- Email: [email protected]
Corrigendum to “Varicella-zoster virus CNS disease—Viral load, clinical manifestations and sequels” [J. Clin. Virol. 46 (2009) 249–253]
Journal of Clinical Virology 47 (2010) 203
Contents lists available at ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Corrigendum
Corrigendum to “Varicella-zoster virus CNS disease—Viral load, clinical manifestations and sequels” [J. Clin. Virol. 46 (2009) 249–253] Anna Persson a,∗ , Tomas Bergström b , Magnus Lindh b , Lili Namvar b , Marie Studahl a a b
Department of Infectious Diseases, Sahlgrenska University Hospital, Östra, SE-416 85 Gothenburg, Sweden Department of Clinical Virology, Sahlgrenska University Hospital, SE-413 46 Gothenburg, Sweden
The authors regret that they made an error in paragraph 3.2. “DNA extraction and real-time PCR detection assay”. The VZV probe sequence was replaced by a CMV probe sequence. The correct probe should be VZV gB probe CGCGGTCCCAAGTCCCTGGA. Thus, the sentence on page 250 should read: “A 70 nucleotide segment of the gB region was amplified and detected by the use of primers VZVgB F, TGCAGGGCATGGCTCAGT and VZVgB R, CCCAAGAACCACATGTCCAAC, and the probe VZVgB P, CGCGGTCCCAAGTCCCTGGA.” The authors would like to apologise for any inconvenience this may have caused to the readers of the journal.
DOI of original article:10.1016/j.jcv.2009.07.014. ∗ Corresponding author. Tel.: +46 31 3434473; fax: +46 31 847813. E-mail address: [email protected] (A. Persson). 1386-6532/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2009.11.025
Contents lists available at ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Corrigendum
Corrigendum to “Varicella-zoster virus CNS disease—Viral load, clinical manifestations and sequels” [J. Clin. Virol. 46 (2009) 249–253] Anna Persson a,∗ , Tomas Bergström b , Magnus Lindh b , Lili Namvar b , Marie Studahl a a b
Department of Infectious Diseases, Sahlgrenska University Hospital, Östra, SE-416 85 Gothenburg, Sweden Department of Clinical Virology, Sahlgrenska University Hospital, SE-413 46 Gothenburg, Sweden
The authors regret that they made an error in paragraph 3.2. “DNA extraction and real-time PCR detection assay”. The VZV probe sequence was replaced by a CMV probe sequence. The correct probe should be VZV gB probe CGCGGTCCCAAGTCCCTGGA. Thus, the sentence on page 250 should read: “A 70 nucleotide segment of the gB region was amplified and detected by the use of primers VZVgB F, TGCAGGGCATGGCTCAGT and VZVgB R, CCCAAGAACCACATGTCCAAC, and the probe VZVgB P, CGCGGTCCCAAGTCCCTGGA.” The authors would like to apologise for any inconvenience this may have caused to the readers of the journal.
DOI of original article:10.1016/j.jcv.2009.07.014. ∗ Corresponding author. Tel.: +46 31 3434473; fax: +46 31 847813. E-mail address: [email protected] (A. Persson). 1386-6532/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2009.11.025