- Email: [email protected]
Cosolvents facilitate DNA synthesis in the herpes simplex virus 1 unique short (Us) inverted repeat
Journal of Virological Methods 73 (1998) 53 – 58
Cosolvents facilitate DNA synthesis in the herpes simplex virus 1 unique short (Us) inverted repeat Jason Paragas, John A. Blaho * Department of Microbiology, Mount Sinai School of Medicine, One Gusta6e L. Le6y Place, New York, NY 10029 -6574, USA Accepted 5 February 1998
Abstract DNA synthesis under standard conditions is not successful within a portion of the Us1 gene of HSV-1 which is juxtaposed to an 86% G + C-containing tract in the Us inverted repeat sequence. We report that the independent addition of specific amounts of at least three different types of cosolvents is capable of facilitating DNA synthesis within this G+C-rich region. In addition, this strategy was used to successfully place a specific site-directed mutation in the Us1 gene. Consideration of these observations should enable future site-specific mutational analyses of portions of the HSV-1 genome which have traditionally been unamenable to genetic manipulations. © 1998 Elsevier Science B.V. All rights reserved. Keywords: Herpes simplex virus; Repeat sequences; Mutagenesis; PCR; Cosolvents
1. Introduction Herpesviruses are a family of viruses which can cause severe disease in neonates and in infectionor drug-induced immunologically deficient patients. The members of the human herpesvirus family are often the causative agents of infectious complications of patients with acquired immunodeficiency disease syndrome (AIDS) and they also include viruses which have been im* Corresponding author. Tel.: + 1 212 2417319; fax: +1 212 5341684; e-mail: [email protected]
plicated in human malignancies. Herpes simplex virus (HSV) is a neurotropic herpesvirus and is the prototype of the family. An understanding of the regulation of its replication machinery will help explain the role of these viruses in human infectious diseases and cancers. Most of the knowledge about the replicative cycle of HSV comes from the work in tissue culture systems using herpes simplex virus 1 (HSV-1) (reviewed in Roizman and Sears, 1996). It was shown that the expression of HSV-1 genes is regulated and ordered in a sequential cascade. HSV genes are transcribed by cellular RNA poly-
0166-0934/98/$19.00 © 1998 Elsevier Science B.V. All rights reserved. PII S0166-0934(98)00036-6
54
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
Fig. 1. Schematic representation of the HSV-1 inverted repeat sequence analyzed in this study. Line 1, the prototype orientation of the HSV genome; the boxes indicate the repeat sequences of the unique long (UL) and short (Us) components of HSV DNA whose flanking sequences have been designated a, a%, b, b%, c, c% (Wadsworth et al., 1975). Line 2, locations in the HSV genome of the BamHI ‘N’ fragment (Post and Roizman, 1981), which contains the gene (Us1 or a22) encoding ICP22 showing relevant restriction endonuclease sites with coordinates (McGeoch et al., 1985). Line 3, representation of the BsaI-SacI subclone; the approximate locations of the Arg77 target, repeat sequence (box), and T7 and SP6 primer sites (outside primers) are shown. Line 4, nucleic acid sequence represented as a box in line 3.
merase II (PolII). The first class of genes which are expressed after infection are the a genes; these genes do not require de novo viral protein synthesis for their expression and are induced by a structural component of the virion, the a trans-inducing factor (VP16). Expression of the later classes of genes, b and g, requires functional a proteins, which include the infected cell protein number 22 (ICP22). The deletion of specific genes in the HSV-1 genome has been an enormously useful technique for defining the general function of viral regulatory proteins. For example, viruses which are devoid of ICP22 (Post and Roizman, 1981) were able to replicate in primate epithelial cells and actively dividing human epithelial cells (permissive cells), but not in rodent epithelial cells or non-dividing human epithelial (non-permissive cells) cells (Sears et al., 1985; Poffenberger et al., 1993; Rice et al., 1995). In the non-permissive cells, these viruses were deficient for late gene expression. In addition, these viruses were highly attenuated for neuro-growth upon intracerebral inoculation of mice (Sears et al., 1985; Poffenberger et al., 1994). Recent studies showed that ICP22 is highly modified posttranslationally (Wilcox et al., 1980) and these modifications include nucleotidylation (Blaho et al., 1993), as well as tyrosine phosphorylation (Blaho et al., 1997).
Unfortunately, the gross deletions described above are incapable of addressing the function that these posttranslational moieties play in the replication of HSV. Therefore, in contrast to these earlier studies, the goal of this work was to develop a system for introducing specific point mutations into the ICP22 gene which could then be used in the generation of recombinant viruses.
2. Materials and methods The genome of HSV-1 consists of a unique long (UL) sequence and a unique short (Us) sequence, each of which is flanked by inverted repeat sequences (Fig. 1). While the overall G+ C content of the HSV-1 genome is approximately 67%, the inverted repeats contain tracts whose content approaches 100% (McGeoch et al., 1985, 1986, 1988). The ICP22 protein is encoded by the Us1 (a22) gene, which is located just at the junction of the Us region and the Us inverted repeat (Fig. 1). Juxtaposed to the start of the a22 gene is a region containing six direct repeats possessing a G+ C content of approximately 86%. Recently, it was shown that the stretch of the ICP22 protein containing amino acids 76–81 is a signaling or recognition site for the nucleotidylylation of ICP22 by human casein kinase II (Mitchell et al., 1997). To
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
address the function of the individual amino acids in this site, we set out to mutate specifically each target amino acid using a polymerase chain reaction (PCR)-based site-directed mutagenesis strategy and the first residue we focused on was Arg77. A portion (Fig. 1) of the a22 gene (BsaI-SacI) containing the codon for Arg77 was cloned into the SacI site of pGEM3ZF1( +) (Promega, Madison, WI). Oligonucleotides (Genset, France) corresponding to the plasmid SP6 and T7 promoters were used as primers in the following reaction. Approximately 1 ng of DNA was used as a template and mixed with 50 pmol of each primer in a mixture (50 ml) containing 10 mM Tris –HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM each of dATP, dCTP, dGTP, and TTP (New England Biolabs, Beverly, MA) plus 0.5 units of AmpliTaq DNA polymerase (PerkinElmer, CA). The mixture was initially held at 95°C for 5 min prior to cycling (30 times) at 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, and then held at 72°C for 10 min using a GeneAmp 2400 (Perkin-Elmer). The reaction products were then analyzed by agarose gel electrophoresis after ethidium bromide staining. As a control, the reaction was performed without the addition of the plasmid template DNA. While the expected size of the full-length product is 1050 bp, these conditions produced only a small product of approximately 150 bp (Fig. 2, lane 3). As expected, the DNA-negative control showed no products (Fig. 2, lane 2). From this result, we conclude that our standard reaction conditions were insufficient for efficient DNA synthesis in this G+ C-rich region of the HSV-1 genome. In an attempt to facilitate DNA synthesis, the reaction conditions described above were repeated with the addition of various cosolvents to the mixtures. The results (Fig. 2) were as follows. (i) Addition of either 5.0% (lane 6) and 10.0% (lane 7) glycerol, 1.0% DMSO (lane 9), or 0.1% NP40 (lane 12) to reaction mixtures yielded significant amounts of full-length product (1050 bp). (ii) Addition of 15.0% glycerol (lane 8) or 10.0% DMSO (lane 10) resulted in the production of higher molecular weight species (greater than fulllength product), whereas (iii) 1% (lane 4) and 5% (lane 5) formamide, 15% DMSO (lane 11), or
55
Fig. 2. Digital scanning image of electrophoretically separated DNA fragments stained with ethidium bromide. Nonidet P-40 (NP40), dimethylsulfoxide (DMSO), glycerol, or formamide (Form.) were added to standard reaction mixtures (no CS) as described in the text. ‘No DNA’ refers to the product of the standard reaction containing SP6 and T7 primers but no plasmid template DNA. Sizes (bp) of relevant molecular weight markers (mw), as well as the locations of the full-length (Full) and 150-bp products are indicated in the margins.
0.2% NP40 (lane 13) had little or no effect. From these results, it was concluded that the independent addition of specific amounts of at least three different types of cosolvents is capable of facilitating DNA synthesis within the G + C-rich repeat sequence. To determine whether cosolvent addition could enable the production of single-site mutations in HSV-1 DNA, a PCR-based site-specific mutagenesis strategy was followed (Fig. 3). This system required the use of four independent oligonucleotide primers; two ‘outside primers’ and two internal ‘mutant primers’. The ‘outside primers’ contain sequences that are distal to the site which is to be mutated. In this series of experiments we used the T7 and SP6 primers which hybridize to sites just outside of the plasmid polylinker (Fig. 1). The ‘mutant primers’ overlap the site to be mutated on both strands; they are of identical lengths and contain complementary nucleotide substitutions (R77Gfor, 5%CGGTGGCCGTGGCGCCCCCCGGA and R77G-rev, 5%-TCCGGGGGGCGCCACGGCCACCG). The design of the mutant oligonucleotides was such that, in addition to mutating the Arg77 to a Gly77, a novel NarI site was also introduced into the DNA.
56
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
and another PCR reaction was performed. As a control, wild type product was synthesized from the plasmid template using the SP6 and T7 primers only. The results (Fig. 4) showed that the mutagenesis strategy yielded a product (Full) which was the same size as the wild type control product (compare lanes 2 and 4). To demonstrate that the product resulting from the mutagenesis protocol contained the intended site-specific mutation, restriction endonuclease digestions of the mutant and wild type products were undertaken. Incubation of the mutant product with the enzyme NarI resulted in the conversion of the full length product (1050 bp) into 792- and 258-base pair fragments (Fig. 4, lane 1) which, as expected, are the lengths of the starting ‘left’ (lane 6) and ‘right’ (lane 5) products, respectively. No smaller products were observed with either (i) the mutant product without NarI (lane 2) or the wild type product (ii) with (lane 3) or (iii) without (lane 5) the enzyme, as expected. The entire 1050-base pair product was sequenced Fig. 3. Schematic representation of the mutagenesis strategy for the gene encoding ICP22. A complete description of the techniques, as well as the sequences of each mutant primer are found in the text. ‘Arg77’ refers to the amino acid in ICP22 which was changed to a glycine. In this study, the ‘left’ and ‘right’ outside primers were T7 and SP6, respectively (Fig. 1).
In the first step, two separate PCR reactions were carried out as described above (Fig. 2) in the presence of 5% glycerol using the appropriate combinations of outside and mutant primers (Fig. 3, line 1). These two reactions yielded two separate products (Fig. 3, line 2), which were gel purified (data not shown). In the next step, the two pure PCR products were combined, denatured, and then allowed to reanneal. The annealed products included the original ‘left’ and ‘right’ products (not shown), as well as two chimeric mixtures of the two starting fragments; only one of the chimeras possesses recessed 3% ends (Fig. 3, line 3). The chimeric products which contain a recessed 3% end were then extended upon the addition of the DNA polymerase without adding any exogenous primers (Fig. 3, line 4). Finally, fresh ‘outside primers’ (SP6 and T7) were added
Fig. 4. Digital scanning image of electrophorectically separated DNA fragments visualized after ethidium bromide staining. Wild type and mutant full-length DNA products (Full) were reacted in the presence (+) or absence (− ) of the NarI enzyme as described in the text. ‘Right’ and ‘left’ products were generated as shown in Fig. 3. Sizes (bp) of relevant molecular weight markers (mw) are indicated in the right margin.
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
to confirm the existence of the intended mutation and the fidelity of the flanking sequences (data not shown) and based on all of these results it is concluded that our system successfully converted the wild type sequence into the intended mutant genotype. The use of this protocol for herpesviral research is supported by the fact that we have now used this strategy to successfully place several specific mutations into various loci of the HSV-1 genome (data not shown).
3. Discussion From these data, it is concluded that our experimental strategy resulted in the successful placement of a specific site-directed mutation in the Us1 gene despite the presence of a proximal tract containing a high G+ C content. The addition of cosolvents into the DNA synthesis reaction seems to be sufficient to overcome the unique properties of the HSV-1 genome which might otherwise prevent polymerization. It is likely that the presence of a high G + C content and, perhaps, other undefined sequence-dependent factors in HSV-1 DNA creates a unique biomolecule which is either resistant to the effects of high temperature denaturation or capable of adopting and maintaining an altered structure during the manipulations, thus blocking the processivity of the polymerase. Supplementing the reaction with cosolvents may rearrange the architecture of HSV-1 DNA into a context that is favorable for DNA synthesis. Previously, segments of HSV-1 DNA derived from the inverted repeats were shown to adopt unorthodox secondary DNA conformations (Wohlrab et al., 1987; Wohlrab and Wells, 1989) and it is conceivable that such anisomorphic confirmations, which are characteristically rigid structures, may have existed during our analyses. The observation that a 150-base pair fragment was produced in the absence of cosolvents (Fig. 2, lane 3) is consistent with a model in which such an ansiomorphic structure may have contributed to the inhibition of polymerase processivity. The potential presence of an ansiomorphic structure in the DNA template may have caused the poly-
57
merase to either pass over the structure or remove it through its 3% to 5% exonuclease activity thus culminating in the production of the 150-base pair band. In light of this observation that a portion of HSV-1 DNA seems inaccessible to a core polymerase (Taq) under standard DNA synthesis conditions, it is not surprising that the HSV-1 viral polymerase complex requires a number of additional viral factors to facilitate the synthesis of viral DNA through any potential unusual DNA structures (Challberg, 1986). A thorough understanding of the particular behavior of HSV-1 DNA as a biomolecule may prove to be advantageous in facilitating the development of appropriate diagnostic assays which detect viral nucleic acids either by PCR or ELOSA (enzyme linked oligosorbant assay). It is hoped that the above findings will enable future site-specific mutational analyses of portions of the HSV-1 genome which have been traditionally unamenable to genetic manipulations.
Acknowledgements These studies were supported in part by grants from the United States Public Health Service (AI38873), the American Cancer Society (JFRA 634), and an unrestricted grant from the National Foundation for Infectious Diseases. J.A.B. is a Markey Research Fellow and thanks the Lucille P. Markey Charitable Trust for their support. J.P. was supported, in part, by a City University of New York (CUNY) predoctoral fellowship.
References Blaho, J.A., Mitchell, C., Roizman, B., 1993. Guanylylation and adenylylation of the a regulatory proteins of herpes simplex virus require a viral b or g function. J. Virol. 67, 3891 – 3900. Blaho, J.A., Zong, C., Mortimer, K.A., 1997. Tyrosine phosphorylation of the herpes simplex type 1 regulatory protein ICP22 and a cellular protein which shares antigenic determinants with ICP22. J. Virol. 71, 9828 – 9832. Challberg, M.D., 1986. A method for identifying the viral genes required for herpesvirus DNA replication. Proc. Natl. Acad. Sci. USA 83, 9094 – 9098.
58
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
McGeoch, D.J., Dolan, A., Donald, S., Rixon, F.J., 1985. Sequence determination and genetic content of the short unique region in the genome of herpes simplex virus 1. J. Mol. Biol. 181, 1 – 13. McGeoch, D.J., Dolan, A., Donald, S., Brauer, D.H.K., 1986. Complete DNA sequence of the short repeat region in the genome of herpes simplex type 1. Nucleic Acids Res. 14, 1727 – 1745. McGeoch, D.J., Dalrymple, M.A., Davidson, A.J., Dolan, A., Frame, M.C., McNab, D., Perry, L.J., Scott, J.E., Taylor, P., 1988. The complete sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69, 1531 – 1574. Mitchell, C., Blaho, J.A., McCormick, A.L., Roizman, B., 1997. The nucleotidylylation of the herpes simplex virus 1 regulatory protein a22 by human casein kinase II. J. Biol. Chem. 272, 25394 – 25400. Poffenberger, K.L., Raichlen, P.E., Herman, R.C., 1993. In vitro characterization of a herpes simplex type 1 ICP22 deletion mutant. Virus Genes 7, 171–186. Poffenberger, K. L, Idowa, A.D., Fraser-Smith, E.B., Raiblen, P.E., Herman, R.C., 1994. A herpes simplex virus type 1 ICP22 deletion mutant is altered for virulence and latency in vivo. Arch. Virol. 139, 111–119. Post, L.E., Roizman, B., 1981. A generalized technique for deletion of specific genes in large genome; a22 of herpes simplex virus 1 is not essential for growth. Cell 25, 227– 232.
.
Rice, S.A., Long, M.C., Lam, V., Schaffer, P.A., Spencer, C.A., 1995. Herpes simplex virus immediate-early protein ICP22 is required for viral modification of host RNA polymerase II and establishment of the normal viral transcription program. J. Virol. 69, 5550 – 5559. Roizman, B., Sears, A., 1996. Herpes simplex viruses and their replication. In Fields, B.N., Knipe, D.M. (Eds.), Virology, 3rd edn. Lippincott-Raven, Philadelphia, pp. 2231 – 2295. Sears, A.E., Halliburton, I.W., Meignier, B., Silver, S., Roizman, B., 1985. Herpes simplex virus 1 mutant deleted in the a22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice. J. Virol. 55, 338 – 346. Wadsworth, S., Jacob, R.J., Roizman, B., 1975. Anatomy of herpes simplex virus DNA. II. Size, composition, and arrangement of inverted terminal repetitions. J. Virol. 15, 1487 – 1497. Wohlrab, F., Wells, R.D., 1989. Slight changes in conditions influence the family of non-B-DNA conformations of the herpes simplex virus type 1 DR2 repeats. J. Biol. Chem. 264, 8207 – 8213. Wohlrab, F., McLean, M.J., Wells, R.D., 1987. The segment inversion site of herpes simplex virus type 1 adopts a novel DNA structure. J. Biol. Chem. 262, 6407 – 6416. Wilcox, K.W., Kohn, A., Sklyanskaya, E., Roizman, B., 1980. Herpes simplex virus phosphoproteins. I. Phosphate cycle on and off some viral polypeptides and can alter their affinity for DNA. J. Virol. 33, 167 – 182.
Cosolvents facilitate DNA synthesis in the herpes simplex virus 1 unique short (Us) inverted repeat Jason Paragas, John A. Blaho * Department of Microbiology, Mount Sinai School of Medicine, One Gusta6e L. Le6y Place, New York, NY 10029 -6574, USA Accepted 5 February 1998
Abstract DNA synthesis under standard conditions is not successful within a portion of the Us1 gene of HSV-1 which is juxtaposed to an 86% G + C-containing tract in the Us inverted repeat sequence. We report that the independent addition of specific amounts of at least three different types of cosolvents is capable of facilitating DNA synthesis within this G+C-rich region. In addition, this strategy was used to successfully place a specific site-directed mutation in the Us1 gene. Consideration of these observations should enable future site-specific mutational analyses of portions of the HSV-1 genome which have traditionally been unamenable to genetic manipulations. © 1998 Elsevier Science B.V. All rights reserved. Keywords: Herpes simplex virus; Repeat sequences; Mutagenesis; PCR; Cosolvents
1. Introduction Herpesviruses are a family of viruses which can cause severe disease in neonates and in infectionor drug-induced immunologically deficient patients. The members of the human herpesvirus family are often the causative agents of infectious complications of patients with acquired immunodeficiency disease syndrome (AIDS) and they also include viruses which have been im* Corresponding author. Tel.: + 1 212 2417319; fax: +1 212 5341684; e-mail: [email protected]
plicated in human malignancies. Herpes simplex virus (HSV) is a neurotropic herpesvirus and is the prototype of the family. An understanding of the regulation of its replication machinery will help explain the role of these viruses in human infectious diseases and cancers. Most of the knowledge about the replicative cycle of HSV comes from the work in tissue culture systems using herpes simplex virus 1 (HSV-1) (reviewed in Roizman and Sears, 1996). It was shown that the expression of HSV-1 genes is regulated and ordered in a sequential cascade. HSV genes are transcribed by cellular RNA poly-
0166-0934/98/$19.00 © 1998 Elsevier Science B.V. All rights reserved. PII S0166-0934(98)00036-6
54
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
Fig. 1. Schematic representation of the HSV-1 inverted repeat sequence analyzed in this study. Line 1, the prototype orientation of the HSV genome; the boxes indicate the repeat sequences of the unique long (UL) and short (Us) components of HSV DNA whose flanking sequences have been designated a, a%, b, b%, c, c% (Wadsworth et al., 1975). Line 2, locations in the HSV genome of the BamHI ‘N’ fragment (Post and Roizman, 1981), which contains the gene (Us1 or a22) encoding ICP22 showing relevant restriction endonuclease sites with coordinates (McGeoch et al., 1985). Line 3, representation of the BsaI-SacI subclone; the approximate locations of the Arg77 target, repeat sequence (box), and T7 and SP6 primer sites (outside primers) are shown. Line 4, nucleic acid sequence represented as a box in line 3.
merase II (PolII). The first class of genes which are expressed after infection are the a genes; these genes do not require de novo viral protein synthesis for their expression and are induced by a structural component of the virion, the a trans-inducing factor (VP16). Expression of the later classes of genes, b and g, requires functional a proteins, which include the infected cell protein number 22 (ICP22). The deletion of specific genes in the HSV-1 genome has been an enormously useful technique for defining the general function of viral regulatory proteins. For example, viruses which are devoid of ICP22 (Post and Roizman, 1981) were able to replicate in primate epithelial cells and actively dividing human epithelial cells (permissive cells), but not in rodent epithelial cells or non-dividing human epithelial (non-permissive cells) cells (Sears et al., 1985; Poffenberger et al., 1993; Rice et al., 1995). In the non-permissive cells, these viruses were deficient for late gene expression. In addition, these viruses were highly attenuated for neuro-growth upon intracerebral inoculation of mice (Sears et al., 1985; Poffenberger et al., 1994). Recent studies showed that ICP22 is highly modified posttranslationally (Wilcox et al., 1980) and these modifications include nucleotidylation (Blaho et al., 1993), as well as tyrosine phosphorylation (Blaho et al., 1997).
Unfortunately, the gross deletions described above are incapable of addressing the function that these posttranslational moieties play in the replication of HSV. Therefore, in contrast to these earlier studies, the goal of this work was to develop a system for introducing specific point mutations into the ICP22 gene which could then be used in the generation of recombinant viruses.
2. Materials and methods The genome of HSV-1 consists of a unique long (UL) sequence and a unique short (Us) sequence, each of which is flanked by inverted repeat sequences (Fig. 1). While the overall G+ C content of the HSV-1 genome is approximately 67%, the inverted repeats contain tracts whose content approaches 100% (McGeoch et al., 1985, 1986, 1988). The ICP22 protein is encoded by the Us1 (a22) gene, which is located just at the junction of the Us region and the Us inverted repeat (Fig. 1). Juxtaposed to the start of the a22 gene is a region containing six direct repeats possessing a G+ C content of approximately 86%. Recently, it was shown that the stretch of the ICP22 protein containing amino acids 76–81 is a signaling or recognition site for the nucleotidylylation of ICP22 by human casein kinase II (Mitchell et al., 1997). To
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
address the function of the individual amino acids in this site, we set out to mutate specifically each target amino acid using a polymerase chain reaction (PCR)-based site-directed mutagenesis strategy and the first residue we focused on was Arg77. A portion (Fig. 1) of the a22 gene (BsaI-SacI) containing the codon for Arg77 was cloned into the SacI site of pGEM3ZF1( +) (Promega, Madison, WI). Oligonucleotides (Genset, France) corresponding to the plasmid SP6 and T7 promoters were used as primers in the following reaction. Approximately 1 ng of DNA was used as a template and mixed with 50 pmol of each primer in a mixture (50 ml) containing 10 mM Tris –HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM each of dATP, dCTP, dGTP, and TTP (New England Biolabs, Beverly, MA) plus 0.5 units of AmpliTaq DNA polymerase (PerkinElmer, CA). The mixture was initially held at 95°C for 5 min prior to cycling (30 times) at 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, and then held at 72°C for 10 min using a GeneAmp 2400 (Perkin-Elmer). The reaction products were then analyzed by agarose gel electrophoresis after ethidium bromide staining. As a control, the reaction was performed without the addition of the plasmid template DNA. While the expected size of the full-length product is 1050 bp, these conditions produced only a small product of approximately 150 bp (Fig. 2, lane 3). As expected, the DNA-negative control showed no products (Fig. 2, lane 2). From this result, we conclude that our standard reaction conditions were insufficient for efficient DNA synthesis in this G+ C-rich region of the HSV-1 genome. In an attempt to facilitate DNA synthesis, the reaction conditions described above were repeated with the addition of various cosolvents to the mixtures. The results (Fig. 2) were as follows. (i) Addition of either 5.0% (lane 6) and 10.0% (lane 7) glycerol, 1.0% DMSO (lane 9), or 0.1% NP40 (lane 12) to reaction mixtures yielded significant amounts of full-length product (1050 bp). (ii) Addition of 15.0% glycerol (lane 8) or 10.0% DMSO (lane 10) resulted in the production of higher molecular weight species (greater than fulllength product), whereas (iii) 1% (lane 4) and 5% (lane 5) formamide, 15% DMSO (lane 11), or
55
Fig. 2. Digital scanning image of electrophoretically separated DNA fragments stained with ethidium bromide. Nonidet P-40 (NP40), dimethylsulfoxide (DMSO), glycerol, or formamide (Form.) were added to standard reaction mixtures (no CS) as described in the text. ‘No DNA’ refers to the product of the standard reaction containing SP6 and T7 primers but no plasmid template DNA. Sizes (bp) of relevant molecular weight markers (mw), as well as the locations of the full-length (Full) and 150-bp products are indicated in the margins.
0.2% NP40 (lane 13) had little or no effect. From these results, it was concluded that the independent addition of specific amounts of at least three different types of cosolvents is capable of facilitating DNA synthesis within the G + C-rich repeat sequence. To determine whether cosolvent addition could enable the production of single-site mutations in HSV-1 DNA, a PCR-based site-specific mutagenesis strategy was followed (Fig. 3). This system required the use of four independent oligonucleotide primers; two ‘outside primers’ and two internal ‘mutant primers’. The ‘outside primers’ contain sequences that are distal to the site which is to be mutated. In this series of experiments we used the T7 and SP6 primers which hybridize to sites just outside of the plasmid polylinker (Fig. 1). The ‘mutant primers’ overlap the site to be mutated on both strands; they are of identical lengths and contain complementary nucleotide substitutions (R77Gfor, 5%CGGTGGCCGTGGCGCCCCCCGGA and R77G-rev, 5%-TCCGGGGGGCGCCACGGCCACCG). The design of the mutant oligonucleotides was such that, in addition to mutating the Arg77 to a Gly77, a novel NarI site was also introduced into the DNA.
