Could CYP24A1 promoter methylation status affect the gene expression in the colorectal cancer patients?

Meta Gene 24 (2020) 100656

Contents lists available at ScienceDirect

Meta Gene journal homepage: www.elsevier.com/locate/mgene

Could CYP24A1 promoter methylation status affect the gene expression in the colorectal cancer patients?

T

Hossein Sadeghia,b,c, Ehsan Nazemalhosseini-Mojaradb, Vahid Reza Yassaeec, Sanaz Savabkarb, ⁎⁎ ⁎ Majid Ghasemiand, Hamid Asadzadeh Aghdaeie, , Mohammad Reza Zalib, Reza Mirfakhraiea,c, a

Department of Medical Genetics, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Department of Gastrointestinal Cancer, Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran c Molecular Genetics Department, Genomic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran d Student Research Committee, Department of Clinical Biochemistry, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran e Department of Molecular Biology, Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran b

A R T I C LE I N FO

A B S T R A C T

Keywords: Colorectal cancer (CRC) Methylation CYP24A1, expression analysis

CYP24A1 up-regulation has been reported in different cancers, including colorectal cancer (CRC). CYP24A1 initiates the degradation of 1, 25-dihydroxyvitamin D3 and is a candidate biomarker for the progression and prognosis of CRC. Despite many studies for discovering the exact mechanism underlying the CYP24A1 overexpression, the results are inconsistent. The present study aimed to determine whether the promoter methylation status of the CYP24A1 gene is the cause of CYP24A1 overexpression in CRC patients. In this regards, after quantification of the CYP24A1 expression by quantitative real-time polymerase chain reaction (qRT-PCR), we measured the methylation status of the CYP24A1 promoter region by methylation-specific PCR (MSP) in 50 cases of fresh human colorectal cancer and 34 paired adjacent tissues. CYP24A1 was overexpressed in the CRC tissues (Fold change = 17.2, P=0.001); however, we didn't find any significant differences regarding the CYP24A1 promoter methylation status between the CRC samples and the paired adjacent tissues. We concluded that the CYP24A1 promoter hypomethylation is not the reason for the gene up-regulation in our CRC patients; therefore, other mechanisms involved in the CYP24A1 overexpression should be investigated.

1. Introduction Colorectal cancer (CRC) is a serious health concern affecting over 1.8 million individuals in 2018 and is the second‑leading cause of cancer-related death worldwide (Bray et al., 2018). One of the most important altered pathways in colorectal cancer is vitamin D metabolism pathway. Vitamin D reduces epithelial cell proliferation and promotes differentiation in human colon cancer (González-Sancho et al., 2006). According to the meta-analysis study conducted by Yin L et al. serum 25(OH)D is inversely related to CRC risk (Yin et al., 2009). Cyp24a1 enzyme is a member of the cytochrome P450 superfamily encoded by the CYP24A1 gene and initiates the degradation of the physiologically active form of vitamin D, 1,25(OH)2D3. CYP24A1 up-

regulation has been observed in different cancers, including CRC (Jones et al., 2012). Several studies have been conducted to understand the cause of CYP24A1 gene expression alteration, but the exact mechanism is not fully understood. Some of the suggested mechanisms are including, the gain of 20q13 (the CYP24A1 locus), single nucleotide polymorphisms, and epigenetic modifications in and around the CYP24A1 gene body (Höbaus et al., 2013a; Fang et al., 2010; Roff and Wilson, 2008). DNA methylation at the cytosine residues is the main epigenetic mechanism in human. This alteration has profound effects on the gene expression in many cancers by interfering with the transcriptional machinery (Jaenisch and Bird, 2003; Lewandowska and Bartoszek, 2011; Sarkar et al., 2013). Alteration the transcription affinity for the binding site may change the transcription activity.

⁎ Correspondence to: R. Mirfakhraie, Department of Medical Genetics, School of Medicine, Shahid Beheshti University of Medical Sciences, Koodakyar St., Velenjak Ave, Chamran Highway, Terhan 19395-4719, Iran. ⁎⁎ Correspondence to: H. A. Aghdaei, Department of Molecular Biology, Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Aerabi St., Yemen St., Chamran Highway, Tehran 1985717411, Iran. E-mail addresses: [email protected] (H.A. Aghdaei), [email protected] (R. Mirfakhraie).

https://doi.org/10.1016/j.mgene.2020.100656 Received 15 August 2019; Received in revised form 9 January 2020; Accepted 22 January 2020 Available online 23 January 2020 2214-5400/ © 2020 Elsevier B.V. All rights reserved.

