Cortical-sparing adrenalectomy for patients with bilateral pheochromocytoma

Cortical-sparing adrenalectomy for patients with bilateral pheochromocytoma Jeffrey E. Lee, MD, Steven A. Curley, MD, Robert F. Gagel, MD, Douglas B. Evans, MD, and Robert C. Hickey, MD, Houston, Texas

Background. Bilateral pheochromocytomas are common in patients with multiple endocrine neoplasia type 2 (MEN 2) and von Hippel-Lindau disease (VHL). In an effort to avoid long-teyvn steroid dependence and Addisonian crisis, we have perJormed cortical-sparing adrenalectomy in this patient population. Methods. Retrospective chart review was completedfor patients with MEN 2- or VItL-related pheochromocytomas who underwent laparotomy at our institution for intended cortical-sparing adrenalectomy betweenJune 1965 and March 1995. Results. Fifteen patients (MEN 2A [10], MEN 2B [2], VHL [3]) underwent laparotomy for cortical-sparing adrenalectomy. None of the tumors were malignant. Cortical-sparing adrenalectomy was possible in 14 (93%). Thirteen of these 14 patients (93%) had normal postoperative plasma co,r measurements and did not require steroid hormone supplementation. At a median foUow-up of 138 months, two patients had died of metastatic medullary thyroid cancer, no patient had suffered Addisonian crisis, and three patients (21%) had recurrent pheochromocytomas (at 118, 1 76, and 324 months after operation). The remaining nine patients were alive without pheochromocytomas. Conclusions. Cortical-sparing adrenalectomy can be performed successfully in MEN 2 or VHL patients with bilateral pheochromocytomas, avoiding chronic steroid hormone replacement and the risk of Addisonian crisis in most patients. Long-term follow-up is necessary because recurrence may develop many years after operation. (Surgery 1996;120:1064-71.) From the Departments of Surgical Oncology and Medical Specialties, Section of Endocrinology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas

PHEOCHROMOCYFOMAS ARE. COMMON in patients with multiple e n d o c r i n e neoplasia type 2 (MEN 2) 1, 2 or von Hippel-Lindau disease (VHL).I, 3 MEN 2 patients with p h e o c h r o m o c y t o m a s uniformly have bilateral disease at the cellular level even if this is n o t clinically a p p a r e n t on presentation. 4 Clinical evidence of bilateral pheochromocytomas will develop in approximately 50% of MEN 2 patients within 10 years after surgical resection o f a unilateral pheochromocytoma. 5, 6 In VHL patients with p h e o c h r o m o c y t o m a s the incidence of clinical bilateral gland involvement is approximately 40% to 60%.3' 7 Bilateral total adrenalectomy has b e e n p r o p o s e d as an app r o p r i a t e therapy tbr unilateral p h e o c h r o m o c y t o m a s in a MEN 2 gene carrier because that p r o c e d u r e may prevent the d e v e l o p m e n t of r e c u r r e n t p h e o c h r o m o cytomas, eliminating the risk o f catecholamine crisis or Presented at the Seventeenth Annual Meeting of the American Association of Endocrine Surgeons, Napa, CaliE,April 21-23, 1996. Reprint requests:Jeffrey E. Lee, MD, Department of Surgical Oncology, Box 106, The Universityof Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd.,Houston, TX Copyright 9 1996 by Mosby-YearBook, Inc. 0039-6060/96/$5.00 + 0 11/6/76607

1064

SURGERY

distant metastasis. 8'9 However, total adrenalectomy commits the patient to lifelong steroid h o r m o n e rep l a c e m e n t and the risk of Addisonian crisis; two deaths from Addisonian crisis after bilateral adrenalectomy for MEN 2-associated p h e o c h r o m o c y t o m a s have b e e n described.5, s0 F u r t h e r m o r e , the risk of malignant pheochromocytomas in patients with MEN 2 or VHL is low a n d k i n d r e d specific. 3' 21 Selective unilateral adrenalectomy with close follow-up for MEN 2 patients with unilateral p h e o c h r o m o c y t o m a s has n o t resulted in death from metastatic p h e o c h r o m o c y t o m a s or hypertensive crisis.5, 6 Finally, patients with MEN 2 or VHL often suffer substantial morbidity from other manifestations of their diseases and frequently u n d e r g o multiple surgical procedures; therefore m a i n t e n a n c e of e n d o g e n o u s adrenal cortical function for as long as possible is desirable. Previous anecdotal reports have d o c u m e n t e d the technical feasibility o f cortical-sparing adrenalectomy in patients with bilateral pheochromocytoma. 12-15 In an effort to avoid long-term steroid d e p e n d e n c e a n d the risk of Addisonian crisis, we have p e r f b r m e d corticalsparing subtotal adrenalectomy in MEN 2 a n d VHL patients with bilateral pheochromocytomas.

