- Email: [email protected]
Corrigendum to “Efficient propagation of single gene deleted recombinant Sendai virus vectors”
Virus Research 101 (2004) 205
Corrigendum
Corrigendum to “Efficient propagation of single gene deleted recombinant Sendai virus vectors” [Virus Res. 99 (2004) 193–197]夽 Christian Bernloehr a,1 , Sascha Bossow b , Guy Ungerechts a , Sorin Armeanu a , Wolfgang J. Neubert b , Ulrich M. Lauer a , Michael Bitzer a,∗,1 a
b
Internal Medicine I, University Clinic Tübingen, D-72076 Tübingen, Germany Max-Planck-Institute for Biochemistry, Molecular Virology, D-82152 Martinsried, Germany
The authors and publisher would like to apologise for an error which occurred in Fig. 3 of the above article. The correct version is reproduced below.
Fig. 3. RT-PCR analysis of recombinant SeVV. Cellular RNA was isolated from SeVV–HN, SeVV–M, and SeVV–F infected Vero cells (MOI 0,1) and RT-PCR was performed using either one of the following specific primer pairs for each viral gene, which is indicated at the bottom of each lane. HN “forward”: 5 GGTGATAGGGGCAAACGTG3 /“reverse”: 5 GACTCGGCCTTGCATAATTTAG 3 ; F “forward”: 5 ATGACAGCA-TATATCCAGAGGTC 3 /“reverse”: 5 TCATCTTTTCTCAGCCATCGC 3 ; M “forward”: 5 GAAATTTCACCTAACACGGC 3 /“reverse”: 5 TCTGCTTGGGGCATTGTC 3 . RT-PCR results from SeVV–HN, –M and F infected cells are shown in lanes 2–4, 5–7, and 8–10, respectively. The amplified genes consisted of 1727 bp by using the HN-, 1046 bp the M- and 1687 bp the F-primers. As a control RNA from SeV wild-type infected Vero cells (MOI 0,1) was used in lanes 13–15. Lane 16 shows a negative control using all three primer pairs (HN, M, and F) but without using cellular RNA.
夽
doi of original article 10.1016/j.virusres.2003.11.005. Corresponding author. Tel.: +49-7071-2983189; fax: +49-7071-295692. E-mail address: [email protected] (M. Bitzer). 1 These authors contributed equally to this study.
∗
0168-1702/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2004.02.003
Corrigendum
Corrigendum to “Efficient propagation of single gene deleted recombinant Sendai virus vectors” [Virus Res. 99 (2004) 193–197]夽 Christian Bernloehr a,1 , Sascha Bossow b , Guy Ungerechts a , Sorin Armeanu a , Wolfgang J. Neubert b , Ulrich M. Lauer a , Michael Bitzer a,∗,1 a
b
Internal Medicine I, University Clinic Tübingen, D-72076 Tübingen, Germany Max-Planck-Institute for Biochemistry, Molecular Virology, D-82152 Martinsried, Germany
The authors and publisher would like to apologise for an error which occurred in Fig. 3 of the above article. The correct version is reproduced below.
Fig. 3. RT-PCR analysis of recombinant SeVV. Cellular RNA was isolated from SeVV–HN, SeVV–M, and SeVV–F infected Vero cells (MOI 0,1) and RT-PCR was performed using either one of the following specific primer pairs for each viral gene, which is indicated at the bottom of each lane. HN “forward”: 5 GGTGATAGGGGCAAACGTG3 /“reverse”: 5 GACTCGGCCTTGCATAATTTAG 3 ; F “forward”: 5 ATGACAGCA-TATATCCAGAGGTC 3 /“reverse”: 5 TCATCTTTTCTCAGCCATCGC 3 ; M “forward”: 5 GAAATTTCACCTAACACGGC 3 /“reverse”: 5 TCTGCTTGGGGCATTGTC 3 . RT-PCR results from SeVV–HN, –M and F infected cells are shown in lanes 2–4, 5–7, and 8–10, respectively. The amplified genes consisted of 1727 bp by using the HN-, 1046 bp the M- and 1687 bp the F-primers. As a control RNA from SeV wild-type infected Vero cells (MOI 0,1) was used in lanes 13–15. Lane 16 shows a negative control using all three primer pairs (HN, M, and F) but without using cellular RNA.
夽
doi of original article 10.1016/j.virusres.2003.11.005. Corresponding author. Tel.: +49-7071-2983189; fax: +49-7071-295692. E-mail address: [email protected] (M. Bitzer). 1 These authors contributed equally to this study.
∗
0168-1702/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2004.02.003