56
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
and another PCR reaction was performed. As a control, wild type product was synthesized from the plasmid template using the SP6 and T7 primers only. The results (Fig. 4) showed that the mutagenesis strategy yielded a product (Full) which was the same size as the wild type control product (compare lanes 2 and 4). To demonstrate that the product resulting from the mutagenesis protocol contained the intended site-specific mutation, restriction endonuclease digestions of the mutant and wild type products were undertaken. Incubation of the mutant product with the enzyme NarI resulted in the conversion of the full length product (1050 bp) into 792- and 258-base pair fragments (Fig. 4, lane 1) which, as expected, are the lengths of the starting ‘left’ (lane 6) and ‘right’ (lane 5) products, respectively. No smaller products were observed with either (i) the mutant product without NarI (lane 2) or the wild type product (ii) with (lane 3) or (iii) without (lane 5) the enzyme, as expected. The entire 1050-base pair product was sequenced Fig. 3. Schematic representation of the mutagenesis strategy for the gene encoding ICP22. A complete description of the techniques, as well as the sequences of each mutant primer are found in the text. ‘Arg77’ refers to the amino acid in ICP22 which was changed to a glycine. In this study, the ‘left’ and ‘right’ outside primers were T7 and SP6, respectively (Fig. 1).
In the first step, two separate PCR reactions were carried out as described above (Fig. 2) in the presence of 5% glycerol using the appropriate combinations of outside and mutant primers (Fig. 3, line 1). These two reactions yielded two separate products (Fig. 3, line 2), which were gel purified (data not shown). In the next step, the two pure PCR products were combined, denatured, and then allowed to reanneal. The annealed products included the original ‘left’ and ‘right’ products (not shown), as well as two chimeric mixtures of the two starting fragments; only one of the chimeras possesses recessed 3% ends (Fig. 3, line 3). The chimeric products which contain a recessed 3% end were then extended upon the addition of the DNA polymerase without adding any exogenous primers (Fig. 3, line 4). Finally, fresh ‘outside primers’ (SP6 and T7) were added
Fig. 4. Digital scanning image of electrophorectically separated DNA fragments visualized after ethidium bromide staining. Wild type and mutant full-length DNA products (Full) were reacted in the presence (+) or absence (− ) of the NarI enzyme as described in the text. ‘Right’ and ‘left’ products were generated as shown in Fig. 3. Sizes (bp) of relevant molecular weight markers (mw) are indicated in the right margin.
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
to confirm the existence of the intended mutation and the fidelity of the flanking sequences (data not shown) and based on all of these results it is concluded that our system successfully converted the wild type sequence into the intended mutant genotype. The use of this protocol for herpesviral research is supported by the fact that we have now used this strategy to successfully place several specific mutations into various loci of the HSV-1 genome (data not shown).
3. Discussion From these data, it is concluded that our experimental strategy resulted in the successful placement of a specific site-directed mutation in the Us1 gene despite the presence of a proximal tract containing a high G+ C content. The addition of cosolvents into the DNA synthesis reaction seems to be sufficient to overcome the unique properties of the HSV-1 genome which might otherwise prevent polymerization. It is likely that the presence of a high G + C content and, perhaps, other undefined sequence-dependent factors in HSV-1 DNA creates a unique biomolecule which is either resistant to the effects of high temperature denaturation or capable of adopting and maintaining an altered structure during the manipulations, thus blocking the processivity of the polymerase. Supplementing the reaction with cosolvents may rearrange the architecture of HSV-1 DNA into a context that is favorable for DNA synthesis. Previously, segments of HSV-1 DNA derived from the inverted repeats were shown to adopt unorthodox secondary DNA conformations (Wohlrab et al., 1987; Wohlrab and Wells, 1989) and it is conceivable that such anisomorphic confirmations, which are characteristically rigid structures, may have existed during our analyses. The observation that a 150-base pair fragment was produced in the absence of cosolvents (Fig. 2, lane 3) is consistent with a model in which such an ansiomorphic structure may have contributed to the inhibition of polymerase processivity. The potential presence of an ansiomorphic structure in the DNA template may have caused the poly-
57
merase to either pass over the structure or remove it through its 3% to 5% exonuclease activity thus culminating in the production of the 150-base pair band. In light of this observation that a portion of HSV-1 DNA seems inaccessible to a core polymerase (Taq) under standard DNA synthesis conditions, it is not surprising that the HSV-1 viral polymerase complex requires a number of additional viral factors to facilitate the synthesis of viral DNA through any potential unusual DNA structures (Challberg, 1986). A thorough understanding of the particular behavior of HSV-1 DNA as a biomolecule may prove to be advantageous in facilitating the development of appropriate diagnostic assays which detect viral nucleic acids either by PCR or ELOSA (enzyme linked oligosorbant assay). It is hoped that the above findings will enable future site-specific mutational analyses of portions of the HSV-1 genome which have been traditionally unamenable to genetic manipulations.