Lee et al.

Surgery Volume 120, Number 6

1065

T a b l e I. Results of postoperative cosyntropin stimulation after total and subtotal adrenalectomy for bilateral pheochromocytoma Plasma cortisol (mg/dl) Patient no.

1 2 3 4 5 6 7 8 9 10

Operation

Total Subtotal Subtotal Subtotal Subtotal Subtotal Subtotal Subtotal Subtotal Subtotal

Steroids required

Yes Yes No No No No No No No No

Basal

15 rain

30 min

45 min

60 min

2.2 10 7.8 15 9 8.7 5 14.9 12 17

1.4 11 ND 17 11 ND 11 16.8 15 17

1.4 11 13 20 13 14.4 14 17.2 17 20

1.2 11 ND 18 13 ND 15 19.4 21 25

2 11 11 23 15 17.4 16 16.3 21 20

ND, Not done.

PATIENTS AND METHODS Patients. We p e r f o r m e d a retrospective chart review for 15 patients with MEN 2- or VHL-associated pheochromocytomas who u n d e r w e n t laparotomies at o u r institution for i n t e n d e d cortical-sparing adrenalectomy between J u n e 1965 a n d March 1995. Patients were m o n i t o r e d after o p e r a t i o n until either death or study c o m p l e t i o n (October 1995) with interval physical examinations, chest radiographs, and 24-hour urine collection for catecholamines. Additional evaluation in these patients was dictated by the presence of coexisting disease (usually medullary thyroid carcinoma [MTC] in patients with MEN 2). All patients had preoperative elevation of levels of urinary fractionated or total catecholamines a n d / o r catecholamine metabolites. A bilateral pheochromocytoma was documented by histopathologic examination of the resected specimens. Recurrence of a pheochromocytoma was identified by the development of elevated urinary catecholamines and documented by the presence of a mass in the adrenal b e d on radiographic imaging. Postoperative adrenal function was evaluated in all patients by d e t e r m i n a t i o n of m o r n i n g plasma cortisol level. T e n patients were also evaluated for postoperative adrenal cortical reserve by m e a s u r e m e n t of their responses to cosyntropin administration. Blood was drawn from these patients for plasma cortisol d e t e r m i n a t i o n before a n d after administration of 0.25 m g cosyntropin. Patients were considered to have adequate adrenal cortisol reserve if the plasma cortisol rose to an absolute level at or greater than 18 m g / d l or d e m o n s t r a t e d a rise of 7 m g / d l or m o r e over baseline within 60 minutes after cosyntropin administration. Determination of RET mutations. PET protooncogene analysis was performed on peripheral blood or minor DNA obtained from MEN 2 patients under approved institutional

protocols. DNA was isolated from peripheral blood samples by automated extraction (Applied Biosciences DNA extractor, model 341; Foster City, CA). DNA was isolated from frozen tumor or paraffin blocks by microwave-based exU'action. Exons 10, 11, 13, and 16 of the RETprotooncogene were amplified as previously described. 16 Polyrnerase chain reactions were performed with the following primer pairs: Exon 10

7F 7R

Exon 11

llIF 11ER

Exon 13

13F2 13IR

Lxon 16

fRET 16 fRET 16

GCC.CCCCAGGAGC,CTGAGTC CGTGGTGGTCCCGGCCGCC GACAC~GGCTGGAGAGC CACCGAGACGATGAAGGAGA CTCTCTGTCTGAACIT~ AGAACA~TGTATGGAGC AC,C ~ A T A ~ CT~TFC TAACCTCCACCCCAAGAGAG

Direct DNA sequencing o f polymerase chain reaction products was p e r f o r m e d with a modification of the standard Sequenase protocol (U.S. Biochemicals, Cleveland, O H ) . 16 Exon 10 a n d 11 mutations (codons 609, 611,618, 620, 634) were identified by direct sequencing a n d confirmed by restriction analysis. A p p r o p r i a t e positive a n d negative controls were included in each amplification a n d restriction analysis.

