HR: 1.51, p = 0.0408) (see Fig. 3b and Fig. 4b).

Race W W W W W W B B B W W W W W B W W W W B W

Discussion

Fig. 2. Roche LINEAR ARRAYÒ HPV Genotyping Test Results in Cases Discordant for HPV16 and p16 ⁄DNA amplification in linear array assay was unsuccessful.

worst, 14.11 months (HR: 4.65, 95% CI: 3.08–7.22, p < 0.0001) (Fig. 4a). The groups discordant for HR HPV/p16 had intermediate median OS values: 62.41 months for the HR HPV+/p16 group and 46.98 months for the HR HPV /p16+ group (Fig. 4a). These groups had significantly improved median OS compared to the HR HPV /p16 group (Fig. 3a), however no significant difference in median OS was observed between the HR HPV+/p16+ group and discordant groups (Fig. 3a).

Survival analysis by race and HPV status Median OS was risk stratified by HPV status and race (Fig. 3b). There was no significant racial difference for HR HPV+ patients: HR HPV+ black patients and HR HPV+ white patients had a median OS of 127 months and 103 months, respectively (p = 0.9521) (Fig. 4b). HR HPV black patients and white patients had a median OS of 11 and 23 months respectively and had significantly worse OS than HR HPV+ blacks and whites (Fig. 3b and Fig. 4b). Among

HR HPV+/p16HR HPV-/p16+ HR HPV-/p16-

HR HPV+/p16+ 1.47 (0.44-3.72, 0.4916) 2.06 (0.77-4.65, 0.1372) 4.65 (3.08-7.22, <0.0001)

In this study, we found p16 IHC had strong correlation with HR HPV infection, a concordance of 92%. Twenty-one out of 184 cases (11%) had discordant HPV16 and p16 results. In our population, a minority of HR HPV infections were due to a type other than HPV16 (6/73, 8%), but importantly in patients that were HPV16 /p16+, 40% (6/15) were found by LAHPV testing to be positive for another HR HPV type. P16 IHC positivity offered similar prognostic information as HR HPV testing, and patients that were positive for at least one of p16 or HR HPV had improved survival compared to HPV /p16 patients. To our knowledge our study is the first study to use the Linear Array test in conjunction with HPV DNA PCR and p16 to resolve all discrepancies between HPV16 and p16. The Roche LINEAR ARRAYÒ HPV Genotyping test showed very high sensitivity and specificity in detecting HPV16 infections compared to HPV16 DNA PCR (100% concordant results in 43 control cases). We found that a small percentage (8%, 6/73) of HPV infections was caused by other high risk genotypes, similar to what is reported in literature (5– 10%) [4–8]. These other HR HPV types were 33 (1), 35 (2), 26 (1), 58 (1), and 59 (1). The small percentage of HR HPV+ OPSCCs that are not due to HPV16 is similar to studies that have used LAPHV testing in OPSCCs. Al-Swiahb et al. found only 1 case out of 45 positive HR HPV OPSCC were positive for a non-HPV16 or HPV18 genotype [22]. Farshadpour et al. tested 32 OPSCCs using HPV DNA PCR and LAHPV and found good concordance between the tests (22/25, 88%) [36]. Lohavanichbutr et al. used LAHPV as the primary method to detect HPV infection in OPSCC and oral cavity cancers. Four of 43 HPV positive tumors were positive for HPV32, HPV35, HPV45, and HPV53. [37] The prognostic significance of other high risk genotypes in OPSCC is not well studied. We found no difference in outcome between HPV16 positive OPSCC patients and the 6 cases positive for another HR HPV (data not shown). In all non-HPV16 HR HPV+ cases (n = 6), p16 was positive, suggesting that these cases had a biologically active HPV infection and thus behaved favorably. In our patient cohort, we observed a significant racial survival difference between white and black patients (median OS 39.9 vs. 14.1 months) that is driven by a large racial disparity in HPV status (whites 60/114, 53% vs. blacks 12/70, 17%, p < 0.0001). We also previously observed and reported a racial survival disparity between black and white patients in OPSCC in an independent patient population in a multicenter TAX-324 chemo- and radiotherapy trial [11]. In that study, there was no racial difference in survival in non-oropharyngeal sites; the more favorable overall survival in white patients with OPSCC was driven by increased prevalence of HR HPV+/p16-

1.40 (0.39-5.59, 0.6004) 3.16 (1.29-10.52, 0.0088)

HR HPV-/p16+

2.25 (1.07-5.79, 0.0300)

Fig. 3a. Overall survival hazard ratios, stratified by HR HPV and p16.

