- Email: [email protected]
Coxiella symbiont in the tick Ornithodoros rostratus (Acari: Argasidae)
Ticks and Tick-borne Diseases 3 (2012) 203–206
Contents lists available at SciVerse ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.de/ttbdis
Original article
Coxiella symbiont in the tick Ornithodoros rostratus (Acari: Argasidae) Aliny P. Almeida a , Arlei Marcili a , Romario C. Leite b , Fernanda A. Nieri-Bastos a , Luísa N. Domingues b , João Ricardo Martins c , Marcelo B. Labruna a,∗ a b c
Dept. of Preventive Veterinary Medicine and Animal Health, Faculty of Veterinary Medicine, University of São Paulo, São Paulo, SP, Brazil Dept. of Preventive Veterinary Medicine, School of Veterinary, Federal University of Minas Gerais, Belo Horizonte, MG, Brazil Institute of Veterinary Research “Desidério Finamor”, Fundac¸ão Estadual de Pesquisa Agropecuária, Eldorado do Sul, RS, Brazil
a r t i c l e
i n f o
Article history: Received 30 November 2011 Received in revised form 10 February 2012 Accepted 24 February 2012 Keywords: Soft ticks Coxiella Ornithodoros rostratus Symbiont Brazil
a b s t r a c t In the present study, the presence of tick-associated bacteria and protozoa in Ornithodoros rostratus ticks (adults, nymphs, and eggs) from the Pantanal region of Brazil were determined by molecular detection. In these ticks, DNA from protozoa in the genera Babesia and Hepatozoon, and bacteria from the genera Rickettsia, Borrelia, Anaplasma, and Ehrlichia were not detected. Conversely, all tested ticks (100%) yielded PCR products for 3 Coxiella genes (16S rRNA, pyrG, cap). PCR and phylogenetic analysis of 3 amplified genes (16S rRNA, pyrG, cap) demonstrated that the agent infecting O. rostratus ticks was a member of the genus Coxiella. This organism grouped with Coxiella symbionts of other soft tick species (Argasidae), having different isolates of C. burnetii as a sister group, and these 2 groups formed a clade that grouped with another clade containing Coxiella symbionts of hard tick species (Ixodidae). Analysis of tick mitochondrial 16S rRNA gene database composed mostly of tick species previously shown to harbor Coxiella symbionts suggests a phylogenetic congruence of ticks and their Coxiella symbionts. Furthermore, these results suggest a very long period of coevolution between ticks and Coxiella symbionts and indicates that the original infection may have occurred in an ancestor common to the 2 main tick families, Argasidae (soft ticks) and Ixodidae (hard ticks). However, this evolutionary relationship must be confirmed by more extensive testing of additional tick species and expanded populations. © 2012 Elsevier GmbH. All rights reserved.
Introduction The Gammaproteobacterium Coxiella burnetii is the causative agent of acute Q fever and chronic endocarditis in humans worldwide, including Brazil (Siciliano et al., 2008; Lemos et al., 2011), where the agent is transmitted mostly by aerosol route or ingestion of infected animal fomites (Maurin and Raoult, 1999). C. burnetii is an obligately intracellular, Gram-negative bacterium that often resides in the phagolysosome of infected mammalian cells. Besides C. burnetii, a number of different tick species of both Argasidae (soft ticks) and Ixodidae (hard ticks) families have been reported to harbor microbes related to C. burnetii (Mediannikov et al., 2003; Reeves et al., 2006; Klyachko et al., 2007; Machado-Ferreira et al., 2011). Although more than 40 tick species can be infected with C. burnetii, direct transmission of this agent to humans from infected ticks has never been documented. Ticks may play a significant role in the transmission of C. burnetii among wild vertebrates (Maurin and Raoult, 1999; Kazar, 2005); however, except for C. burnetii, there is
∗ Corresponding author at: Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, Av. Prof. Orlando Marques de Paiva 87, Cidade Universitária, São Paulo 05508-270, SP, Brazil. Tel.: +55 11 3091 1394; fax: +55 11 3091 7928. E-mail address: [email protected] (M.B. Labruna). 1877-959X/$ – see front matter © 2012 Elsevier GmbH. All rights reserved. doi:10.1016/j.ttbdis.2012.02.003
no evidence that demonstrates that such Coxiella-related organisms cause disease in humans or other vertebrate hosts. Hence, these Coxiella-related organisms are thought to be highly prevalent tick endosymbionts that are maintained transovarially (Klyachko et al., 2007; Machado-Ferreira et al., 2011). The soft tick Ornithodoros rostratus (Acari: Argasidae) is known to occur in northern Argentina, Paraguay, Bolivia, and western Brazil (Aragão, 1936; Nava et al., 2007). In Brazil, O. rostratus was recently reported in a Pantanal area of the state of Mato Grosso do Sul, where it was associated with several domestic animals (cattle, horses, pigs), and was also reported to be an important human biting tick (Aragão, 1936; Canc¸ado et al., 2008). Within this context, the present study searched by molecular methods for the presence of tick-associated bacteria and protozoa in O. rostratus ticks from the Pantanal region of Brazil.