RESULTS P a t i e n t characteristics. T h e eight m e n a n d seven w o m e n included 10 patients with MEN 2A, two with

1066

Lee et al.

Surgery December 1996

30

25

"6 15 m

m

|

m

10

v

v i

i

i

i

15

30

45

60

Time (min) Hg. 1. Cosyntropin stimulation test results in selected patients "after total and subtotal adrenalectomies for bilateral pheochromocytomas. Patient 1 ( 9 underwent total adrenalectomy. Patient 2 (m) underwent subtotal adrenalectomy but required postoperative steroid hormone replacement. Patients 8 (A) and 9 (O) undex-went subtotal adrenalectomies and did not require postoperative steroid hormone replacement. T a b l e II. RET mutations in patients with MEN 2A and bilateral pheochromocytomas Kindred

Patient no.

R/s mutation

1

9 1 11 12 5 13 10 7

634 TGC--->CGC (Cys--+Arg)

2

3 4

634 TGC-->CGC (Cys-+Arg)

634 TGC--->CGC (Cys---~Arg) 634 TGC--~CGC (Cys--~Arg)

MEN 2B, and three with VHL. The median age at which cortical-sparing adrenalectomy was performed was 36 years (range, 15 to 61 years). Presentation. Twelve patients presented with synchronous bilateral pheochromocytomas. Three patients presented with metachronous contralateral pheochromocytomas 26, 96, and 139 months after unilateral adrenalectomy; all three underwent subtotal resection of the remaining adrenal gland. T u m o r characteristics. Median tumor size was 3.3 cm (range, 0.5 to 9.0 cm). None of the tumors were malignant by standard histopathologic or clinical criteria; no patient had a metastatic p h e o c h r o m o c y t o m a during follow-up. There was no history of malignant pheochromocytomas in any of the MEN 2A, MEN 2B, or VHL kindreds in this study. Surgical procedure. An open anterior approach to

the adrenal glands was pertbrmed in all patients, and all patients received perioperative steroid h o r m o n e coverage. Cortical-sparing adrenalectomy was possible in 14 of 15 (93%) patients; one patient had mnltifocal pheochromocytoma on intraoperative evaluation and underwent total adrenalectomy. Cortical-sparing was accomplished on the right side in three patients, on the left side in nine patients, and bilaterally in two patients. Median operative blood losswas 400 ml (range, 150 to 1500 ml). No perioperative deaths occurred. Perioperative morbidity occurred in two patients; one patient had postoperative pneumonia, and a second patient had a superficial wound infection. Postoperative adrenal cortical function. Thirteen of 15 patients had normal postoperative plasma cortisol measurements and did not require steroid h o r m o n e supplementation. The one patient who underwent completion adrenalectomy for the intraoperative finding of a multifocal p h e o c h r o m o c y t o m a had a low basal cortisol level, did not respond to cosyntropin stimulation, and required postoperative steroid h o r m o n e replacement. A second patient r e q u i r e d postoperative steroid h o r m o n e replacement for symptoms of adrenal insufficiency despite having undergone a subtotal adrenalectomy with intended cortical sparing. Adrenal insufficiency in this patient was manifested by weakness, low-grade fever, abdominal pain, diarrhea, and hyperpigmentation. These signs and symptoms responded to steroid h o r m o n e replacement. Although this patient's morning plasma cortisol level off steroid h o r m o n e

Surgery Volume 120, Number 6

Lee et al.

1067

T a b l e I l L Incidence o f malignant p h e o c h r o m o c y t o m a in patients with MEN 2

First author Casanova Lairmore Neumann Vasen Oishi Gagel Jansson Shapiro van Heerden Tibblin Lips Wilson Total

Institution/Country U. Paris Washington U. U. Freiburg Netherlands Kumamoto U. Tufts U. U. Goteborg U. Michigan Mayo Clinic U. Lund Netherlands MDA

Reference no.

Year

11 5 1 21 22 6 8 23 9 19 4 24

1993 1993 1993 1992 1990 1988 1988 1985 1984 1983 1981 1978

Total pheochromocytomas (n) *

Malignant pheochromocytomas (n)

100 58 24 8 82t 8 9 35 17 18 20 8 387

3 0 0 0 4 0 0 3 3 0 0 2 15 (3.9%)

U., University; MDA, M. D. Anderson Cancer Center. *Total number of patients reported with pheochromocytoma and MEN 2. tIneludes one patient with extraadrenal pheochromocytoma reported.