HR HPV+ Blacks HR HPV- Whites HR HPV- Blacks

HR HPV+ Whites 0.97 (0.37-2.18, 0.9521) 3.48 (2.17-5.67, <0.0001) 5.25 (3.31-8.50, <0.0001)

HR HPV+ Blacks 3.57 (1.62-9.45, 0.0009) 5.39 (2.46-14.23, <0.0001)

HR HPV- Whites

1.51 (1.02-2.25, 0.0408)

Fig. 3b. Overall survival hazard ratios, stratified by HR HPV and race.

Please cite this article in press as: Liu SZ et al. Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer. Oral Oncol (2015), http://dx.doi.org/10.1016/j.oraloncology.2015.06.014

6

S.Z. Liu et al. / Oral Oncology xxx (2015) xxx–xxx

Survival Fraction

1.00

HR HPV+, p16+ HR HPV-, p16HR HPV+, p16-

0.75

HR HPV-, p16+ 0.50 0.25 0.00

0

50

100

200

150

250

Time (months) Fig. 4a. HR HPV survival by HPV and p16 status.

Survival Fraction

1.00

HPV-, Black HPV-, White HPV+, Black

0.75

HPV+, White 0.50 0.25 0.00

0

50

100

150

200

250

Time (months) Fig. 4b. HR HPV survival by race.

HPV infection in whites (34% vs. 4% in black patients). A recent study by Jiron et al. also demonstrated that black patients had lower rates of HPV+ OPSCC than whites, which accounted for their much poorer survival [38]. In contrast, Weinberger et al. and Isayeva et al. noticed no significant racial HPV prevalence between blacks and whites in their studies, but racial differences in survival could be accounted for by pairing HPV and p16 co-results [30,39]. Weinberger et al. found in their study that black patients were much more likely than whites to have prognostically unfavorable HPV+/p16 or ‘‘HPV inactive’’ OPSCCs [40]. They hypothesized that it is only in the HPV+/p16+ subgroup that HPV has a role in oncogenesis, with improved outcome corresponding to a lower p53 and Rb expression than in ‘‘HPV inactive’’ or ‘‘HPV negative’’ (HPV /p16 ) infections [40]. The ‘‘HPV inactive’’ OPSCCs behaved significantly worse than ‘‘HPV active’’ OPSCCs (HPV+/p16+). Similarly, Isayeva et al. found that black patients were much more likely to have p16 negative OPSCC (termed ‘‘silenced p16’’ but independent of HPV status) than whites, and p16 overexpression, not HPV prevalence, was more common in whites and was a stronger positive predictor of survival than HPV status. p16 negativity drove the significantly worse outcome in blacks vs. whites. In our cohort, there was no significant survival difference between HPV+/p16+ and discordant groups (HPV /p16+, HPV+/p16 ) and no racial difference in prevalence among discordant groups vs. HPV+/p16+ group. Unlike earlier studies, we observed an improved survival compared to the HPV /p16 group as long as either HPV or p16 is positive. Our results support the findings by Smith et al., who found that in head and neck squamous cell carcinomas discordant HPV/p16 cases showed a trend toward better prognosis than the HPV /p16 group [41]. While differences amongst studies could be the result of different molecular techniques for HPV testing, different p16 IHC cutoffs, and population groups, further data is needed to determine whether the combination of HPV and p16 is needed to define the subgroup of OPSCC patients with the best prognosis. Further study is important