Meta Gene 24 (2020) 100656

H. Sadeghi, et al.

Table 1 qRT-PCR primer sequences. Genes

Forward primer

Reverse primer

Amplicon size (bp)

CYP24A1 Beta-2-microglogulin

CATTTGGCTCTTTGTTGGATTGTC TGTCTTTCAGCAAGGACTGGT

CACCATCTGAGGCGTATTATCG TGCTTACATGTCTCGATCCCAC

145 143

A260/A280 ratio. First-strand cDNA was synthesized from 1 μg of the extracted total RNA using a Revert Aid First-Strand cDNA Synthesis Kit with random primers according to manufacturer-provided instruction (Thermo Fisher Scientific, USA).

Furthermore, methylation of the cytosine residues in the gene promoter region affects the transcription factor (TF) binding affinity (Lewandowska and Bartoszek, 2011). The promoter region of the CYP24A1 has a large CpG island (Höbaus et al., 2013b), and several transcription factors were predicted to be located in this region, including tripartite motif-containing 28 (TRIM28) and transcription factor AP-2 gamma (TFAP2C) (Lesurf et al., 2015). The up-regulation of the TRIM28 and TFAP2C is reported in cancers, including colorectal cancer (Czerwińska et al., 2017; Wang et al., 2018). In this study, we selected the critical region1, the binding site for TRIM28, and the critical region2, the binding site for TFAP2C, in the CpG island of CYP24A1 promoter and seek another possible reason for CYP24A1 overexpression by assessment of methylation status in these regions in CRC patients.

2.3. DNA extraction Genomic DNA was extracted from colorectal tissues using a GeneAll Exgene™ Cell SV Kit (GeneAll Biotechnology, Seoul, Korea) according to manufacturer's instructions. The quality and quantity of the DNA were estimated using NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific, USA). 2.4. Quantitative real-time PCR (qRT-PCR) condition and gene expression analysis

2. Materials and methods The qRT-PCR analysis was performed on an ABI StepOnePlus™ RealTime PCR System (Applied Biosystems, Foster City, CA) using 2.0× RealQ-PCR Master Mix® with SYBR Green (Ampliqon, Odense, Denmark). The primer sets for CYP24A1 and Beta-2-microglobulin (β2M) genes were designed by Allele ID 6 software (Premier Biosoft, Palo Alto, USA) (Table 1). Each reaction consisted of 10 μl 2× RealQ-PCR Master Mix®, 1 μl cDNA (10 ng), 1 μl of each primer (10 pmol) and 7 μl of nuclease-free water to conduct PCR in a 20 μl of reaction mixture. We carried out the reactions in duplicate and β2M gene was used as normalization control. This gene was selected according to previous research for identification of housekeeping control genes in colorectal cancer (Kheirelseid et al., 2010). The cycling condition was: initial denaturation at 95 °C for 15 min, 40 cycles of denaturation at 95 °C for 15 s and annealing and extension at 60 °C for 1 min, followed by the melt curve stage assessment. The melting curve profile and agarose gel electrophoresis were performed to verify the specificity of primers and the authenticity of the PCR products.

2.1. Patients and tissue specimens collection The present study conforms to the Declaration of Helsinki regarding research involving human subjects and was approved by the Ethics Committee of the Shahid Beheshti University of Medical Sciences (SBMU) (Code: IR.SBMU. MSP.REC.1396.754). Written consent was obtained from all patients who were informed that the data would be used for research. CRC was confirmed based on clinical examination, colonoscopy, and histopathology tests on isolated biopsies by an experienced pathologist. We excluded the patients who had received any therapy before surgery and the patients suffering from other cancers or the diseases affecting the digestive system. A total of 50 cases of fresh human colorectal cancer and 34 paired adjacent tissues were collected from the Institute for Gastroenterology and Liver Diseases between February 2017 and February 2018 (Shahid Beheshti University of Medical Sciences). Tumor samples were taken from the CRC tissue during the surgical procedure. All samples were immediately frozen in liquid nitrogen and stored at −80 °C.