Materials and methods In March 2009, Ornithodoros ticks were collected from the environment at the Nhumirim farm, in the central area of the Brazilian Pantanal, state of Mato Groso do Sul (18◦ 59 S; 56◦ 39 W). Ticks were collected by CO2 traps armed on the sandy soil inside a cattle ranch, as previously described (Canc¸ado et al., 2008). Ecological
Labruna et al. (2004) Breitschwerdt et al. (1998) Stromdahl et al. (2003) Stromdahl et al. (2003) Reeves et al. (2006) Reeves et al. (2006) Masuzawa et al. (1997) This paper 401 360 665 354 504 601 1457 532 50 62 60 60 55 55 58 58 Used in a nested reaction.
GCAAGTATCGGTGAGGATGTAAT GTTAGTGGCAGACGGGTGAGT ACATATTCAGATGCAGACAGAGGT CTTTGATCACTTATCATTCTAATAGCa TTATTTACCAACGTTCCTGAGCCG ATTTAGTGGGTTTCGCGCAT ATTGAAGAGTTTGATTCTGG GGGGAAGAAAGTCTCAAGGGTAATATCCTT gltA 16S rRNA fla fla pyrG cap 16S rRNA 16S rRNA
a
551 574 58 50 GCTTGAAACACTCTARTTTTCTCAAAG ACAATAAAGTAAAAAACAYTTCAAAG
Reverse
CCGTGCTAATTGTAGGGCTAATACA GGTAATTCTAGAGCTAATACATGAGC
Forward
18S rRNA 18S rRNA
GCTTCCTTAAAATTCAATAAATCAGGAT TATAGGTACCGTCATTATCTTCCCTAT GCAATCATAGCCATTGCAGATTGT AACAGCTGAAGAGCTTGGAATGa TTTATCCCGAGCAAATTCAATTATGG CATCAGCATACGTTTCGGGAA CGGCTTCCCGAAGGTTAG TGCATCGAATTAAACCACATGCTCCACCGC
Reference Amplicon size (nt) Annealing temp. (◦ C) Primer sequence (5 –3 )
Babesia spp. Hepatozoon spp. Rickettsia spp. Anaplasmataceae Borrelia spp. Borrelia spp. Coxiella spp. Coxiella spp. Coxiella spp. Coxiella spp.