as it would have potential implications in clinical trial design and treatment and also help determine whether in practice HPV16 negative/p16 positive patients should be tested for other HR HPV types. Currently there are numerous ways of evaluating HPV status in OPSCC including with p16 expression which has been found to be a surrogate marker of HPV status. The goal of HPV testing is to accurately diagnose biologically relevant HPV infection in oropharyngeal cancer with high sensitivity and specificity, ideally with one test that is easily reproducible in everyday practice. Defining the best method for HPV testing will continue to be critical especially if ongoing studies show that different treatment paradigms should employed for HPV positive OPSCC. In the literature, there are substantial differences in defining p16 overexpression. The cutoff used ranges from >0% to >80% (proportion of tumor cells displaying moderate to strong staining), with most studies utilizing a >50% cut-off (Table 4). In this study, we utilized a p16 cut-off of >50%. Among 75 p16+ cases, 28 showed 50–70% proportional staining (2+) and 47 showed >70% proportional staining (3+). We did not observe differences in survival or HPV prevalence between patients with 2+ vs. 3+ p16 IHC staining (data not shown). The various cutoffs used for defining p16 overexpression have contributed to substantial variation in the level of concordance with direct HPV testing. The HPV and p16 concordance of our study is on the higher end (92%) among studies that employed the HPV DNA PCR approach (61–100%), but is similar to large studies (n > 100) with a defined p16 IHC cutoff of >50% (80–97% concordance) [17,22,24–29,31,36,40–55]. In a recent meta-analysis of OPSCC correlating HPV detected by DNA PCR and/or ISH and p16 (n = 2888), the highest correlation between HPV and p16 was for p16 IHC staining >70% rather than a verbal definition or a lower percentage. [14] HPV DNA PCR testing offers the highest concordance with p16 IHC results among published studies comparing p16 IHC with HPV status detected by various molecular methods (DNA PCR,

Please cite this article in press as: Liu SZ et al. Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer. Oral Oncol (2015), http://dx.doi.org/10.1016/j.oraloncology.2015.06.014

7

S.Z. Liu et al. / Oral Oncology xxx (2015) xxx–xxx Table 4 Selected references reporting both HPV detected by DNA PCR and p16 detected by IHC.

a

Reference

Site

Primers (HPV gene target)

Genotyping method(s)

na

HRHPV+ n

[29]

HN

185

HN OP

299 274

[24] [26] This study [25] [28] [56] [27] [54] [34]

OP OP OP

Not described (E6) SPF10 (L1) Type-specific (E6, E7)

PCR-MassArray (15 HR types); PCR product sequencing PCR product sequencing ISH (types 16, 18); Line blot (37 types) for ISH-neg subset Not described Line blot (27 types) Line blot (37 types)

324

[35] [22]

Type-specific (E6); PGMY09/11 (L1) MY09/11-GP5+/6+(L1) MY09/MY11-GP05/06 (L1)

OP OP OP OP OP OP

[53] [49] [50] [30] [57]

OP OP OP HN HN

[36] [51]

OP OP

BSGP5+/6+(L1) A5/A10-A6/A8 (L1) GP5+/6+(L1) Type-specific (E6/E7) A10/A5-A6/A8 (L1) Type-specific (E6, E7); Broad spectrum (E1, E2) GP5+/GP6+(L1) MY09/GP6+–GP5+/GP6+(L1) Type-specific (E1) Type-specific (E6, E7) BSGP5+/6+(L1), MY09/11-‘‘125’’ (L1) Type-specific (E6) GP5+/6+(L1)

[46]

OP

[48] [55] [17] [33]

OP OP OP OP

[52]

OP

[42] [47] [31]

OP OP OP

Type-specific (target undefined); GP5+/6+(L1) GP5+/6+(L1) A10/A5–A6/A8 (L1) GP5+/6+(L1) AttoSense (target unclear) Type-specific (E6/E7); SPF10 (L1) Amplicor (L1) GP5+/6+(L1) SPF10 (L1)

HPV16% of HR

p16+ n

Cutoff

HPV/p16 concordance

85%

195

>50%

90%

81 44

95% 89%

105 36

>0% >60%

80% 97%

198 184 184

104 133 72

– 92% 92%

86 81 75

Descriptive Descriptive >50%

88% 67% 92%

Bead hybridization (27 types) Line blot (37 types) Bead hybridization (18 HR types) qPCR (types 16, 18, 31, 33, 35) PCR product sequencing qPCR (types 16, 18); PCR product sequencing DNA Chip (24 types) DNA Chip (37 types) qPCR (types 16, 18) qPCR (type 16) Bead hybridization (27 types), DNA chip (32 types) qPCR (type 16) PCR (type 16), bead hybridization (24 types) PCR (types 16, 18, 33)

177 162 142 104 96 94

92 51 95 40 27 50

– 100% 96% 95% – 90%

54 50 90 39 29 59

Descriptive >70% >70% >70% >60% >80%

65% 96% 89% 86% 94% 88%

93 92 90 81 78

46 69 17 37 22

96% 84% 100% – 95%

46 49 32 33 29

>67% >50% Descriptive P20% >5%

92% 70% 83% 85% 77%

78 55

59 35

– 100%

19 40

Descriptive >10%

61% 69%

52

32

–

25

>5%

71%

DNA Chip (27 types) PCR product sequencing PCR product sequencing qPCR plus TOF MS (13 HR types, results not reported) qPCR (types 16, 18, 33); line blot (28 types) Line blot (37 types), HPV16 FISH Dot blot (37 types) Line blot (25 types)

52 52 51 48

38 15 25 36

89% 73% 96% –

37 17 27 35

Any >60% >10% >25%

87% 88% 76% 85%

46

29

97%

28

>10%

80%

27 26 20

14 21 12

79% 86% 83%

14 20 11

>75% >75% Descriptive

100% 88% 95%

Only cases co-tested for HPV and p16 are extracted here.

DNA in situ hybridization, and RNA PCR). The advantage of DNA in situ hybridization (ISH) is direct histological evaluation, leading to a low false positive rate (high specificity). However, this test has a high false negative rate (decreased sensitivity) compared to HPV DNA PCR testing. [13,16,17] The concordance between p16 and HPV DNA ISH reported in literature for OPSCC is between 58% and 93%. HPV mRNA PCR testing most convincingly detects biologically active (i.e., oncogenic) HPV infections. However, mRNA is subject to RNA degradation and is best performed on fresh frozen tissue. In four studies that have employed this method, the concordance with p16 IHC was mediocre (73–94%). [25,30,56,57] In the lone large study (n > 100), the concordance with p16 IHC was 80% vs. 91–94% using a DNA PCR approach. [57] In summary, our study found that p16 IHC is a reliable surrogate marker for HR HPV+ OPSCC with high sensitivity and specificity. In patients who are HPV16 negative but p16+, additional testing for non-HPV16 high risk HPV genotypes may be warranted to identify favorably prognostic HPV types. Patients discordant for HR HPV and p16 still had significantly better prognoses than HPV /p16 patients. Importantly, we found a racial survival difference in our OPSCC cohort, which is driven by racial differences in HPV infection. A potential limitation of our study is the relatively small size of non-HPV16 HR HPV types (n = 6), which did not allow us to examine prognostic differences between HPV16 and specific other HR HPV genotypes. Further studies with larger cohorts are needed to examine the clinical and biological significance of p16 results discordant with other HR HPV genotypes.

Conflict of interest The authors of this study have no financial or personal conflict of interest. Acknowledgement None. References [1] Siegel RA, Naishadham D, Jemal Fau, Jemal A. Cancer statistics 2013. CA Cancer J Clin 2013;63(1):11–30. http://dx.doi.org/10.3322/caac.21166. [2] Chaturvedi AK et al. Human papillomavirus and rising oropharyngeal cancer incidence in the United States. J Clin Oncol 2011;29(32):4294–301 (http:// dx.doi.org/10.1200/JCO.2011.36.4596). [3] Chaturvedi AK et al. Worldwide trends in incidence rates for oral cavity and oropharyngeal cancers. J Clin Oncol 2013;31(36):4550–9 (http://dx.doi.org/10. 1200/JCO.2013.50.3870. [4] Kreimer AR et al. Human papillomavirus types in head and neck squamous cell carcinomas worldwide: a systematic review. Cancer Epidemiol Biomarkers Prev 2005;14(2):467–75. [5] Bosch FX et al. Comprehensive control of human papillomavirus infections and related diseases. Vaccine 2013;31(17):H1–H31. http://dx.doi.org/10.1016/ j.vaccine.2013.10.003, pii:S0264-410X(13)01346-7. [6] Gillison ML et al. Distinct risk factor profiles for human papillomavirus type 16-positive and human papillomavirus type 16-negative head and neck cancers. J Natl Cancer Inst 2000;92(9):709–20. [7] Herrero R et al. Human papillomavirus and oral cancer: the international agency for research on cancer multicenter study. J Natl Cancer Inst 2003;95(23):1772–83.

Please cite this article in press as: Liu SZ et al. Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer. Oral Oncol (2015), http://dx.doi.org/10.1016/j.oraloncology.2015.06.014

8

S.Z. Liu et al. / Oral Oncology xxx (2015) xxx–xxx

[8] St Guily JL et al. Human papillomavirus genotype distribution in oroph Human papillomavirus genotype distribution in oropharynx and oral cavity cancer in France–The EDiTH VI study arynx and oral cavity cancer. J Clin Virol 2011;51(2):100–4. http://dx.doi.org/10.1016/j.jcv.2011.03.003. [9] Ang KK et al. Human papillomavirus and survival of patients with oropharyngeal cancer. N Engl J Med 2010;363(1):24–35. http://dx.doi.org/10. 1056/NEJMoa0912217. [10] Dayyani F et al. Meta-analysis of the impact of human papillomavirus (HPV) on cancer risk and overall survival in head and neck squamous cell carcinomas (HNSCC). Head Neck Oncol 2010;2:15. http://dx.doi.org/10.1186/1758-32842-15. [11] Settle K et al. Racial survival disparity in head and neck cancer results from low prevalence of human papillomavirus infection in black oropharyngeal cancer patients. Cancer Prev Res (Phila) 2009;2(9):776–81. http://dx.doi.org/ 10.1158/1940-6207.CAPR-09-0149. [12] Fakhry C et al. Improved survival of patients with human papillomaviruspositive head and neck squamous cell carcinoma in a prospective clinical trial. J Natl Cancer Inst 2008;100(4):261–9. http://dx.doi.org/10.1093/jnci/djn011. [13] Rischin D et al. Prognostic significance of p16INK4A and human papillomavirus in patients with oropharyngeal cancer treated on TROG 0202 phase III trial. J Clin Oncol 2010;28(27):4142–8. http://dx.doi.org/10.1200/JCO. 2010.29.2904. [14] Gronhoj Larsen C et al. Correlation between human papillomavirus and p16 overexpression in oropharyngeal tumours: a systematic review. Br J Cancer 2014;110(6):1587–94. http://dx.doi.org/10.1038/bjc.2014.42. [15] Salazar CR et al. Combined P16 and human papillomavirus testing predicts head and neck cancer survival. Int J Cancer 2014. [16] Chernock RD et al. Human papillomavirus-related squamous cell carcinoma of the oropharynx: a comparative study in whites and African Americans. Arch Otolaryngol Head Neck Surg 2011;137(2):163–9. http://dx.doi.org/10.1001/ archoto.2010.246. [17] Mellin Dahlstrand H et al. P16(INK4a) correlates to human papillomavirus presence, response to radiotherapy and clinical outcome in tonsillar carcinoma. Anticancer Res 2005;25(6C):4375–83. [18] Cai C et al. Keratinizing-type squamous cell carcinoma of the oropharynx: p16 overexpression. Am J Surg Pathol 2014;38(6):809–15. http://dx.doi.org/10. 