T a b l e IV. Incidence of malignant p h e o c h r o m o c y t o m a in patients with VHL

First author

Institution~Country

Richard Aprill Neumann Green Atuk Horton Total

France National Naval Medical Center U. Freiburg U. Newfoundland U. Virginia National Institutes of Health

Reference number Year 3 25 1 7 17 18

1994 1994 1993 1986 1979 1976

Pheochromocytomas Malignant pheochromocytomas (n) * (n) 36t 4 43 20 13 5 121

3 0 0 1 0 0 4 (3.3%)

U., University. *Total no. of patients reported with pheochromocytoma and VHL. tlncludes three patients with extraadrenal pheochromocytoma reported.

r e p l a c e m e n t was within the n o r m a l range, he h a d a flat response to cosyntropin administration (patient 2; Table I and Fig. 1). O f eight additional patients evaluated for adrenal cortical resmwe by cosyntropin administration, six h a d n o r m a l responses of plasma cortisol, a n d two had b o r d e r l i n e increases (Table 1, Fig. 1). None o f these eight patients r e q u i r e d chronic steroid h o r m o n e supplementation. Recurrence. Median follow-up was 138 m o n t h s (range, 7 to 331 months). No patient suffered Addisonian crisis. T h r e e patients (21%) h a d r e c u r r e n t pheochromocytomas. Recurrences were identified 118, 176, and 324 m o n t h s after adrenalectomy. Two o f three patients have u n d e r g o n e resection o f their r e c u r r e n t tumors. Recurrence was on the side o f subtotal adrenalectomy in two patients a n d on the side of r e p o r t e d total adrenalectomy in the third patient. Two o f the patients who suffered recurrences were m e m b e r s of the same MEN 2A kindred. At study completion nine patients were alive without clinical or biochemical evi-

dence o f pheochromocytomas. Median follow-up o f these nine patients was 90 months. M o r b i d i t y and mortality. All 12 patients with MEN 2 had MTC, and 6 of 12 patients h a d distant metastases. Two patients with MEN 2 d i e d o f metastatic MTC; neither o f these patients had suffered recurrence o f pheoc h r o m o c y t o m a at the time of death. O n e patient with VHL u n d e r w e n t craniotomy for resection o f a meningioma. RE/" mutations. Information on RET mutations was available from representatives o f four separate MEN 2A kindreds, accounting for 8 o f the 10 MEN 2A patients r e p o r t e d here (Table II). In all f o u r kindreds the point m u t a t i o n identified was a c o d o n 634 TGC--+CGC (Cys-,Arg).

DISCUSSION Pheochromocytomas are c o m m o n in patients with MEN 2A, MEN 2B, a n d VHL. A p h e o c h r o m o c y t o m a will develop in 30% to 50% of patients with MEN 2 as man-

1068

Lee et al.

Surgery December 1996

T a b l e V. Results of unilateral adrenalectomy for p h e o c h r o m o c y t o m a in patients with MEN 2

No. of patients P~culre~'lt

First author Institution~Country Lairmore Gagel Jansson Tibblin Lips Total

Washington U. Tufts U. u. Goteborg U. Lund Netherlands

Reference number Year 5 6 8 19 4

1993 1988 1988 1983 1981

Malignant pheochromocytomas Died during pheochromocytomas Follow-up (yr) (%) follow-up

n 26 8 9 13 4 60

9 11 8 7 4 8.4*

12 (46) 4 (50) 1 (11) 4 (31) 4 (100) 25 (42)

0 0 0 0 0 0

U, University. *Weighed average.

T a b l e VI. Results of bilateral total adrenalectomy for p h e o c h r o m o c y t o m a in patients with MEN 2

No. of patients Deaths caused Reference Follow-up Malignant Addisonian by Addisonian F~curfent First author Institution~Country no. Year n (yr) pheochromocytomas crisis crisis pheoehromocyWmas van Heerden Mayo Clinic Lairmore Washington U. TeleniusKuwait Berg Total

9 5 10

1994 17 1993 43 1989 26 86

10 9.4 6 8.5*

1 0 NR

0 10 9

0 1 1

1 0 NR

1 (2%)

19 (22%)

2 (2%)

1 (2%)

U,, University; NR, not reported. *Weighted average.

T a b l e VII. Results of bilateral subtotal adrenalectomy for p h e o c h r o m o c y t o m a in patients with familial pheochromocytoma

First author

Institution

Reference no.