2.5. Modification with sodium bisulfite and methylation-specific PCR 2.2. RNA extraction and reverse transcription We used methylation-specific PCR (MSP) to measure DNA methylation. MSP requires the use of two sets of primer, M primer for the methylated DNA and U primer for unmethylated DNA. Primers were designed in the locations of CpG islands in the promoter region of the CYP24A1 gene, according to MethyPrimer (http://www.urogene.org/ cgi-bin/methprimer/methprimer.cgi) (Table 2). Bisulfite treatment was carried out using 1000 ng of extracted DNA with the EpiTect Bisulfite Kit (Qiagen) according to the manufacturer's instructions. In this

Total RNA was directly extracted from the colorectal tissues using a GeneAll Hybrid-R™ RNA purification kit (Geneall Biotechnology Co. Ltd., Seoul, Korea) as described by the manufacturer's protocol. RNA was visualized on 1% agarose gel to evaluate the RNA integrity. Additionally, the quantity and the quality of the total extracted RNA was estimated using NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific, USA). The RNA purity was evaluated according to the Table 2 Primers and conditions for the Methylation-specific PCR (MSP). Name

Name1

Primer sequence

Amplicon size (bp)

Site

Region 1

MF1primer MR1primer UF1primer UR1primer MF1primer MR1primer UF1primer UR1primer

5′-ATTATCGTAAAGAAGGTTACGGGT-3′ 5′-CTCATCAAATCTAACCGCAT-3′ 5′-TTATTGTAAAGAAGGTTATGGG-3′ 5′-CAAACTCATCAAATCTAACCACAT-3′ 5′- GATAGGAGGAAACGTAGCGTTAG −3′ 5′- CCTCTAAAATCTAACTAAAACCACGAA −3′ 5′- GGATAGGAGGAAATGTAGTGTTAG −3′ 5′- CCTCTAAAATCTAACTAAAACCACAAAAA −3′

80

+1044 +1124 +1045 +1128 +10 +90 +9 +90

Region 2

83 80 81

MF: methyl forward; MR: methyl reverse; UF: un-methyl forward; UR: un-methyl reverse; Ta: annealing temperature. 2

Ta

59 °C

61 °C

Meta Gene 24 (2020) 100656

H. Sadeghi, et al.

method, all non-methyl cytosines are converted to uracils, while methylated cytosines remained unaffected. Bisulfite-modified EpiScope® Methylated HCT116 gDNA (TaKaRaBio, Shiga, Japan), which was highly methylated by CpG methylase, and EpiScope® Unmethylated HCT116 DKO gDNA (TaKaRaBio), which is genetically lacking both of methyltransferases DNMT1 (DNA methyltransferase 1) and DNMT3B (DNA methyltransferase 3B) were used as a positive control and a negative control, respectively. MSP was carried out with a total volume of 25 μl, containing 12.5 μl Taq DNA Polymerase 2× Master Mix Red (Amplicon, Denmark), 1 μl each primer (10 pmol), 2 μl genomic DNA containing 100–200 ng DNA and 8.50 μl PCR grade water. Amplification was carried out on a GeneTouch (BIOER, China). The cycling conditions were: initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing temperature as in Table 2 for 1 min and extension at 72 °C for 1 min, and a final elongation step at 72 °C for 5 min. PCR products were separated by 2% agarose gel electrophoresis containing RedSafe (iNtRON, Korea) in 0.5× TBE.

Table 4 Relationship between CYP24A1 promoter methylation region 1 and clinicopathological characteristics in patients with CRC. χ2

P value

17 12

0.44

0.66

12 9

16 13

0.82

0.37

29 21

14 7

15 14

1.11

0.29

37 13

14 7

22 7

051

0.47

Clinicopathological characteristics

n

Unmethylated

Methylated

Total Sex Male Female Age ≥57 < 57 Stage I & II III & IV Location Colon Rectum

50

21

29

28 22

11 10

28 22

Table 5 Relationship between CYP24A1 promoter methylation region 2 and clinicopathological characteristics in patients with CRC.

2.6. Statistical analysis The qRT-PCR amplification efficiency was assessed using LinRegPCR software (version: 2017.1) and for each sample, the cycle threshold (Ct) and mean PCR efficiencies were determined. The relative gene expression was determined according to the Pfaffl method (Pfaffl, 2001). We analyzed the experimental data using GraphPad Prism 7.0 (GraphPad Software, La Jolla, CA). The expression data (ΔCt values) were examined for normality with the Kolmogorov–Smirnov test. Paired t-tests were calculated on mRNA expression data for tumor samples and respective adjacent mucosa samples from the same patient. The χ2 test was used to compare the methylation patterns between the two groups. P < .05 was considered statistically significant. 3. Results

χ2

P value

4 4

0.14

0.71

25 17

3 5

1.32

0.25

29 21

26 16

3 5

1.64

0.20

37 13

31 11

6 2

0.005

0.94

Clinicopathological characteristics

n

Unmethylated

Methylated

Total Sex Male Female Age ≥57 < 57 Stage I & II III & IV Location Colon Rectum

50

42

8

28 22

24 18

28 22

3.1. CYP24A1 expression levels in colorectal cancer tissues status of the CYP24A1 promoter regions 1 and 2. Totally, CYP24A1 gene was overexpressed in the CRC tissues compared to the adjacent tissues with a fold change of 17.2 (P = .001), however; the gene was not expressed in all of the tissue samples.