Acknowledgements These studies were supported in part by grants from the United States Public Health Service (AI38873), the American Cancer Society (JFRA 634), and an unrestricted grant from the National Foundation for Infectious Diseases. J.A.B. is a Markey Research Fellow and thanks the Lucille P. Markey Charitable Trust for their support. J.P. was supported, in part, by a City University of New York (CUNY) predoctoral fellowship.
References Blaho, J.A., Mitchell, C., Roizman, B., 1993. Guanylylation and adenylylation of the a regulatory proteins of herpes simplex virus require a viral b or g function. J. Virol. 67, 3891 – 3900. Blaho, J.A., Zong, C., Mortimer, K.A., 1997. Tyrosine phosphorylation of the herpes simplex type 1 regulatory protein ICP22 and a cellular protein which shares antigenic determinants with ICP22. J. Virol. 71, 9828 – 9832. Challberg, M.D., 1986. A method for identifying the viral genes required for herpesvirus DNA replication. Proc. Natl. Acad. Sci. USA 83, 9094 – 9098.
58
J. Paragas, J.A. Blaho / Journal of Virological Methods 73 (1998) 53–58
McGeoch, D.J., Dolan, A., Donald, S., Rixon, F.J., 1985. Sequence determination and genetic content of the short unique region in the genome of herpes simplex virus 1. J. Mol. Biol. 181, 1 – 13. McGeoch, D.J., Dolan, A., Donald, S., Brauer, D.H.K., 1986. Complete DNA sequence of the short repeat region in the genome of herpes simplex type 1. Nucleic Acids Res. 14, 1727 – 1745. McGeoch, D.J., Dalrymple, M.A., Davidson, A.J., Dolan, A., Frame, M.C., McNab, D., Perry, L.J., Scott, J.E., Taylor, P., 1988. The complete sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69, 1531 – 1574. Mitchell, C., Blaho, J.A., McCormick, A.L., Roizman, B., 1997. The nucleotidylylation of the herpes simplex virus 1 regulatory protein a22 by human casein kinase II. J. Biol. Chem. 272, 25394 – 25400. Poffenberger, K.L., Raichlen, P.E., Herman, R.C., 1993. In vitro characterization of a herpes simplex type 1 ICP22 deletion mutant. Virus Genes 7, 171–186. Poffenberger, K. L, Idowa, A.D., Fraser-Smith, E.B., Raiblen, P.E., Herman, R.C., 1994. A herpes simplex virus type 1 ICP22 deletion mutant is altered for virulence and latency in vivo. Arch. Virol. 139, 111–119. Post, L.E., Roizman, B., 1981. A generalized technique for deletion of specific genes in large genome; a22 of herpes simplex virus 1 is not essential for growth. Cell 25, 227– 232.
.
Rice, S.A., Long, M.C., Lam, V., Schaffer, P.A., Spencer, C.A., 1995. Herpes simplex virus immediate-early protein ICP22 is required for viral modification of host RNA polymerase II and establishment of the normal viral transcription program. J. Virol. 69, 5550 – 5559. Roizman, B., Sears, A., 1996. Herpes simplex viruses and their replication. In Fields, B.N., Knipe, D.M. (Eds.), Virology, 3rd edn. Lippincott-Raven, Philadelphia, pp. 2231 – 2295. Sears, A.E., Halliburton, I.W., Meignier, B., Silver, S., Roizman, B., 1985. Herpes simplex virus 1 mutant deleted in the a22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice. J. Virol. 55, 338 – 346. Wadsworth, S., Jacob, R.J., Roizman, B., 1975. Anatomy of herpes simplex virus DNA. II. Size, composition, and arrangement of inverted terminal repetitions. J. Virol. 15, 1487 – 1497. Wohlrab, F., Wells, R.D., 1989. Slight changes in conditions influence the family of non-B-DNA conformations of the herpes simplex virus type 1 DR2 repeats. J. Biol. Chem. 264, 8207 – 8213. Wohlrab, F., McLean, M.J., Wells, R.D., 1987. The segment inversion site of herpes simplex virus type 1 adopts a novel DNA structure. J. Biol. Chem. 262, 6407 – 6416. Wilcox, K.W., Kohn, A., Sklyanskaya, E., Roizman, B., 1980. Herpes simplex virus phosphoproteins. I. Phosphate cycle on and off some viral polypeptides and can alter their affinity for DNA. J. Virol. 33, 167 – 182.