Year

n

Follow-up (yr)

Steroid requirement

Lee Albanese Hamberger van Heerden Irvin Total

MDA U. Pittsburgh Karolinska Hospital Mayo Clinic U. Miami

Present series 12 13 9 15

1996 1992 1987 1984 1983

14 4 2 3 2 25

11.5 6 2; 3 mo 10 7, 3 9*

1 0 0 1 0 2 (8%)

Cosynt,vpin test Abnormal NR Abnormal Abnormal NR Abnormal

3/9 2/2 0/1 5/12 (42%)

Recurrence 3 0 0 2 0 5 (20%)

/Z, University. *Weighted average.

ifested by clinical or biochemical evidence of catecholamine hypersecretion. 1' 2, 4, g A p h e o c h r o m o c y t o m a will develop in approximately 10% to 19% of patients with VHL; in some VHL kindreds nearly 100% have pheochromocytomas.l, 3, 7, 17, 18 Malignant p h e o c h r o m o c y t o m a s are very rare in patients with MEN 2 or VHL. T h e overall rate of malignant p h e o c h r o m o c y t o m a s was only 3.9 % in 12 series including a total of 387 MEN 2 patients (Table III). For VHL patients the rate of malignant p h e o c h r o m o c y t o m a s was 3.3% in six series including a total of 121 patients (Table IV). Also the risk for d e v e l o p m e n t of a malignant p h e o c h r o m o c y t o m a in MEN 2 or VHL is usually kin-

d r e d specific, 3' 11 making malignancy extremely unlikely in the absence of a positive family history. M a n a g e m e n t o f a p h e o c h r o m o c y t o m a in the patient with MEN 2 or VHL is complicated by the morbidity associated with o t h e r manifestations of these diseases. Virtually all patients with MEN 2 have MTC; o t h e r series have d o c u m e n t e d that patients with MEN 2 a n d pheochromocytomas often suffer from the clinical consequences o f MTC, including morbidity and death from metastatic MTC. 6, m Patients with VHL may suffer morbidity from retinal hemangiomas, cerebellar hem a n g i o m a s and hemangioblastomas, a n d renal cell carcinomas. 18 Patients with MEN 2 or VHL often

Surgery Volume 120, Number 6

undergo multiple sequential surgical procedures and receive multiagent chemotherapy; morbidity from bilateral adrenalectomy may significantly increase the complexity of therapy in these patients. The safety of selective unilateral adrenalectomy for MEN 2 patients with unilateral disease is well documented (Table V). Although up to half of all patients who undergo a unilateral adrenalectomy may eventually require a second operation for a contralateral pheochromocytoma, this may not occur for many years, during which time the patient will not be steroid dependent. No MEN 2 patient who has undergone unilateral adrenalectomy has been reported to have died of catecholamine crisis, all those who have had contralateral disease have been successfully treated, and no patient has had a metastatic pheochromocytoma. Subtotal cortical-sparing adrenalectomy represents a potential treatment alternative for MEN 2 or VHL patents with bilateral pheochromocytomas because this procedure may avoid the need for steroid hormone replacement and the risk of Addisonian crisis (Table VI) in a group of patients at relatively low risk for morbidity from recurrent pheochromocytomas but at relatively high risk for morbidity from other manifestations of their diseases. The technique of subtotal adrenalectomy, in which the surgeon leaves a small amount of vascularized cortical tissue unilaterally 12' 13, 15 or bilaterally14 after tumor removal, has been previously described (Table VII). We report here our experience with bilateral subtotal adrenalectomy in patients with MEN 2 or VHL and bilateral pheochromocytomas. Most patients in our series had successful cortical-sparing procedures, demonstrated by the absence of a requirement for steroid hormone supplementation and the absence of Addisonian crisis. The incidence of recurrent pheochromocytomas seen here after subtotal adrenalectomy (21% after a median follow-up of 11.5 years) is lower than that alter unilateral adrenalectomy for clinically unilateral disease (Table V, overall approximately 42% after 8.4 years). Time to recurrence after subtotal adrenalectomy is similar to time to development of contralateral disease after unilateral adrenalectomy. Similar to the experience with selective unilateral adrenalectomy, no patient suffered from hypertensive crisis or metastatic pheochromocytoma after corticalsparing adrenalectomy. Recurrences were anatomically amenable to surgical resection in the two patients deemed candidates for surgical resection. Interestingly, one of the three recurrences in this series developed on the side of reported total adrenalectomy. Intraoperative findings and histopathologic evaluation of the resected recurrence revealed that a small amount of adrenal tissue had been left behind despite the referring surgeon's impression of a complete resection. This clinical event corroborates a report of residual adrenal cortical func-

Lee et al.