1097/PAS.0000000000000183. [19] Bishop JA et al. Detection of transcriptionally active high-risk HPV in patients with head and neck squamous cell carcinoma as visualized by a novel E6/E7 mRNA in situ hybridization method. Am J Surg Pathol 2012;36(12):1874–82. http://dx.doi.org/10.1097/PAS.0b013e318265fb2b. [20] Ukpo OC et al. High-risk human papillomavirus E6/E7 mRNA detection by a novel in situ hybridization assay strongly correlates with p16 expression and patient outcomes in oropharyngeal squamous cell carcinoma. Am J Surg Pathol 2011;35(9):1343–50. http://dx.doi.org/10.1097/PAS.0b013e318220e59d. [21] Lewis Jr JS et al. p16 positive oropharyngeal squamous cell carcinoma:an entity with a favorable prognosis regardless of tumor HPV status. Am J Surg Pathol 2010;34(8):1088–96. http://dx.doi.org/10.1097/PAS. 0b013e3181e84652. [22] Al-Swiahb JN et al. Prognostic impact of p16 p53 epidermal growth factor receptor and human papillomavirus in oropharyngeal cancer in a betel nutchewing area. Arch Otolaryngol Head Neck Surg 2010;136(5):502–8. http:// dx.doi.org/10.1001/archoto.2010.47. [23] Gao G et al. A novel RT-PCR method for quantification of human papillomavirus transcripts in archived tissues and its application in oropharyngeal cancer prognosis. Int J Cancer 2013;132(4):882–90. http:// dx.doi.org/10.1002/ijc.27739. [24] Hong AM et al. Human papillomavirus predicts outcome in oropharyngeal cancer in patients treated primarily with surgery or radiation therapy. Br J Cancer 2010;103(10):1510–7. http://dx.doi.org/10.1038/sj.bjc. 6605944. [25] Holzinger D et al. Viral RNA patterns and high viral load reliably define oropharynx carcinomas with active HPV16 involvement. Cancer Res 2012;72(19):4993–5003. http://dx.doi.org/10.1158/0008-5472.CAN-11-3934. [26] Junor E et al. Benefit of chemotherapy as part of treatment for HPV DNApositive but p16-negative squamous cell carcinoma of the oropharynx. Br J Cancer 2012;106(2):358–65. http://dx.doi.org/10.1038/bjc.2011.542. [27] Kawakami H et al. Human papillomavirus DNA and p16 expression in Japanese patients with oropharyngeal squamous cell carcinoma. Cancer Med. 2013;2(6):933–41. http://dx.doi.org/10.1002/cam4.151. [28] Mooren JJ et al. P16(INK4A) immunostaining is a strong indicator for high-riskHPV-associated oropharyngeal carcinomas and dysplasias, but is unreliable to predict low-risk-HPV-infection in head and neck papillomas and laryngeal dysplasias. Int J Cancer 2014;134(9):2108–17. http://dx.doi.org/10.1002/ijc. 28534. [29] Walline HW et al. High-risk human papillomavirus detection in oropharyngeal nasopharyngeal and oral cavity cancers: comparison of multiple methods. JAMA Otolaryngol Head Neck Surg 2013;139(12):1320–7. http://dx.doi.org/10. 1001/jamaoto.2013.5460. [30] Isayeva T et al. African Americans with oropharyngeal carcinoma have significantly poorer outcomes despite similar rates of human papillomavirusmediated carcinogenesis. Hum Pathol 2014;45(2):310–9. http://dx.doi.org/10. 1016/j.humpath.2013.09.006, pii:S0046-8177(13)00389-4. [31] Quon H et al. Transoral robotic surgery and adjuvant therapy for oropharyngeal carcinomas and the influence of p16 INK4a on treatment

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41] [42]

[43]

[44]

[45]

[46]

[47]

[48] [49]

[50]

[51]

[52] [53]

[54]

[55]

[56]

[57]

outcomes. Laryngoscope 2013;123(3):635–40. http://dx.doi.org/10.1002/lary. 22172. van Hamont D et al. Evaluation of the SPF10-INNO LiPA human papillomavirus (HPV) genotyping test and the roche linear array HPV genotyping test. J Clin Microbiol 2006;44(9):3122–9. Black CC et al. Use of a linear array for the detection of human papillomavirus genotypes in head and neck cancer. Arch Pathol Lab Med 2010;134(12):1813–7. http://dx.doi.org/10.1043/2009-0592-OAR.1. Shanesmith R et al. Comparison of 2 line blot assays for defining HPV genotypes in oral and oropharyngeal squamous cell carcinomas. Diagn Microbiol Infect Dis 2011;70(2):p. 240–5. http://dx.doi.org/10.1016/ j.diagmicrobio.2011.01.011. Steinau M, Swan Dc, Unger ER. Type-specific reproducibility of the Roche linear array HPV genotyping test. J Clin Virol 2008;42(4):412–4. http://dx.doi. org/10.1016/j.jcv.2008.03.004. Farshadpour F et al. Human papillomavirus and oropharyngeal squamous cell carcinoma: a case-control study regarding tobacco and alcohol consumption. Patholog Res Int 2011:806345. http://dx.doi.org/10.4061/2011/806345. Lohavanichbutr P et al. Genomewide gene expression profiles of HPV-positive and HPV-negative oropharyngeal cancer: potential implications for treatment choices. Arch Otolaryngol Head Neck Surg 2009;135(2):180–8. http://dx.doi. org/10.1001/archoto.2008.540. Jiron J et al. Racial disparities in Human Papillomavirus (HPV) associated head and neck cancer. Am J Otolaryngol 2014;35(2):147–53. http://dx.doi.org/10. 1016/j.amjoto.2013.09.004, pii:S0196-0709(13)00219-6. Weinberger PM et al. Human papillomavirus-active head and neck cancer and ethnic health disparities. Laryngoscope 2010;120(8):1531–7. http://dx.doi. org/10.1002/lary.20984. Weinberger PM et al. Molecular classification identifies a subset of human papillomavirus–associated oropharyngeal cancers with favorable prognosis. J Clin Oncol 2006;24(5):736–47. Smith EM et al. P16INK4a expression, human papillomavirus, and survival in head and neck cancer. Oral Oncol 2008;44(2):133–42. Charfi L et al. Two types of squamous cell carcinoma of the palatine tonsil characterized by distinct etiology, molecular features and outcome. Cancer Lett 2008;260(1–2):72–8. El-Mofty SK, Patil S. Human papillomavirus (HPV)-related oropharyngeal nonkeratinizing squamous cell carcinoma: characterization of a distinct phenotype. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;101(3):339–45. Evans MF et al. Discrimination of ’driver’ and ’passenger’ HPV in tonsillar carcinomas by the polymerase chain reaction, chromogenic in situ hybridization, and p16(INK4a) immunohistochemistry. Head Neck Pathol 2011;5(4):344–8. http://dx.doi.org/10.1007/s12105-011-0282-y. Kim SH et al. HPV integration begins in the tonsillar crypt and leads to the alteration of p16, EGFR and c-myc during tumor formation. Int J Cancer 2007;120(7):1418–25. Kuo KT et al. The biomarkers of human papillomavirus infection in tonsillar squamous cell carcinoma-molecular basis and predicting favorable outcome. Mod Pathol 2008;21(4):376–86. http://dx.doi.org/10.1038/modpathol. 3800979. Licitra L et al. High-risk human papillomavirus affects prognosis in patients with surgically treated oropharyngeal squamous cell carcinoma. J Clin Oncol 2006;24(36):5630–6. Lindquist D et al. Intense CD44 expression is a negative prognostic factor in tonsillar and base of tongue cancer. Anticancer Res 2012;32(1):153–61. Melkane AE et al. HPV-related oropharyngeal squamous cell carcinomas: a comparison between three diagnostic approaches. Am J Otolaryngol 2014;35(1):25–32. http://dx.doi.org/10.1016/j.amjoto.2013.08.007, pii:S0196-0709(13)00198-1. Nichols AC et al. Does HPV type affect outcome in oropharyngeal cancer? J Otolaryngol Head Neck Surg 2013;42:9. http://dx.doi.org/10.1186/1916-021642-9. Park WS et al. Human papillomavirus in oropharyngeal squamous cell carcinomas in Korea: use of G1 cycle markers as new prognosticators. Head Neck 2012;34(10):1408–17. http://dx.doi.org/10.1002/hed.21939. Reimers N et al. Combined analysis of HPV-DNA, p16 and EGFR expression to predict prognosis in oropharyngeal cancer. Int J Cancer 2007;120(8):1731–8. Semrau R et al. Prognostic impact of human papillomavirus status, survivinand epidermal growth factor receptor expression on survival in patients treated with radiochemotherapy for very advanced nonresectable oropharyngeal cancer. Head Neck 2013;35(9):1339–44. http://dx.doi.org/10.1002/hed.23126. Thavaraj S et al. Evaluation of human papillomavirus testing for squamous cell carcinoma of the tonsil in clinical practice. J Clin Pathol 2011;64(4):308–12. http://dx.doi.org/10.1136/jcp.2010.088450. Weiss D et al. HPV16-dependent overexpression in HNSCC and predicts lower recurrence rate in HNSCC independently of HPV16. BMC Cancer 2012;12:259. http://dx.doi.org/10.1186/1471-2407-12-259. Hoffmann M et al. HPV DNA E6⁄I-mRNA expression and p16INK4A immunohistochemistry in head and neck cancer – how valid is p16INK4A as surrogate marker? Cancer Lett 2012;323(1):88–96. http://dx.doi.org/10.1016/ j.canlet.2012.03.033. Shi W et al. Comparative prognostic value of HPV16 E6 mRNA compared with in situ hybridization for human oropharyngeal squamous carcinoma. J Clin Oncol 2009;27(36):p. 6213–21. http://dx.doi.org/10.1200/JCO.2009.23.1670.

Please cite this article in press as: Liu SZ et al. Correlation of p16 expression and HPV type with survival in oropharyngeal squamous cell cancer. Oral Oncol (2015), http://dx.doi.org/10.1016/j.oraloncology.2015.06.014