4. Discussion CYP24A1 catabolizes the 1,25(OH)2D3 and is aberrantly expressed in the CRC and inflammatory bowel disease. The gene overexpression is suggested to be involved in the colorectal carcinogenesis (Kheirelseid et al., 2010). To date, a growing body of literature has recommended the CYP24A1 as a potential prognostic biomarker in colorectal cancer (Sun et al., 2016; Horváth et al., 2010). Copy number gain at 20q13 (the CYP24A1 locus), single nucleotide polymorphisms, and epigenetic modifications are supposed to be the cause of CYP24A1 overexpression in several tumors (Höbaus et al., 2013a; Fang et al., 2010; Roff and Wilson, 2008; Anderson et al., 2006). We recently showed that the polymorphisms in CYP24A1 gene or miRNAs that target the CYP24A1 may affect the risk of colorectal cancer (Sadeghi et al., 2019a; Sadeghi et al., 2019b). Therefore, we investigated whether the epigenetic mechanisms could explain the differences in the expression of CYP24A1 in the colon cancer cells. According to the UCSC database, the CpG island in the CYP24A1 promoter contains two regions, R1 and R2, for binding of TF2AC and TRIM28 TFs, respectively (Lesurf et al., 2015). Therefore, it may be postulated that the hypomethylation of these regions results in the CYP24A1 overexpression due to the alteration in the binding affinity of the related TFs. TRIM28 is the potential epigenetic regulator that promotes cell metastasis and is involved in the regulation of the dynamic organization of chromatin structure (Wei et al., 2016). TRIM28 forms a complex with histone deacetylase 1 (HDAC1), heterochromatin protein 1 (HP1), and the histone methyltransferase SETDB1. This transcription factor is a scaffold that is targeted by KRAB-

3.2. Methylation status of CYP24A1 promoter Methylation status of the CYP24A1 promoter region was investigated by MSP in the subjects with colorectal cancer and the paired adjacent tissues. Region 1 is located upstream to the transcription start site, and the results indicated that there was no significant difference regarding DNA methylation in this region between the case and control groups (P = .85) (Table 3). Furthermore, the prevalence of methylation in the region 2 was only 16% in the CRC group and 11.8% in the control group without any significant differences (P = .59) (Table 3). MSP results revealed that the CYP24A1 was methylated in 58% (29/50) and 16% (8/50) of CRC tissues in the promoter regions 1 and 2, respectively. According to Tables 4 and 5, we didn't find any significant differences between clinicopathological characteristics and methylation Table 3 The frequency of CYP24A1 promoter methylation in the region 1 and 2 in CRC patient and healthy adjacent control. Region

Methylation status

Case, n (%)

Control, n (%)

1

Unmethylated Methylated Unmethylated Methylated

21 29 42 8

15 19 30 4

2

P

0.85 0.59

3

Meta Gene 24 (2020) 100656

H. Sadeghi, et al.

ZFPs to specific loci and coordinates both histone methylation and HP1 proteins deposition to make gene silencing (Schultz et al., 2002). Deletion of the TRIM28 gene from the maternal germline makes severe phenotypic and epigenetic variabilities (Messerschmidt et al., 2012). Our results showed that there were no significant differences regarding DNA methylation in this region between the case and control groups (P = .85). TFAP2C overexpression is associated with the proliferation and progression of cancer (Kim et al., 2016). TFAP2C is robustly overexpressed in colorectal cancer and is a novel prognostic factor in CRC patients (Yu et al., 2019). Our results showed that there are no significant differences regarding DNA methylation in this region between the case and control groups (P = .59). Other studies, in contrast with the results of our research, have shown that the CYP24A1 expression is inversely correlated with the promoter methylation in various diseases such as colorectal cancer, prostate cancer, lung adenocarcinoma, and preeclampsia (Höbaus et al., 2013b; Luo et al., 2010; Deeb et al., 2011; Novakovic et al., 2009; Ramnath et al., 2014). Luo W et al, by using bisulfite pyrosequencing, showed that the CYP24A1 hypermethylation in the malignant prostate lesions results in the reduction of the CYP24A1 expression in the malignant prostate lesions compared with adjacent histologically benign lesions (Luo et al., 2010). In the animal study, methylation was the reason of the CYP24A1 lack of expression in mouse tumor-derived endothelial cells and rat osteoblastic ROS17/2.8 cells (Ohyama et al., 2002; Chung et al., 2007). Despite the mentioned studies and in agreement with our findings, Höbaus J et al. didn't find any significant correlation between DNA methylation status at the promoter region and CYP24A1 overexpression in CRC. They concluded that gene amplification is the major reason for CYP24A1 up-regulation in CRC. Höbaus et al, also showed that the CYP24A1 expression level differs among CRC cell lines in a cell-dependent manner (Höbaus et al., 2013a). On the other hand, Fang Z and colleagues didn't find any positive correlation between CYP24A1 copy number gain and its mRNA overexpression (Fang et al., 2010). One of the limitations of the present study was the possible confounding factors, such as vitamin D supplementation. Vitamin D supplementation may change the CYP24A1 methylation status and hence, CYP24A1 methylation levels may predict vitamin D response variation (Zhou et al., 2014). Since each CRC patient does not receive a certain amount of vitamin D; therefore, CYP24A1 gene methylation may be variable among the subjects. In conclusion, the results of our observations showed that although CYP24A1 was up-regulated in the CRC samples, there were no differences between colorectal cancer patient tissues and the adjacent control tissues in terms of methylation status. Therefore, other factors influencing the CYP24A1 expression alteration should be investigated.

mRNA in human tumors. Cancer Chemother. Pharmacol. 57, 234–240. Bray, F., Ferlay, J., Soerjomataram, I., et al., 2018. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 68, 394–424. Chung, I., Karpf, A.R., Muindi, J.R., et al., 2007. Epigenetic silencing of CYP24 in tumorderived endothelial cells contributes to selective growth inhibition by calcitriol. J. Biol. Chem. 282, 8704–8714. Czerwińska, P., Mazurek, S., Wiznerowicz, M., 2017. The complexity of TRIM28 contribution to cancer. J. Biomed. Sci. 24, 63. Deeb, K.K., Luo, W., Karpf, A.R., et al., 2011. Differential vitamin D 24-hydroxylase/ CYP24A1 gene promoter methylation in endothelium from benign and malignant human prostate. Epigenetics 6, 994–1000. Fang, Z., Xiong, Y., Zhang, C., et al., 2010. Coexistence of copy number increases of ZNF217 and CYP24A1 in colorectal cancers in a Chinese population. Oncol. Lett. 1, 925–930. González-Sancho, J.M., Larriba, M.J., Ordóñez-Morán, P., et al., 2006. Effects of 1α, 25dihydroxyvitamin D3 in human colon cancer cells. Anticancer Res. 26, 2669–2681. Höbaus, J., Hummel, D.M., Thiem, U., et al., 2013a. Increased copy-number and not DNA hypomethylation causes overexpression of the candidate proto-oncogene CYP24A1 in colorectal cancer. Int. J. Cancer 133, 1380–1388. Höbaus, J., Fetahu, I.S., Khorchide, M., et al., 2013b. Epigenetic regulation of the 1, 25dihydroxyvitamin D3 24-hydroxylase (CYP24A1) in colon cancer cells. J. Steroid Biochem. Mol. Biol. 136, 296–299. Horváth, H.C., Lakatos, P., Kósa, J.P., et al., 2010. The candidate oncogene CYP24A1: a potential biomarker for colorectal tumorigenesis. J. Histochem. Cytochem. 58, 277–285. Jaenisch, R., Bird, A., 2003. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. 33, 245. Jones, G., Prosser, D.E., Kaufmann, M., 2012. 25-Hydroxyvitamin D-24-hydroxylase (CYP24A1): its important role in the degradation of vitamin D. Arch. Biochem. Biophys. 523, 9–18. Kheirelseid, E.A., Chang, K.H., Newell, J., et al., 2010. Identification of endogenous control genes for normalisation of real-time quantitative PCR data in colorectal cancer. BMC Mol. Biol. 11, 12. Kim, W., Kim, E., Lee, S., et al., 2016. TFAP2C-mediated upregulation of TGFBR1 promotes lung tumorigenesis and epithelial–mesenchymal transition. Exp. Mol. Med. 48, e273. Lesurf, R., Cotto, K.C., Wang, G., et al., 2015. ORegAnno 3.0: a community-driven resource for curated regulatory annotation. Nucleic Acids Res. 44, D126–D132. Lewandowska, J., Bartoszek, A., 2011. DNA methylation in cancer development, diagnosis and therapy—multiple opportunities for genotoxic agents to act as methylome disruptors or remediators. Mutagenesis 26, 475–487. Luo, W., Karpf, A.R., Deeb, K.K., et al., 2010. Epigenetic regulation of vitamin D 24hydroxylase/CYP24A1 in human prostate cancer. Cancer Res. 70, 5953–5962. Messerschmidt, D.M., de Vries, W., Ito, M., et al., 2012. Trim28 is required for epigenetic stability during mouse oocyte to embryo transition. Science 335, 1499–1502. Novakovic, B., Sibson, M., Ng, H.K., et al., 2009. Placenta-specific methylation of the vitamin d 24-hydroxylase gene implications for feedback autoregulation of active vitamin d levels at the fetomaternal interface. J. Biol. Chem. 284, 14838–14848. Ohyama, Y., Kusada, T., Yamasaki, T., et al., 2002. Extensive methylation of CpG island of CYP24 gene in osteoblastic ROS17/2.8 cells. In: Nucleic Acids Symposium Series Oxford University Press, pp. 249–250. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 29 (9), 2002–2007. Ramnath, N., Nadal, E., Jeon, C.K., et al., 2014. Epigenetic regulation of vitamin D metabolism in human lung adenocarcinoma. J. Thorac. Oncol. 9, 473–482. Roff, A., Wilson, R.T., 2008. A novel SNP in a vitamin D response element of the CYP24A1 promoter reduces protein binding, transactivation, and gene expression. J. Steroid Biochem. Mol. Biol. 112, 47–54. Sadeghi, H., Nazemalhosseini-Mojarad, E., Piltan, S., et al., 2019a. A candidate intronic CYP24A1 gene variant affects the risk of colorectal cancer. Biomark. Med 14 (1), 23–29. Sadeghi, H., Nazemalhosseini-Mojarad, E., Yaghoob-Taleghani, M., et al., 2019b. miR-30a promoter variation contributes to the increased risk of colorectal cancer in an Iranian population. J. Cell. Biochem. 120 (5), 7734–7740. Sarkar, S., Horn, G., Moulton, K., et al., 2013. Cancer development, progression, and therapy: an epigenetic overview. Int. J. Mol. Sci. 14, 21087–21113. Schultz, D.C., Ayyanathan, K., Negorev, D., et al., 2002. SETDB1: a novel KAP-1-associated histone H3, lysine 9-specific methyltransferase that contributes to HP1-mediated silencing of euchromatic genes by KRAB zinc-finger proteins. Genes Dev. 16, 919–932. Sun, H., Wang, C., Hao, M., et al., 2016. CYP24A1 is a potential biomarker for the progression and prognosis of human colorectal cancer. Hum. Pathol. 50, 101–108. Wang, X., Sun, D., Tai, J., et al., 2018. TFAP2C promotes stemness and chemotherapeutic resistance in colorectal cancer via inactivating hippo signaling pathway. J. Exp. Clin. Cancer Res. 37, 27. Wei, C., Cheng, J., Zhou, B., et al., 2016. Tripartite motif containing 28 (TRIM28) promotes breast cancer metastasis by stabilizing TWIST1 protein. Sci. Rep. 6, 29822. Yin, L., Grandi, N., Raum, E., Haug, U., Arndt, V., Brenner, H., 2009. Meta-analysis: longitudinal studies of serum vitamin D and colorectal cancer risk. Aliment. Pharmacol. Ther. 30 (2), 113–125. Yu, H., Jiang, W., Chen, G., et al., 2019. Impact of colon-specific DNA methylationregulated gene modules on colorectal cancer patient survival. Med. Sci. Monit. 25, 3549. Zhou, Y., Zhao, L.-J., Xu, X., et al., 2014. DNA methylation levels of CYP2R1 and CYP24A1 predict vitamin D response variation. J. Steroid Biochem. Mol. Biol. 144, 207–214.

Funding information Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Genomic Research Center, Shahid Beheshti University of Medical Sciences. Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgments This study has been extracted from the thesis written by Mr. Hossein Sadeghi in School of Medicine, Shahid Beheshti University of Medical Sciences (Registration no: 351). References Anderson, M.G., Nakane, M., Ruan, X., et al., 2006. Expression of VDR and CYP24A1

4