Amplicons were not generated from the O. rostratus ticks by the PCR assays targeting the protozoa genera Babesia and Hepatozoon
Gene
Results
Target organisms
details of the study region have also been previously described by Canc¸ado et al. (2008). Live ticks were brought to the laboratory and taxonomically identified (Barros-Battesti et al., 2006) as 20 nymphs, 8 females, and 5 males of Ornithodoros rostratus Aragão. All 20 nymphs and 3 females were separated for molecular analyses (described below), and the remaining adults were used to form a laboratory colony. Ticks were fed on tick-naïve rabbits; then engorged ticks were transferred to an incubator and maintained at 25 ◦ C and 85% relative humidity. In the laboratory, ticks were subjected individually to DNA extraction by the guanidine isothiocynate-phenol technique (Sangioni et al., 2005), and tested by a battery of PCR assays targeting protozoa of the genera Babesia and Hepatozoon, and bacteria of the genera Rickettsia, Borrelia, and Coxiella, and the family Anaplasmataceae (genera Anaplasma and Ehrlichia). PCR was performed with genus-specific primers shown in Table 1. In each PCR assay, negative controls (water) and an appropriate positive control sample (DNA of Babesia canis, Hepatozoon canis, Rickettsia parkeri, Borrelia anserina, C. burnetii, or Ehrlichia canis) were run together with the O. rostratus DNA samples. PCR products of the expected size for each assay were purified with ExoSap (USB) and sequenced in an automatic sequencer (Applied Biosystems/PerkinElmer, model ABI Prism 310 Genetic, Foster City, CA) according to the manufacturer’s protocol, using the same primers (forward and reverse) used for the PCR. Partial sequences obtained were submitted to BLAST analysis (Altschul et al., 1990) to determine the closest similarities in GenBank. Partial sequences of 3 Coxiella genes (16S rRNA, pyrG, cap) generated in the present study were aligned by Clustal X (Thompson et al., 1997) and manually refined by Genedoc (Nicholas et al., 1997) with corresponding Coxiella sequences available in GenBank. The 16S rRNA gene was analyzed separately, while pyrG and cap were concatenated and then aligned. The bacterial 16S rRNA gene was chosen in this study because it is the most widely employed gene for primary identification of tick symbionts; pyrG and cap were used because they were recently used for molecular characterization of a Coxiella symbiont of soft ticks (Reeves et al., 2006). Two phylogenetic trees (one for the 16S rRNA gene and one for pyrG-cap) were constructed by the parsimony method using Paup *4.0b10 software (Swofford, 2002). Corresponding sequences of Legionella pneumophila or L. longbeachae were included as outgroup. Confidence values for individual branches of the resulting trees were determined by bootstrap analysis with 1000 replicates. Three egg pools (each containing 20 eggs) derived from 3 different females, and 10 individual eggs were taken from the O. rostratus colony and subjected to DNA extraction as described above. These samples were tested by PCR targeting the 3 Coxiella genes listed in Table 1. PCR products generated from 6 individual eggs were purified and sequenced as described above. Tick DNA was also tested by PCR targeting the 16S rRNA mitochondrial gene, as previously described (Mangold et al., 1998). The PCR products of 2 ticks (1 female, 1 nymph) were DNA-sequenced as described above, and the resulting sequence was submitted to BLAST analysis in order to certify the taxonomic identification of the tick. In addition, a phylogenetic tree using the same methods described above was constructed based on the alignment of tick mitochondrial 16S rDNA sequences of the tick species (and a few close-related species) from which Coxiella symbionts have been reported. The sequence of Allothyridae (a tick sister group) was included as an outgroup.
This paper This paper
A.P. Almeida et al. / Ticks and Tick-borne Diseases 3 (2012) 203–206
Table 1 PCR primers used to test DNA extracts of Ornithodoros rostratus from Pantanal, State of Mato Grosso do Sul, Brazil.
204
A.P. Almeida et al. / Ticks and Tick-borne Diseases 3 (2012) 203–206
205
Fig. 1. (A) Molecular phylogenetic analysis of the Coxiella agent of Ornithodoros rostratus from Brazil. A total of 987 aligned nucleotide sites of the 16S rRNA bacterial gene was subjected to analysis. (B) Molecular phylogenetic analysis of hard and soft ticks from which Coxiella symbionts have been reported. A total of 406 aligned nucleotide sites of the tick mitochondrial 16S rRNA gene were subjected to analysis. Bootstrap values under 1000 replicates are shown at the nodes. Numbers in brackets are GenBank accession numbers. Scale bars indicate nucleotide substitutions per site.
and bacterial genera Rickettsia, Borrelia, Anaplasma, and Ehrlichia, although positive control samples always yielded visible amplicons of the expected size. On the other hand, all 23 ticks (20 nymphs, 3 females) and all egg samples (3 pools and 10 individual eggs) yielded PCR products for the 3 Coxiella genes (16S rRNA, pyrG, cap) tested. In addition, the 23 ticks yielded products by the tick mitochondrial 16S rRNA PCR, from which sequences generated from 2 ticks were identical to each other and 98.7% (368/373-bp) identical to the corresponding sequence of O. rostratus from Argentina (DQ295780), available in GenBank. DNA sequences were generated from the PCR products of all 20 nymphs, 3 females, and 2 eggs for the Coxiella cap as well as from 10 nymphs and 2 eggs for pyrG and from 2 females and 2 eggs for the 16S rRNA gene. Considering each of the 3 genes separately, all sequences were identical to each other. By Blast analysis, the partial sequence of the 16S rRNA gene was closest (97.0%; 1415/1459) to a Coxiella symbiont of O. moubata (AB001521), and 98.8% (1200/1215) identical to the corresponding sequence of C. burnetii (CP001019). The cap partial sequence was 94.2% (502/533) identical to the corresponding sequence of a Coxiella symbiont of Carios capensis (=Ornithodoros capensis) (DQ150580) and 95.2% (494/519) identical to C. burnetii (CP001020); and the pyrG partial sequence was 96.3% (413/429) identical to both Coxiella symbiont of Carios capensis (DQ150578) and C. burnetii (CP001019). Phylogenetic analysis inferred from the 3 genes (16S rRNA, pyrG, cap) show that the agent infecting 100% of the O. rostratus ticks of the present study belonged to the genus Coxiella (Figs. 1 and 2). In the 16S rRNA gene tree (Fig. 1A), the partial sequence of the Coxiella agent of O. rostratus grouped with Coxiella symbionts of other soft tick species (Argasidae) under 74% bootstrap support, having different isolates of C. burnetii as a sister group (97% bootstrap support). These 2 groups formed a clade that grouped under 77% bootstrap support with another clade containing Coxiella symbionts of hard
Fig. 2. Molecular phylogenetic analysis of the Coxiella agent of Ornithodoros rostratus from Brazil. A total of 1005 aligned nucleotide sites of the concatenated pyrG and cap genes were subjected to analysis. Bootstrap values under 1000 replicates are shown at the nodes. Numbers in brackets are GenBank accession numbers. Scale bars indicate nucleotide substitutions per site.
tick species (Ixodidae). This hard tick clade included a Coxiella pathogen of birds, namely Candidatus ‘Coxiella avium’. A phylogenetic analysis inferred from the tick mitochondrial 16S rRNA gene, composed mostly by tick species from which Coxiella symbionts have been reported (Fig. 1B), suggest a phylogenetic congruence of ticks and their Coxiella symbionts. Phylogenetic concatenated analysis inferred from pyrG-cap also placed the Coxiella agent of O. rostratus with an argasid Coxiella symbiont (Carios capensis), having a sister group composed by different isolates of C. burnetii (Fig. 2). No other Coxiella symbiont sequences were available for this pyrGcap concatenated analysis. The GenBank nucleotide sequence accession numbers for the partial sequences of the Coxiella symbiont generated in this study are JN887879 for the 16S rRNA gene, JN887880 for pyrG, and
206
A.P. Almeida et al. / Ticks and Tick-borne Diseases 3 (2012) 203–206
JN887881 for cap; the accession number for the O. rostratus mitochondrial 16S rRNA partial sequence is JN887882. Discussion Herein, we report a high level of infectivity (100%) of a novel Coxiella agent in O. rostratus ticks, which is consistent with reports of other Coxiella symbionts in hard and soft ticks (Mediannikov et al., 2003; Reeves et al., 2006; Klyachko et al., 2007; MachadoFerreira et al., 2011). Because we found that all of the O. rostratus eggs were also infected, it is likely that the Coxiella agent is effectively maintained transovarially in O. rostratus ticks. These findings, in association with our phylogenetic analyses that placed the Coxiella agent of O. rostratus with different Coxiella symbionts of ticks, suggests that this agent infecting O. rostratus ticks in Brazil is also a symbiont. Our phylogenetic analyses indicate that the Coxiella symbiont of O. rostratus is unique, but is related to Coxiella symbionts of other soft ticks. These symbionts group together within a larger monophyletic group of Coxiella symbionts of both soft and hard ticks (Fig. 1A). Because the phylogenetic relatedness of all known tick-associated Coxiella symbionts tend to be congruent to the phylogenetic relatedness of their specific tick hosts (Fig. 1B) and because ticks generally have very high infection rates (e.g., 100%), this finding suggests that the original infection occurred in an ancestor common to the 2 main tick families, Argasidae (soft ticks) and Ixodidae (hard ticks). However, further testing of more tick species and populations is needed to firmly establish this conclusion. Previous studies with insects and symbionts have reported congruent phylogenies between hosts and their bacterial symbionts (Bandi et al., 1995; Gruwell et al., 2007). On the other hand, our analyses also suggest that at a few points of the tick-Coxiella coevolution, the bacterium evolved to pathogenic agents, resulting in the organisms C. burnetii and Candidatus ‘Coxiella avium’. While the former pathogen is the etiological agent of Q fever world wide (Maurin and Raoult, 1999), the latter agent was recently described causing severe disease in birds (Shivaprasad et al., 2008). Because of the likely long coevolution process and high infection rates in tick populations, it is possible that the infection by Coxiella symbionts is beneficial for ticks. Further studies employing microscopic and biochemical methods are needed to confirm the symbiotic nature of the Coxiella agent of O. rostratus and to test a possible mutual benefit of this tick-bacterium interaction. Acknowledgments We are grateful to Jere McBride (University of Texas Medical Branch) for revising the manuscript. This work was supported by Fundac¸ão de Amparo a Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410.
Aragão, H., 1936. Ixodidas brasileiros e de alguns paizes limitrophes. Mem. Inst. Oswaldo Cruz 31, 759–843. Bandi, C., Sironi, M., Damiani, G., Magrassi, L., Nalepa, C.A., Laudani, U., Sacchi, L., 1995. The establishment of intracellular symbiosis in an ancestor of cockroaches and termites. Proc. Biol. Sci. 259, 293–299. Barros-Battesti, D.M., Arzua, M., Bechara, G.H., 2006. Carrapatos de importância médico-veterinária da Região Neotropical: um guia ilustrado para identificac¸ão de espécies. Vox/ICTTD-3/Butantan, São Paulo. Breitschwerdt, E.B., Hegarty, B.C., Hancock, S.I., 1998. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J. Clin. Microbiol. 36, 2645–2651. Canc¸ado, P.H., Piranda, E.M., Mourão, G.M., Faccini, J.L., 2008. Spatial distribution and impact of cattle-raising on ticks in the Pantanal region of Brazil by using the CO2 tick trap. Parasitol. Res. 103, 371–377. Gruwell, M.E., Morse, G.E., Normark, B.B., 2007. Phylogenetic congruence of armored scale insects (Hemiptera: Diaspididae) and their primary endosymbionts from the phylum Bacteroidetes. Mol. Phylogenet. Evol. 44, 267–280. Kazar, J., 2005. Coxiella burnetii infection. Ann. N.Y. Acad. Sci. 1063, 105–114. Klyachko, O., Stein, B.D., Grindle, N., Clay, K., Fuqua, C., 2007. Localization and visualization of a coxiella-type symbiont within the lone star tick, Amblyomma americanum. Appl. Environ. Microbiol. 73, 6584–6594. Labruna, M.B., Whitworth, T., Horta, M.C., Bouyer, D.H., McBride, J.W., Pinter, A., Popov, V., Gennari, S.M., Walker, D.H., 2004. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 42, 90–98. Lemos, E.R., Rozental, T., Mares-Guia, M.A., Almeida, D.N., Moreira, N., Silva, R.G., Barreira, J.D., Lamas, C.C., Favacho, A.R., Damasco, P.V., 2011. Q fever as a cause of fever of unknown origin and thrombocytosis: first molecular evidence of Coxiella burnetii in Brazil. Vector Borne Zoonotic Dis. 11, 85–87. Machado-Ferreira, E., Dietrich, G., Hojgaard, A., Levin, M., Piesman, J., Zeidner, N.S., Soares, C.A., 2011. Coxiella symbionts in the Cayenne tick Amblyomma cajennense. Microb. Ecol. 62, 134–142. Mangold, A.J., Bargues, M.D., Mas-Coma, S., 1998. Mitochondrial 16SrDNA sequences and phylogenetic relationships of species of Rhipicephalus and other tick genera among Metastriata (Acari: Ixodidae). Parasitol. Res. 84, 478–484. Maurin, M., Raoult, D., 1999. Q fever. Clin. Microbiol. Rev. 12, 518–553. Masuzawa, T., Sawaki, K., Nagaoka, H., Akiyama, M., Hirai, K., Yanagihara, Y., 1997. Identification of rickettsiae isolated in Japan as Coxiella burnetii by 16S rRNA sequencing. Int. J. Syst. Bacteriol. 47, 883–884. Mediannikov, O., Ivanov, L., Nishikawa, M., Saito, R., Sidelnikov, Y.N., Zdanovskaya, N.I., Tarasevich, I.V., Suzuki, H., 2003. Molecular evidence of Coxiella-like microorganism harbored by Haemaphysalis concinnae ticks in the Russian Far East. Ann. N.Y. Acad. Sci. 990, 226–228. Nava, S., Lareschi, M., Rebollo, C., Benítez Usher, C., Beati, L., Robbins, R.G., Durden, L.A., Mangold, A.J., Guglielmone, A.A., 2007. The ticks (Acari: Ixodida: Argasidae, Ixodidae) of Paraguay. Ann. Trop. Med. Parasitol. 101, 255–270. Nicholas, K.B., Nicholas, H.B.J., Deerfield, D.W.I., 1997. GeneDoc: analysis and visualization of genetic variation. EMBNEW NEWS 4, 14. Reeves, W.K., Loftis, A.D., Sanders, F., Spinks, M.D., Wills, W., Denison, A.M., Dasch, G.A., 2006. Borrelia, Coxiella, and Rickettsia in Carios capensis (Acari: Argasidae) from a brown pelican (Pelecanus accidentalis) rookery in South Carolina, USA. Exp. Appl. Acarol. 39, 321–329. Sangioni, L.A., Horta, M.C., Vianna, M.C., Gennari, S.M., Soares, R.M., Galvão, M.A., Schumaker, T.T., Ferreira, F., Vidotto, O., Labruna, M.B., 2005. Rickettsial infection in animals and Brazilian spotted fever endemicity. Emerg. Infect. Dis. 11, 265–270. Shivaprasad, H.L., Cadenas, M.B., Diab, S.S., Nordhausen, R., Bradway, D., Crespo, R., Breitschwerdt, E.B., 2008. Coxiella-like infection in psittacines and a toucan. Avian Dis. 52, 426–432. Siciliano, R.F., Ribeiro, H.B., Furtado, R.H.M., Castelli, J.B., Sampaio, R.O., Santos, F.C.P., Colombo, S., Grinberg, M., Strabelli, T.M.V., 2008. Endocardite por Coxiella burnetii (Febre Q). Doenc¸a rara ou pouco diagnosticada? Relato de caso. Rev. Soc. Bras. Med. Trop. 41, 409–412. Stromdahl, E., Williamson, P., Kollars, T., Evans, S.R., Barry, R.K., Vince, M.A., Dobbs, N.A., 2003. Evidence of Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J. Clin. Microbiol. 41, 5557–5562. Swofford, D.L., 2002. PAUP*. Phylogenetic analysis using parsimony (* and Other Methods). Version 4. Sinauer & Associates, Sunderland, Massachusasetts. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.
Contents lists available at SciVerse ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.de/ttbdis
Original article
Coxiella symbiont in the tick Ornithodoros rostratus (Acari: Argasidae) