Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells☆

ARTICLE IN PRESS Molecular and Cellular Endocrinology ■■ (2014) ■■–■■

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / m c e

Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells ☆ Bernard P. Schimmer *, Martha Cordova University of Toronto, Toronto, ON M5G 1L6, Canada

A R T I C L E

I N F O

Article history: Received 7 August 2014 Received in revised form 18 September 2014 Accepted 24 September 2014 Available online Keywords: RNA processing Splicing factors GNAS Cd151 Dab2 Tia1

A B S T R A C T

The stimulatory effect of ACTH on gene expression is well documented and is thought to be a major mechanism by which ACTH maintains the functional and structural integrity of the gland. Previously, we showed that ACTH regulates the accumulation of over 1200 transcripts in Y1 adrenal cells, including a cluster with functions in alternative splicing of RNA. On this basis, we postulated that some of the effects of ACTH on the transcription landscape of Y1 cells are mediated by alternative splicing. In this study, we demonstrate that ACTH regulates the alternative splicing of four transcripts – Gnas, Cd151, Dab2 and Tia1. Inasmuch as alternative splicing potentially affects transcripts from more than two-thirds of the mouse genome, we suggest that these findings are representative of a genome-wide effect of ACTH that impacts on the mRNA and protein composition of the adrenal cortex. © 2014 Elsevier Ireland Ltd. All rights reserved.

1. Introduction The pituitary hormone ACTH is the major physiological regulator of glucocorticoid production in the adrenal cortex. The hormone acts acutely to mobilize cholesterol and transport it to inner mitochondrial membranes where it is metabolized by CYP11A1 (the cholesterol side-chain cleavage enzyme) to pregnenolone, the first enzymatic step in the steroid hormone biosynthetic pathway. ACTH also regulates the synthesis of the enzymes important for steroid hormone biosynthesis, and stimulates adrenal cell proliferation and renewal, thereby maintaining the structural and functional integrity of the gland. These latter changes generally occur over many hours and generally reflect effects on gene transcription (Rainey et al., 2004; Schimmer and Parker, 2005; Sewer et al., 2007). In addition, ACTH affects the accumulation of a large number of transcripts not obviously linked to adrenocortical function, as evidenced by genome-wide studies of ACTH action in different adrenal cell models (Hazard et al., 2008; Lee and Widmaier, 2005; Schimmer

Abbreviations: Ang II, angiotensin II; hnRNP, heterogeneous nuclear ribonucleoprotein; SR, serine/arginine-rich; PMA, phorbol myristic acid. ☆ Keith L. Parker Memorial Lecture. * Corresponding author. C. H. Best Institute, University of Toronto, 112 College St., Toronto, ON M5G 1L6, Canada. Tel.: +1 416 978-6088; fax: +1 416 978 6088. E-mail address: [email protected] (B.P. Schimmer).

et al., 2006, 2007). Among these is a set of 39 down-regulated transcripts with functions in alternative splicing of RNA (Schimmer et al., 2006). Alternative RNA splicing affects a wide range of biological activities (Stamm et al., 2005) and plays important roles in differentiation, development, cell proliferation, cell death and human disease (for brief review see Pan et al., 2004). In the adrenal cortex, splice variants of the type 1 human AII receptor have been identified and proposed to modulate adrenal responses to AII (Martin et al., 2001) whereas splice variants GHRH receptor have been identified and postulated to play a role in adrenal carcinogenesis (Freddi et al., 2005). Otherwise, little else is known about the role of alternative splicing in the adrenal cortex or the factors that regulate it. In the present study, we have examined the effects of ACTH on the accumulation of several transcripts with functions in alternative splicing to confirm our previous microarray study and have directly tested the hypothesis that ACTH regulates alternative splicing of RNA by examining the effects of ACTH on four different transcripts – Gnas, Cd151, Dab2 and Tia1. We demonstrate that these four transcripts are alternatively spliced following chronic stimulation of Y1 adrenal cells with ACTH. Inasmuch as alternative splicing is thought to affect over two-thirds of both human and mouse genes (Stamm et al., 2005), our findings raise the possibility of a global effect of ACTH on alternative splicing that significantly affects the composition of transcripts expressed in the adrenal cortex.

http://dx.doi.org/10.1016/j.mce.2014.09.026 0303-7207/© 2014 Elsevier Ireland Ltd. All rights reserved.

Please cite this article in press as: Bernard P. Schimmer, Martha Cordova, Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells, Molecular and Cellular Endocrinology (2014), doi: 10.1016/j.mce.2014.09.026

ARTICLE IN PRESS B.P. Schimmer, M. Cordova/Molecular and Cellular Endocrinology ■■ (2014) ■■–■■

2

Table 1 Gene-specific oligonucleotides. Gene symbol

Gene name

Primers used for quantitative RT-PCR Srsf1 Serine/arginine splicing factor 1 Srsf2 Serine/arginine splicing factor 2 Tardbp TAR DNA-binding protein Hnrpa1 Heterogeneous nuclear binding protein A1 Hnrpa2/b1 Heterogeneous nuclear binding protein A2/B1 Magoh Mago–Nashi (Drosophila) homolog Snrbp2 Small nuclear ribonucleoprotein polypeptide B Tkt Transketolase Primers used for alternative splicing events CD151 Cluster of differentiation 151 Dab2 Disabled (Drosophola) homolog 2 Gnas Guanyl nucleotide binding protein, alpha stimulating (mouse) Guanyl nucleotide binding protein, GNASa alpha stimulating (human) Tia1 (exon 5) T-cell intracellular antigen 1 Tia 1 (exon 6_7) T-cell intracellular antigen 1 a

Forward primer

Reverse primer

NCBI accession number

CCGGGTTAAAGTTGATGGG CAAGTCCTCCTCGGTCTCC AAACTGGTCACTCGAAAGGG TTCATCCAGTCAGAGAGGTCG GACAAGAAATGCAGGAAGTCC TTCGGTCATGAGTTCCTGG GCTAATACCCAAGGCACTGC TTGCTAACATCCGAATGCC

TGGTGATCCTCTGCTTCTCC CTCTGTTAAGCCGCTTGCC CTTCTCAAAGGCTCGTCTGG TTAGAACCTCCTGCCACTGC TCTGCTCCTTCCACCATAGC GCCTCTTTCCTGATCATGACG CAAGCGAACTTCCTTGAATCC CGAGAAGGTGGAATTCTTGG

NM_173374 NM_011358 NM_145556 NM_001039129 NM_016806 NM_010760 NM_021335 NM_009388

GCCGAGCGTTCTCTGTACTC ATGTGTGTGGAGGTGAAGGC AAGGACAAGCAGGTCTACCG

AAGCAGCAGTTGTAGGTAAAGAGC TGTCTGAAGCAAGCAAGTCG TTCAATGGCCTCCTTCAGG

NM_009842 NM_023118 NM_201616

TAATACGACTCACTATAGGG

TAGAAGGCACAGTCGAGG

GAATGGGCGGAAGATAATGG AGTCCAGAAATCACAACCG

GTCTTCGGTTGTGATTTCTGG GTTCTGATTTGTCTTCCACC

NM_011585 NM_011585

Primers correspond to sequences within the PRNAT-CMV3.1/Neo vector flanking the GNAS minigene.

2. Materials and methods 2.1. Cells, cell culture and DNA-mediated gene transfer The origins and properties of the ACTH-responsive Y1 mouse and the H295R human adrenocortical tumor cell lines as well as the conditions for their propagation have been described previously (Rainey et al., 2004). For experimental manipulations, Y1 cells were plated at a density of 4 × 105 cells per 100 mm dish in Alpha Minimal Essential Medium supplemented with 15% heat-inactivated horse serum, 2.5% heat-inactivated fetal bovine serum, penicillin G sodium (200 U/ml) and streptomycin sulfate (200 μg/ml) and cultured for 3–4 days until cells reached approximately 40% confluence. DNA mediated gene transfer was carried out with super-coiled plasmid DNA (5–10 μg) using a high-efficiency calcium phosphate precipitation technique (Ausubel et al., 2007). Cells were exposed to the DNA-calcium phosphate precipitate for 24 h, rinsed and incubated for an additional 24 h before further treatment. Tissue culture medium, sera and G418 were purchased from Invitrogen Canada (Burlington, ON). 2.2. RNA isolation and RT-PCR amplification Total RNA was extracted from cells using a guanidine thiocyanate buffer and isolated by centrifugation of the extract through a cushion of 5.7 M CsCl as described previously (Chirgwin et al., 1979). Quantitative RT-PCR reactions were carried out as described previously (Schimmer et al., 2006). Essentially, total RNA (5 μg) was reverse transcribed with Superscript II™ (Invitrogen Canada) in 20 μl reactions containing oligo-dT 18 primer (100 pmol) according to the supplier’s instructions. Aliquots of the RT reaction (1 μl) were amplified over 40 cycles in 25 μl reactions containing gene-specific forward and reverse primers (5 pmol each) using Platinum SYBR Green qPCR SuperMix UDG™ (Invitrogen Canada) and the 7300 Real Time PCR System (Applied Biosystems, Foster City, CA). Each amplification cycle consisted of template denaturation at 95 °C for 15 s and primer annealing and extension at 60 °C for 60 s. In each experiment, transketolase mRNA was used as the reference standard to normalize transcript levels among samples and transcript concentrations were determined using the 2−ΔΔCt method (Livak and Schmittgen, 2001).

Alternative splicing events were evaluated by amplification of the cDNA prepared by RT-PCR (as described earlier) in the presence of Platinum Taq Polymerase (Invitrogen, Canada) and genespecific oligonucleotide primers; PCR cycle conditions are provided in the figure legends. The amplified products were separated by electrophoresis in agarose gels (from 1.0 to 2.5% depending on fragment size) in the presence of ethidium bromide and the fluorescent intensities of the ethidium-stained bands were quantitated by densitometry under conditions where the amounts of ethidiumstained product were proportional to cDNA input. The intensities of the stained products, adjusted for differences in fragment size (Glazer et al., 1990), were used to calculate the molar ratios of alternatively spliced products.

2.3. Oligonucleotides and plasmids Gene-specific oligonucleotides (detailed in Table 1) were synthesized by Invitrogen Canada. The human GNAS minigene, containing exons 2, 3 and 4 plus adjacent truncated intron sequences in the expression plasmid pcDNA3.1- was described previously (Pollard et al., 2002) and was a generous gift from Dr. Allison J. Tyson-Capper and Dr. G. Nicholas Europe-Finner (Newcastle University, Newcastle upon Tyne, UK).