1069

tion in some patients who undergo supposed bilateral total adrenalectomy. 2~ We examined nine patients who had undergone subtotal adrenalectomy for adrenal cortical reserve by cosyntropin stimulation (Table I, Fig. 1). A single patient in our series who underwent subtotal adrenalectomy had evidence for residual cortical function but had inadequate adrenal cortical reserve documented by a flat response to cosyntropin administration. This patient had clinical evidence for a mild degree of adrenal insufficiency and required chronic steroid hormone supplementation. Two additional patients had borderline responses to cosyntropin administration, although these patients had no clinical requirement for chronic steroid hormone administration. Previous anecdotal reports have documented abnormal responses to cosyntropin in some patients who undergo intended cortical-sparing subtotal adrenalectomy (Table VII).9' 13 Our results confirm that patients may have some degree of diminished adrenal cortical reserve after a subtotal adrenalectomy. We recommend cosyntropin testing in all patients who undergo a subtotal adrenalectomy approximately 1 month after operation. An equivocal response to initial testing necessitates retesting after an interval of 3 to 12 months to document return of adequate adrenal reserve. In those patients in whom adrenal reserve appears marginal, supplemental doses of steroids should be administered during acute illness and when patients undergo general anesthesia for major operative procedures. We found the uniform presence of a cystine to arginine mutation at position 634 in the RET protooncogene in MEN 2A patients with bilateral pheochromocytomas. It is possible that this mutation is relatively specific for the development of pheochromocytomas, bilateral pheochromocytomas, or benign pheochromocytomas in patients with MEN 2A. However, the exclusion of patients with unilateral pheochromocytomas from this series and the absence of malignant pheochromocytomas in our patient population prevent a firm conclusion regarding the influence of this RET mutation on the development of pheochromocytomas in MEN 2 patients. Our current operative strategy for the MEN 2 or VHL patient with a bilateral pheochromocytoma uses an open anterior transabdominal approach. We do not recommend a bilateral posterior approach if a subtotal adrenalectomy is planned because of limited exposure and the resulting difficulty in preserving vascularized cortical tissue. We have not performed a laparoscopic subtotal adrenalectomy, yet this remains theoretically possible with the development of advanced techniques for intracorporeal suturing and retraction. When performed by laparotomy, the side for subtotal adrenalectomy is chosen and subtotal adrenalectomy is per-

1070

Lee et al.

t b r m e d b e f o r e total a d r e n a l e c t o m y o n t h e o p p o s i t e side. T h i s allows a s e c o n d a t t e m p t at s u b t o t a l a d r e n a l e c t o m y if the first a t t e m p t results in d e v a s c u l a r i z a t i o n of the adrenal remnant. A l t h o u g h we believe o u r d a t a s u p p o r t bilateral subtotal a d r e n a l e c t o m y for p a t i e n t s w i t h M E N 2 o r V H L a n d bilateral p h e o c h r o m o c y t o m a s , this r e c o m m e n d a t i o n m a y w a r r a n t m o d i f i c a t i o n in a p a t i e n t w h o s e family m e m b e r s have h a d aggressive ( b i o c h e m i c a U y o r o n t o logically) bilateral a d r e n a l m e d u l l a r y disease. T h e rec u r r e n c e o f p h e o c h r o m o c y t o m a s after s u b t o t a l a d r e n a l e c t o m y in two p a t i e n t s f r o m t h e s a m e M E N 2 k i n d r e d in this series r e i n f o r c e s t h e n e e d to individualize surgical strategy in t h e s e p a t i e n t s b a s e d in p a r t o n k i n d r e d n a t u r a l history. We thank Pamela N. Schultz and Sangeeta Khorana for RET protooncogene analysis.

REFERENCES 1. Neumann HPH, Berger, DP, Sigmund G, et al. Pheochromocytomas, multiple endocrine neoptasia type 2, and yon HippelLindan disease. New EnglJ Med 1993;329:1531-8. 2. Evans DB, Lee JE, Merrell RC, Hickey RC. Adrenal medullary disease in multiple endocrine neoplasia type .2: appropriate management. Endocrinol Metab Clin North Am 1994;23:167-76. 3. Richard S, Beigelman C, Duclos,J-M, et al. Pheochromocytoma as the first manifestation of yon Hippel-Lindau disease. Surgery 1994;116:1076-81. 4. Lips KJM, VanDerSluys Veer j, Alleman AD, et al. Bilateral occurrence of pheochromocytoma in patients with the multiple endocrine neoplasia syndrome type 2 A (Sipple's syndrome). Am J Med 1981;70:1051-60. 5. Lairmore TC, Ball DW, Baylin SB, Wells SA. Management of pheochromocytomas in patients with multiple endocrine neoplasia type 2 syndromes. Ann Surg 1993;217:595-603. 6. Gagel RF, Tashjian AH, Cummings T, et at. The clinical outcome of prospective screening for multiple endocrine neoplasia type 2a: an 18-year experience. N EnglJ Med 1988;318:478-84. 7. Green,JS, Bowmer, MI,Johnson, GJ. Von Hippel-Lindau disease in a Newfoundland kindred. Can Med AssocJ 1986;134:133-46. 8.Jansson S, Tisell LE, Fjalling M, Lindberg S, Jacobsson L, Zachrisson BF. Early diagnosis of and surgical strategy for adrenal medullary disease in MEN 2 gene carriers. Surgery 1988;103:11-8. 9. van Heerden JA, Sizemore GW, CarneyJA, Grant CS, ReMine WH, Sheps SG. Surgical management of the adrenal glands in the multiple endocrine neoplasia type II syndrome. World J Surg 1984;8:612-21. 10. Telenius-Berg M, Ponder MA, Berg B, Ponder BAJ, Werner S. Quality of life after bilateral adrenalectomy in MEN 2. Henry Ford Hosp MedJ 1989;37:160-3. 11. Casanova S, Rosenberg-Bourgin M, Farkas D, Calmettes C, et al. Phaeochromocytoma in multiple endocrine neoplasia type 2 A: survey of 100 cases. Clin Endocrinol (Oxf) 1993;38:531-7. 12. Albanese CT, Wiener ES. Routine total bilateral adrenalectomy is not warranted in childhood familial pheochromocytoma.JPediatr Surg 1993;28:1248-52. 13. Hamberger B, Telenius-Berg M, Cederrnark B, Grondal S, Hansson B-G, Werner S. Subtotal adrenalectomy in multiple endocrine neoplasia type 2. Henry Ford Hosp MedJ 1987;35:127-8. 14. van HeerdenJA, Sizemore GW, CarneyJA, Brennan MD, Sheps SG. Bilateral subtotal adrenal resection for bilateral pheochro-

Surgery December 1996 mocytomas in multiple endocrine neoplasia, type 2a: a case report. Surgery 1985;98:363-6. 15. Irvin GL, Fishman LM, Sher JA. Familial pheochromocytoma. Surgery 1983;94:93840. 16. Khorana S, Gagel RF, Cote GJ. Direct sequencing of PCR products in agarose gel slices. Nucleic Acids Res 1994;22:3425-6. 17. Atuk NO, McDonald T, Wood T, et al. Familial pheochromocytoma, hypercalcemia, and yon Hippel-Lindan disease: a ten year study of a large family. Medicine (Baltimore) 1979;58:209-18. 18. Horton WA, Wong V, Eldridge R. Von Hippel-Lindan disease: clinical and pathological manifestations in nine families with 50 affected members. Arch Intern Med 1976;136:769-77. 19. Tibblin S, DymlingJ-F,Ingemansson S, et al. Unilateral versus bilateral adrenalectomy in multiple endocrine neoplasia IIA. WorldJ Surg 1983;7:201-8. 20. Chalmers RA, Mashiter K, Joplin GF. Residual adrenal cortical fimction after bilateral "total" adrenalectomy for Cushing's disease. Lancet 1981;2:1196-9. 21. Vasen HFA, van der Feltz M, Raue F, et al. The natural course of multiple endocrine neoplasia type I1B. Arch Intern Med 1992; 152:1250-2. 22. Oishi S, Sasaki M, YamauchiJ, Umeda T, Sato T. Analysisof eight Sipple's syndrome patients and review of eighty-two cases from the Japanese literatm'e. Jpn J Clin Oncol 1990;20:392-406. 23. Shapiro B, CoppJE, SissonJC, Eyre PL, WallisJ, BeierwaltesWH. Iodine-131 metaiodobenzylguanidine for the locating of suspected pheochromocytoma: experience in 400 cases.J Nucl Med 1985;26:576-85. 24. Wilson RA, lbanez ML. A comparative study of 14 cases of tamilial and nonfamilial pheochromocytomas. Hmn Pathol 1978; 9:181-8. 25. April BS, Drake AJ, Lasseter DH, Mohamed Shakir KM. Silent adrenal nodules in yon HippeI-Lindau disease suggest pheochromocytoma. Ann Intern Med 1994;120:485-7.

DISCUSSION Dr. Janice L. Pasieka (Calgary, Alberta, Canada). Do you give these patients perioperative stress-dose steroids? For how long? Dr. Lee. We administer stress doses of steroid h o r m o n e s perioperatively to all patients. Steroids are tapered within 2 weeks after operation. Patients are then monitored offsteroids for signs or symptoms of adrenal insufficiency. Cosyntropin testing is pertbrmed approximately 1 m o n t h after operation. An equivocal response to initial cosyntropin testing results in retesting after an interval of 3 to 12 months. Those patients with overt signs or symptoms of adrenal insufficiency receive replacement doses of steroid hormones. Those patients with marginal adrenal reserve by cosyntropin testing receive supplemental doses of steroids during acute illness and when they undergo general anesthesia for major operative procedures. Dr, Bertil Hamberger (Stockholm, Sweden). Your experience is very interesting because you have such a long followup. We also have performed subtotal adrenalectomy in this patient population and have several patients who are more than 5 years out; however, only three o f our patients do not require steroid h o r m o n e supplementation. Perhaps we have been more radical with our adrenalectomies. I believe that one needs to try to preserve at least 20% of the adrenal gland to avoid adrenal insufficiency. What has been your experience? How much cortical tissue do you think must be left to prevent adrenal insufficiency?

Surgery Volume 120, Number 6

Dr. Lee. This series goes back over 30 years, and accurate documentation regarding the size or fraction of the adrenal remnant was not available for many of our cases. We were unable to identify a clear correlation between the size of the adrenal r e m n a n t and the presence or degree of adrenal insufficiency, if any. The procedure we perform is more than an enucleation but less than a total adrenalectomy. We attempt to preserve the major adrenal venous drainage; however, this is not possible in many cases. We mobilize most of the adrenal gland, generally with the exception of its most cephalad portion. We then resect the tumor along with a rim of grossly normal adrenal tissue, leaving a portion of vascularized adrenal tissue behind. We emphasize that in a bilateral operation it is helpful to choose the side for cortical sparing at the beginning of the operation and perform subtotal adrenalectomy on that side first. T h e n if one takes, for example, a bit too much adrenal tissue, encounters a bleeding problem, or devascularizes the adrenal remnant, one still has a second side on which to attempt cortical sparing. Dr. Lawrence A. Danto (Davis, CA). Do you have any experience with cortical autotransplantation? I have tried a couple and have been disappointed. Dr. Lee. We have also been unsuccessful with adrenal cortical autotransplantation. The only successful cases of adrenal cortical autografts reported have been performed with hyperplastic adrenal cortical tissue in patients with Cushing's disease

Lee et al.

1071

(Arch Intern Med 1967;120:185-92; Surg Clin North Am 1979;59:159-65). Dr. Norman W. T h o m p s o n (Ann Arbor, MI). We have seen a couple of recurrences after this procedure had been done elsewhere. There were multiple implantations of pheochromocytoma with the recurrences. The adrenal tissue that you leave may look normal, but the medulla is really hyperplastic and any of its cells can potentially form a new pheochromocytoma. What were your recurrences like? Do you take any precautions during operation to prevent seeding? Clinically, how do you follow these MEN 2 patients who often d o n ' t have hypertension because their pheochromocytomas secrete epinephrine rather than norepinephrine? Dr. Lee. In answer to your first question, two of our three patients who had recurrences underwent resection of their recurrent pheochromocytomas. In each of these two cases the recurrences were anatomically localized and were amenable to surgical resection. Neither patient had a multifocal recurrence. Our third patient with recurrence had advanced metastatic MTC and was not considered a candidate for surgical resection. In answer to your second question, I believe the best guard against the potential risk of intraoperative seeding and multifocal recurrence is to perform an anatomic operation at the outset. In answer to your last question, these patients are screened annually with 24-hour urine collections for fractionated catecholamines.