3. Results 3.1. Effects of ACTH on transcripts with functions in alternative splicing In order to confirm our microarray data indicating that ACTH caused the down-regulation of transcripts associated with alternative splicing (Schimmer et al., 2006), we examined the effects of ACTH on the levels of several splicing factors by quantitative RTPCR (Fig. 1). The splicing factors chosen included those most affected by ACTH treatment in the previous microarray study. After treating Y1 cells with ACTH for 24 h, transcripts encoding the splicing enhancers Srsf1, Srsf2, and Tardbp, the splicing repressors Hnrpa1 and Hnrpa2b1, and a proposed regulator of pre-spliceosome formation Snrpb2, and were significantly reduced by 35–40%; the transcript encoding Magoh, a component of the exon junction complex, failed to show a statistically significant response to ACTH in these assays (Fig. 1).

Please cite this article in press as: Bernard P. Schimmer, Martha Cordova, Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells, Molecular and Cellular Endocrinology (2014), doi: 10.1016/j.mce.2014.09.026

ARTICLE IN PRESS B.P. Schimmer, M. Cordova/Molecular and Cellular Endocrinology ■■ (2014) ■■–■■

*

** ** ** *

*

Fig. 1. The effects of ACTH on the levels of transcripts encoding various splicing factors. Y1 mouse adrenocortical tumor cells were propagated and analyzed for specific transcripts by quantitative RT-PCR as described in Section 2. Cells were incubated for 24 h in fresh growth medium in the absence (black bars) or presence (white bars) of 15 nM ACTH1–24 (Organon Inc., West Orange, NJ) before RNA extraction. Results were compiled from five independent experiments. Statistical significance (*p < 0.05, **p < 0.01) was determined by the analysis of variance of log-transformed data (Bland and Altman, 1996), followed by the Bonferroni multiple comparison test.

3

3 (Pollard et al., 2002), we first evaluated whether the downregulation of these splicing factors by ACTH was reflected in the alternative splicing of Gnas in the Y1 mouse adrenal cell line. As determined using PCR primers from exons 2 and 4, Y1 cells expressed both exon 3-included and exon 3-excluded forms of the Gnas transcript; the larger transcript predominated and only very low levels of shorter form were detected (Fig. 2A). These findings are consistent with earlier observations demonstrating the predominance of the long form of Gnas in the plasma membranes of Y1 cells (Qiu et al., 1996; Schimmer and Tsao, 1990). Treating Y1 cells with ACTH (15 nM) for 24 h increased the accumulation of the short form of Gnas; however, the increase was modest and a correspondingly small decrease in the more abundant long form of the transcript was difficult to detect. To determine if this effect of ACTH on the short form of the Gnas transcript reflected alternative RNA splicing, we evaluated the effects of ACTH on a minigene containing exons 2, 3 and 4 from the human GNAS gene plus adjacent truncated intron sequences (Fig. 2B, Pollard et al., 2002). As shown in Fig. 2C and D, ACTH stimulated the accumulation of the shorter transcript 1.9fold at the expense of the larger transcript containing exon 3. This effect of ACTH was transient and reached statistical significance by 12 h but was lost by 36 h.

3.2. Alternative splicing of the transcript encoding Gnas

3.3. Alternative splicing of the transcripts encoding Cd151

Inasmuch as the splicing factors Srsf1 and Hnrpa1 have been shown to regulate the alternative splicing of GNAS (the α subunit of the stimulatory guanyl nucleotide binding protein) at coding exon

We next screened 75 transcripts (Appendix: Supplementary Table S1) selected randomly from a library of 3126 alternative splicing events (Pan et al., 2004) for ACTH-regulated alternative splicing

A)

B)

ACTH

pCDNA 3.1

Exon 3

Exon 2

Gnas-long

Exon 4

pCDNA 3.1

Exon 2 Exon 3 Exon 4

Gnas-short

Exon 2 Exon 4

+ Exon 3 – Exon 3 0

4

12

24

36

ACTH (h)

48

Excluded/Included

D)

C)

2.0

** 1.5

*

*

36

48

1.0 0.50

12

24

Time, h Fig. 2. Effects of ACTH on the alternative splicing of GNAS at exon 3. (A) Endogenous Gnas. Y1 cells were either untreated (−) or treated with ACTH (15 nM) for 24 h (+) and then were analyzed for alternative splicing of endogenous Gnas as described in Section 2 using gene-specific oligonucleotide primers (Table 1). PCR amplification was carried over 28 cycles; each cycle was comprised of 40 s at 94 °C, 40 s at 59 °C and 60 s at 72 °C. Samples then were incubated at 72 °C for 10 min. PCR products were sized using a 100 bp DNA ladder (Fermentas Canada Inc., Burlington, ON). A representative electrophoretogram is shown. (B) A schematic representation of the human GNAS minigene. Shown are the constant coding exons 2 and 4 (white bars), the alternatively spliced coding exon 3 (hatched bar), flanking intron sequences (thick lines), pcDNA3.1 vector (thin lines) and primers complementary to sequences in the vector pcDNA3.1- (arrows) that were used to amplify the products of the minigene. Schematic representations of the predicted alternatively spliced products are also shown. (C and D) Alternative splicing of GNAS. Total RNA was isolated from Y1 cells following transient transfection with the GNAS minigene and treatment with ACTH (15 nM) for the times indicated. Alternatively spliced products of the GNAS minigene, containing (+), or missing (–) exon 3, were analyzed as in panel (A) above; conditions for PCR were 94 °C, 40 s; 56 °C, 30 s; 70 °C, 60 s; for 25 cycles. The intensities of the ethidium bromide-stained bands were quantitated by densitometry and expressed as the molar ratio of the alternatively spliced transcripts. A representative electrophoretogram is shown in (C); the results averaged from three to seven independent experiments ± S.E. are shown in (D). Statistical significance (**p < 0.01 vs. untreated; *p < 0.05 vs. 12 h treatment) was determined by the Newman–Keuls multiple comparison post-hoc test.

Please cite this article in press as: Bernard P. Schimmer, Martha Cordova, Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells, Molecular and Cellular Endocrinology (2014), doi: 10.1016/j.mce.2014.09.026

ARTICLE IN PRESS B.P. Schimmer, M. Cordova/Molecular and Cellular Endocrinology ■■ (2014) ■■–■■

4

A)

B)

Exons

1

2 1 1

3

2

3

2

3

bp included

500 400 300 200

excluded 0

4

12 24 36 Time, h

48

C)

Excluded/Included

**

Time, h Fig. 3. Effects of ACTH on the alternative splicing of Cd151 at exon 1. Y1 mouse adrenocortical tumor cells were examined for alternative splicing of Cd151 following treatment with ACTH (15 nM) for the times indicated. Total RNA was recovered and analyzed as described in Fig. 2; PCR cycles were the same as described in the legend to Fig. 2A. (A) Schematic representation of the alternative splicing of Cd151 showing the constant exons 1, 2 and 3 (white bars), the alternatively spliced portion of exon 1 (hatched bar), flanking intron sequences (thick lines) and primers complementary to sequences in exons 1 and 3 (arrows) that were used to amplify the alternatively spliced products. Schematic representations of the alternatively spliced products are also shown (note that exon 3 is the first coding exon). (B) Effects of ACTH on the accumulation of exon-included and exon-excluded forms of Cd151 are shown in a representative electrophoretogram. (C) Results from three separate experiments were combined and expressed as mean fold-change in molar ratio of the alternatively spliced transcripts ± S.E. Statistically significant differences from the untreated control (**p < 0.01) were determined by Dunnett’s multiple comparison post-hoc test.

in Y1 cells using RT-PCR; of these, 70 transcripts were expressed in Y1 cells (Appendix: Supplementary Table S1). As shown in Fig. 3, ACTH affected the alternative splicing of only one transcript, Cd151. Treating Y1 adrenal cells with ACTH (15 nM) stimulated alternative splicing of Cd151 at exon 1, such that the shorter form of the transcript increased over time while the longer form decreased (Fig. 3A and B). As determined in three separate experiments, ACTH caused a time-dependent increase in the ratio of the alternatively spliced transcripts (p = 0.002 as determined by ANOVA) that reached 1.7-fold at 48 h (Fig. 3C).

3.4. Alternative splicing of the transcript encoding Dab2 In the rat adrenal gland, Dab2 is expressed in the glomerulosa zone of the cortex where it is regulated by Ang II and by salt; Ang II injected into rats caused a transient increase in both the long and short forms of Dab2 whereas a low-salt diet specifically increased the accumulation of the long form of Dab2 (Romero et al., 2007). Both the long or short forms of rat Dab2 potentiated the action of Ang II on CYP11B2 promoter activity and on aldosterone secretion in H295R human adrenocortical tumor cells, with only subtle differences between them (Romero et al., 2007). Because of this linkage of the alternatively spliced forms of Dab2 to steroidogenesis, we assayed Y1 adrenal cells for Dab2 expression and for the effects of ACTH on the accumulation of the alternatively spliced forms, using PCR primers that spanned coding exon 9, the alternatively spliced exon (Fig. 4A). Under basal conditions, both forms of the Dab2 transcript were expressed in Y1 cells in approximately equal molar amounts (Fig. 4B). After stimulation with ACTH (15 nM), the level of the shorter Dab2 transcript increased in a timedependent manner while the larger exon 9-containing transcript concomitantly decreased, indicative of an effect of ACTH on the alternative splicing of Dab2 (Fig. 4B and C). The effect of ACTH reached statistical significance (p < 0.05) at 24 h and was sustained for 48 h, causing a 1.7-fold change in the ratio of the two transcripts (Fig. 4C).

3.5. Alternative splicing of the transcripts encoding Tia1 Our interest in the effect of ACTH on the alternative splicing of Tia1 in Y1 adrenal cells arose from a microarray study of ACTH action (Schimmer et al., 2006), in which Tia1 appeared to be regulated by ACTH in opposite directions when hybridized to different cDNA clones from the same gene (unpublished observations). Curiously, one of these cDNA clones corresponded in sequence to a portion of the intron between coding exons 6 and 7, suggesting that a novel alternative exon resided this region. Indeed, RT-PCR amplification of Tia1 from Y1 adrenal cells using primers from exons 6 and 8 (Fig. 5A) generated one product of expected size (197 bp) and expected sequence (data not shown) and a somewhat longer product that was approximately one-third as abundant (Fig. 5B). The larger fragment contained a 66 bp insert corresponding to a sequence within the intron between exons 6 and 7 (bases 19,293–19,358; see gene centered accession no. 21841; Fig. 5C). The insertion introduced two stop codons, the first of which is 435 bp downstream of the translation start site, predicting a truncated protein of 144 amino acids. Treatment with ACTH (15 mM) stimulated exon inclusion, as evidenced by the accumulation of the longer Tia1 transcript at the expense of the shorter one (Fig. 5B); the ratio of the two transcripts changed 3.3-fold after ACTH treatment (p < 0.05; Fig. 5D). ACTH also regulated the alternative splicing of Tia1 at exon 5 (Fig. 5E, F and G). Using PCR primers from coding exons 4 and 6 (Fig. 5E), two forms of Tia1 were generated that differed by 33 bp, as predicted for the inclusion or exclusion of exon 5 (Fig. 5F). ACTH (15 nM) stimulated the inclusion of exon 5 as evidenced by the accumulation of the large form at the expense of the short form of the transcript (Fig. 5G).

3.6. Effects of forskolin, 8BrcAMP and PMA on alternative splicing Since the inhibitory effects of ACTH on the accumulation of many of the splicing factor transcripts appeared to be mediated by cAMP

Please cite this article in press as: Bernard P. Schimmer, Martha Cordova, Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells, Molecular and Cellular Endocrinology (2014), doi: 10.1016/j.mce.2014.09.026

ARTICLE IN PRESS B.P. Schimmer, M. Cordova/Molecular and Cellular Endocrinology ■■ (2014) ■■–■■

A)

5

B)

Exons 4

5

6

7

8

9

bp

10

1000 4 5 6 7 8

9

included

10

4 5 6 7 8 10

excluded

300 0

4

12 24 36 48

Time, h

C)

2.5 2.0

*

*

*

24

36

48

1.5 1.0 0.5 0.0 0

12

Time, h Fig. 4. Effects of ACTH on the alternative splicing of mouse Dab2 at exon 9. Effects of ACTH on Dab2 were evaluated in Y1 mouse adrenocortical tumor cells as described in Fig. 3. Conditions for PCR amplification were the same as described in Fig. 2. Statistical significance (*p < 0.05) was determined by Dunnett’s multiple comparison post-hoc test.

and protein kinase A (Schimmer et al., 2006), we evaluated the effects of forskolin, 8BrcAMP and PMA on the alternative splicing of the GNAS minigene and on the endogenous Cd151, Dab2 and Tia1. Both forskolin (10 μM) and 8BrcAMP (3 mM) stimulated the exclusion of exon 3 in GNAS (Table 2), the exclusion of the distal end of exon 1 in Cd151 and the inclusion of exon 5 in Tia1 (Table 3), suggesting cAMP-mediated events. Forskolin also stimulated the exclusion of exon 9 in Dab2 and the inclusion of the novel exon in Tia1; the effect of 8BrcAMP on the alternative splicing of the latter transcripts paralleled those of forskolin, but failed to reach statistical significance (Table 3). In all cases, PMA (0.1 μM) was without effect (Tables 2 and 3). 4. Discussion Alternative splicing is determined by many factors, including enhancers or silencers of the splicing reaction that affect the recruitment of the basic splicing machinery to adjacent splice sites in pre-mRNA (Wahl et al., 2009). Some of these splicing enhancers and silencers shuttle between the cytoplasm and nucleus and have activities that are modified by phosphorylation and other posttranslational modifications (Lynch, 2007). Ultimately, it is the net sum of positive and negative effects at a given splice site that determines splice site selection (Caceres et al., 1994; Wahl et al., 2009). An observation that exposure of H295R human adrenocortical tumor cells to ACTH reduced hnRNP B protein accumulation provided the first hint that ACTH might affect alternative RNA splicing in cells of the adrenal cortex (Wu et al., 2005). Subsequently, in a series of microarray experiments, we demonstrated that ACTH, acting primarily through cAMP, inhibited the accumulation of a cluster of 39 transcripts with functions in alternative splicing (Schimmer et al., 2006), some of which were confirmed by quantitative RT-PCR (Fig. 1). The transcripts affected included those of the SR and hnRNP families, which act as enhancers and silencers of RNA splicing respectively. These observations on the regulation of transcription factors by ACTH led to the demonstration that ACTH affected the alternative splicing of four different transcripts, Gnas, Cd151, Dab2 and Tia1, in the Y1 adrenocortical cell line (Figs. 2–5). The effects of ACTH on alternative splicing of these transcripts, like its effects on many of the splicing factors (Schimmer et al., 2006), appear to be mediated by cAMP (Tables 2 and 3). Whether the effects of ACTH on alternative

splicing are all due to the changing levels of the splicing factors have yet to be determined. Inasmuch as ACTH stimulates both exon skipping (Figs. 2–4) and exon inclusion (Fig. 5) and exerts its various effects with different time courses (Figs. 2–5), it seems likely that different mechanisms are involved in the regulation of each of the splicing events described here. Little is known about the functional significance of the alternatively spliced forms of Gnas, Cd151, Dab2 and Tia1 in the adrenal cortex. For Gnas, biochemical evidence suggests that the alternatively spliced forms may couple differently to G-protein coupled receptors and affect cell signaling, but roles for the alternatively spliced forms in situ have yet to be established (Liu and Seifert, 2002; Seifert et al., 1998). Cd151 (cluster of differentiation 151; also known as PETA-3 or SFA-1) is a member of the tetraspanin-4 superfamily of cell surface proteins (Fitter et al., 1998) that associates with cell matrix adhesion complexes and affects cell migration (Liu et al., 2007). Alternative splicing of Cd151 at exon 1 generates two transcripts, which differ by 119 nucleotides in the 5′-untranslated region; the functional significance of these alternatively spliced forms are as yet unknown (Fitter et al., 1998). Dab2 (disabled homolog 2) is a protein that affects signal transduction or gene expression depending upon the alternative splicing of its transcript at coding exon 9. Inclusion of exon 9 produces a 96 kDa mitogen-regulated cytoplasmic adapter protein involved in signal transduction (Hocevar et al., 2001), whereas exclusion of exon 9 gives rise to a 67 kDa nuclear coactivator of transcription (Cho et al., 2000). Whether these discrete functions assigned to the alternatively spliced forms of Dab2 are relevant to the adrenal cortex is uncertain since both forms functioned equally well in regulating expression of the CYP11B2 promoter activity in H295R adrenocortical tumor cells (Romero et al., 2007). Tia1 (T-cell intracellular antigen 1; also known as cytotoxic granuleassociated RNA binding protein) is an RNA-binding protein that regulates alternative splicing by influencing 5′ splice site selection (Del Gatto-Konczak et al., 2000) and that represses translation by forming non-functional preinitiation complexes at target transcripts (Lopez de Silanes et al., 2005). Alternative splicing of Tia1 at exon 5 (i.e., coding exon 4) generates two transcripts that encode Tia1 isoforms with different RNA splicing activities (Izquierdo and Valcarcel, 2007). Thus it is possible that the alternative splicing of Tia1 at exon 5 mediates some of the other effects of ACTH on alternative splicing in the adrenal cortex. The function of the truncated

Please cite this article in press as: Bernard P. Schimmer, Martha Cordova, Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells, Molecular and Cellular Endocrinology (2014), doi: 10.1016/j.mce.2014.09.026

ARTICLE IN PRESS B.P. Schimmer, M. Cordova/Molecular and Cellular Endocrinology ■■ (2014) ■■–■■

6

A)

B)

7

6

Exons

6 6

8

7

8

7

8

bp included

300 200 100

excluded 0

4

12 24 36 Time, h

48

D)

C)

TTTC AGTGTCTCTGAAGAATGGACAGAATTGCCCTGGCTA ACTACAAGCTACGGTTCACAGTGGATAAAT AGATGCCCGT GTGGTAAAAGACATGGCTACCGGG AAGTCTAAGGGATATG GCTTTGTCTCCTTTTTCAACAAATGGGATGCAGAAAATGC CATTCAGCAGATGGGTGGCCAGTGGCTTGGTGG A

Excluded/Included

ACCGAAGACATCAAAGCAGCGTTTGCACCATTTGGAAGAA

*

*

Time, h

Exons

F) 4

3 3

5

4 3

6

5

4

6 6

G)

Relative intensity

E)

bp 200 150 100

**

*

Fig. 5. Effects of ACTH on the alternative splicing of Tia1 between exons 6 and 7 and at exon 5. The effects of ACTH on the alternative splicing of Tia1 were evaluated in Y1 mouse adrenocortical tumor cells as described in Fig. 3. (A–D) Effects of ACTH on the novel splicing event in the region between coding exons 6 and 7. (A) Schematic representation of the alternatively spliced intronic region of Tia1 showing the constant exons 6, 7 and 8 (white bars), the alternatively spliced portion of intron 1 (hatched bar), flanking intron sequences (thick lines) and primers complementary to sequences exons 6 and 8 (arrows) that were used to amplify the alternatively spliced products. Schematic representations of the alternatively spliced products are also shown. (B) Effects of ACTH on the accumulation of the spliced forms of Tia 1, with and without the novel exon, in a representative electrophoretogram; (C) the sequence of the novel exon (shaded) spliced from the intron between exons 6 and 7; (D) Results averaged from three separate experiments and expressed as mean fold-changes in molar ratios of the alternatively spliced transcripts ± S.E. Conditions for PCR amplification were 94 °C, 40 s; 56 °C, 30 s; 70 °C, 60 s for 28 cycles. (E, F and G) Effects of ACTH on alternative splicing at exon 5. Conditions for PCR were 94 °C, 40 s; 60 °C, 40 s; 70 °C, 40 s; for 28 cycles. (E) Schematic representation of the alternative splicing of Tia1 at exon 5 showing the constant exons 3, 4 and 6 (white bars), the alternatively spliced exon 5 (hatched bar), flanking intron sequences (thick lines) and primers complementary to sequences exons 3 and 8 (arrows) that were used to amplify the alternatively spliced products. Schematic representations of the alternatively spliced products are also shown. (F) Representative electrophoretogram of the effects of a 24-h treatment with ACTH on the alternatively spliced forms of Tia1 at exon 5. (E) The accumulation of the exon-included and exon-excluded forms of the transcript in the absence (white bars) or presence (black bars) of 15 nM ACTH were quantitated by densitometry and reported as means ± S.E. (n = 3). Statistical significance (*p < 0.05, **p < 0.01) was determined by Dunnett’s multiple comparison post-hoc test.

transcript predicted from the alternative splicing of Tia1 between exons 6 and 7 is more enigmatic, as we do not know if this alternatively spliced product has activity, is unique to Y1 adrenal cells, or is more widely distributed in normal adrenal cells as well as in other tissues. As noted in Section 3.3 earlier, we were able to identify one ACTHregulated splicing event when screening 2% – i.e., 75 transcripts – of a library comprised of 3126 alternative spliced transcripts. The 3126 alternatively spliced transcripts were sequence-verified events mined from mouse cDNA and EST databases and further culled on the basis of their representation in multiple tissues (Pan et al., 2004). While we have screened only a fraction of the library of alternatively spliced transcripts, our results indicate that more than 90% of the transcripts screened are expressed in Y1 adrenal cells (Appendix: Supplementary Table S1) and suggest that the library

Table 2 Effects of candidate second messengers on the alternative splicing of a Gsα minigenea. Ratio of alternatively spliced transcripts Treatment

Mean ± S.D.

p valueb

Control Forskolin 8BrcAMP PMA

0.75 ± 0.03 1.38 ± 0.37 1.25 ± 0.24 0.60 ± 0.04

<0.01 <0.01 n.s.

a Y1 adrenal cells transfected with a Gsα minigene were stimulated with forskolin (10 μM), 8BrcAMP (3 mM) or PMA (0.1 μM) for 12 h and total RNA was evaluated for alternative splicing of Gsα by RT-PCR as described in Section 2. The ratios of the alternatively spliced transcripts (exon 3 excluded/exon 3 included) were analyzed in three separate experiments and quantitated by densitometry. b Statistical significance was determined by one-way ANOVA followed by Dunnett’s multiple comparison tests.

Please cite this article in press as: Bernard P. Schimmer, Martha Cordova, Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells, Molecular and Cellular Endocrinology (2014), doi: 10.1016/j.mce.2014.09.026

ARTICLE IN PRESS B.P. Schimmer, M. Cordova/Molecular and Cellular Endocrinology ■■ (2014) ■■–■■

Table 3 Effects of candidate second messengers on the alternative splicing of Cd151, Tia1 and Dab2a. Ratio of excluded/included transcripts

Treatment Control Forskolin 8BrcAMP PMA

Cd151

Dab2

Tia1b

Tia1c

Mean ± S.D. 0.81 ± 0.07 1.34 ± 0.10** 1.43 ± 0.02** 0.95 ± 0.10

Mean ± S.D. 1.49 ± 0.49 5.97 ± 2.11** 3.66 ± 1.11 3.47 ± 0.84

Mean ± S.D. 2.36 ± 0.88 0.69 ± 0.22** 1.47 ± 0.49 2.51 ± 0.76

Mean ± S.D. 0.88 ± 0.07 0.46 ± 0.05** 0.66 ± 0.09* 0.77 ± 0.09

a Y1 adrenal cells were stimulated with forskolin (10 μM), 8BrcAMP (3 mM) or PMA (0.1 μM) for 24 h (Dab2 and Tia1 at exon 5) or 48 h (Cd151 and Tia1 between exons 6 and 7) and analyzed as described in Table 1. b Alternative splicing at the novel exon situated between exons 6 and 7. c Alternative splicing at exon 5. * Values significantly different from the control group, p < 0.05. ** Values significantly different from the control group p < 0.01.

is representative of alternatively spliced transcripts expressed in the Y1 adrenal cell line. Therefore, by extrapolation, the library may contain as many as 50 splicing events affected by ACTH. When coupled with our findings that ACTH affects a cluster of transcripts that encode proteins with alternative splicing activity (Figs. 1 and 5 and Schimmer et al., 2006), our results suggest that regulation of alternative splicing of RNA helps shape the effects of ACTH on the transcription landscape of the adrenal cortex. Acknowledgments I thank William Rainey and his committee for selecting me as the 2014 Keith L. Parker Memorial Lecturer. This is indeed an honor, especially since Keith and I were not only close collaborators, but also very good friends for over 24 years. The origins of our collaboration and summary of our work together have been summarized elsewhere (Schimmer and White, 2010). The work presented here was funded by a research grant from the Canadian Institutes of Health Research (MOP-64325). Appendix: Supplementary material Supplementary data to this article can be found online at doi:10.1016/j.mce.2014.09.026. References Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., et al., 2007. Current Protocols in Molecular Biology. John Wiley & Sons, New York. Bland, J.M., Altman, D.G., 1996. Transformations, means, and confidence intervals. BMJ 312, 1079. Caceres, J.F., Stamm, S., Helfman, D.M., Krainer, A.R., 1994. Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science 265, 1706–1709. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J., Rutter, W.J., 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294–5299. Cho, S.Y., Jeon, J.W., Lee, S.H., Park, S.S., 2000. p67 isoform of mouse disabled 2 protein acts as a transcriptional activator during the differentiation of F9 cells. Biochem. J. 352 (Pt 3), 645–650. Del Gatto-Konczak, F., Bourgeois, C.F., Le Guiner, C., Kister, L., Gesnel, M.C., Stevenin, J., et al., 2000. The RNA-binding protein TIA-1 is a novel mammalian splicing regulator acting through intron sequences adjacent to a 5′ splice site. Mol. Cell. Biol. 20, 6287–6299. Fitter, S., Seldin, M.F., Ashman, L.K., 1998. Characterisation of the mouse homologue of CD151 (PETA-3/SFA-1); genomic structure, chromosomal localisation and identification of 2 novel splice forms. Biochim. Biophys. Acta 1398, 75–85.

7

Freddi, S., Arnaldi, G., Fazioli, F., Scarpelli, M., Appolloni, G., Mancini, T., et al., 2005. Expression of growth hormone-releasing hormone receptor splicing variants in human primary adrenocortical tumours. Clin. Endocrinol. (Oxf) 62, 533–538. Glazer, A.N., Peck, K., Mathies, R.A., 1990. A stable double-stranded DNA-ethidium homodimer complex: application to picogram fluorescence detection of DNA in agarose gels. Proc. Natl Acad. Sci. U.S.A. 87, 3851–3855. Hazard, D., Liaubet, L., Sancristobal, M., Mormede, P., 2008. Gene array and real time PCR analysis of the adrenal sensitivity to adrenocorticotropic hormone in pig. BMC Genomics 9, 101. Hocevar, B.A., Smine, A., Xu, X.X., Howe, P.H., 2001. The adaptor molecule Disabled-2 links the transforming growth factor beta receptors to the Smad pathway. EMBO J. 20, 2789–2801. Izquierdo, J.M., Valcarcel, J., 2007. Two isoforms of the T-cell intracellular antigen 1 (TIA-1) splicing factor display distinct splicing regulation activities. Control of TIA-1 isoform ratio by TIA-1-related protein. J. Biol. Chem. 282, 19410– 19417. Lee, J.J., Widmaier, E.P., 2005. Gene array analysis of the effects of chronic adrenocorticotropic hormone in vivo on immature rat adrenal glands. J. Steroid Biochem. Mol. Biol. 96, 31–44. Liu, H.Y., Seifert, R., 2002. Distinct interactions of G(salpha-long), G(salpha-short), and G(alphaolf) with GTP, ITP, and XTP. Biochem. Pharmacol. 64, 583–593. Liu, L., He, B., Liu, W.M., Zhou, D., Cox, J.V., Zhang, X.A., 2007. Tetraspanin CD151 promotes cell migration by regulating integrin trafficking. J. Biol. Chem. 282, 31631–31642. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 25, 402–408. Lopez de Silanes, I., Galban, S., Martindale, J.L., Yang, X., Mazan-Mamczarz, K., Indig, F.E., et al., 2005. Identification and functional outcome of mRNAs associated with RNA-binding protein TIA-1. Mol. Cell. Biol. 25, 9520–9531. Lynch, K.W., 2007. Regulation of alternative splicing by signal transduction pathways. Adv. Exp. Med. Biol. 623, 161–174. Martin, M.M., Willardson, B.M., Burton, G.F., White, C.R., McLaughlin, J.N., Bray, S.M., et al., 2001. Human angiotensin II type 1 receptor isoforms encoded by messenger RNA splice variants are functionally distinct. Mol. Endocrinol. 15, 281–293. Pan, Q., Shai, O., Misquitta, C., Zhang, W., Saltzman, A.L., Mohammad, N., et al., 2004. Revealing global regulatory features of mammalian alternative splicing using a quantitative microarray platform. Mol. Cell 16, 929–941. Pollard, A.J., Krainer, A.R., Robson, S.C., Europe-Finner, G.N., 2002. Alternative splicing of the adenylyl cyclase stimulatory G-protein G alpha(s) is regulated by SF2/ASF and heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) and involves the use of an unusual TG 3′-splice site. J. Biol. Chem. 277, 15241–15251. Qiu, R., Tsao, J., Kwan, W., Schimmer, B.P., 1996. Mutations to forskolin resistance result in loss of adrenocorticotropin receptors and consequent reductions in levels of G protein α-subunits. Mol. Endocrinol. 10, 1708–1718. Rainey, W.E., Saner, K., Schimmer, B.P., 2004. Adrenocortical cell lines. Mol. Cell. Endocrinol. 228, 23–28. Romero, D.G., Yanes, L.L., de Rodriguez, A.F., Plonczynski, M.W., Welsh, B.L., Reckelhoff, J.F., et al., 2007. Disabled-2 is expressed in adrenal zona glomerulosa and is involved in aldosterone secretion. Endocrinology 148, 2644–2652. Schimmer, B.P., Parker, K.L., 2005. Adrenocorticotrophic hormone; adrenocortical steroids and their synthetic analogs; inhibitors of the synthesis and actions of adrenocortical hormones. In: Brunton, L., Lazo, J., Parker, K. (Eds.), Goodman and Gilman’s the Pharmacological Basis of Therapeutics. McGraw-Hill, Inc., New York, pp. 1587–1612. Schimmer, B.P., Tsao, J., 1990. Decreased levels of guanyl nucleotide-binding regulatory protein α-subunits in Y1 adrenocortical tumor cell mutants resistant to forskolin. Mol. Endocrinol. 4, 1698–1703. Schimmer, B.P., White, P.C., 2010. Minireview: steroidogenic factor 1: its roles in differentiation, development, and disease. Mol. Endocrinol. 24, 1322–1337. Schimmer, B.P., Cordova, M., Cheng, H., Tsao, A., Goryachev, A.B., Schimmer, A.D., et al., 2006. Global profiles of gene expression induced by adrenocorticotropin in Y1 mouse adrenal cells. Endocrinology 147, 2357–2367. Schimmer, B.P., Cordova, M., Cheng, H., Tsao, A., Morris, Q., 2007. A genome-wide assessment of adrenocorticotropin action in the Y1 mouse adrenal tumor cell line. Mol. Cell. Endocrinol. 265–266, 102–107. Seifert, R., Wenzel-Seifert, K., Lee, T.W., Gether, U., Sanders-Bush, E., Kobilka, B.K., 1998. Different effects of Gsalpha splice variants on beta2-adrenoreceptormediated signaling. The beta2-adrenoreceptor coupled to the long splice variant of Gsalpha has properties of a constitutively active receptor. J. Biol. Chem. 273, 5109–5116. Sewer, M.B., Dammer, E.B., Jagarlapudi, S., 2007. Transcriptional regulation of adrenocortical steroidogenic gene expression. Drug Metab. Rev. 39, 371–388. Stamm, S., Ben-Ari, S., Rafalska, I., Tang, Y., Zhang, Z., Toiber, D., et al., 2005. Function of alternative splicing. Gene 344, 1–20. Wahl, M.C., Will, C.L., Luhrmann, R., 2009. The spliceosome: design principles of a dynamic RNP machine. Cell 136, 701–718. Wu, W., Kamma, H., Ffujiwara, M., Yano, Y., Satoh, H., Hara, H., et al., 2005. Altered expression patterns of heterogeneous nuclear ribonucleoproteins a2 and b1 in the adrenal cortex. J. Histochem. Cytochem. 53, 487–495.

Please cite this article in press as: Bernard P. Schimmer, Martha Cordova, Corticotropin (ACTH) regulates alternative RNA splicing in y1 mouse adrenocortical tumor cells, Molecular and Cellular Endocrinology (2014), doi: 10.1016/j.mce.2014.09.026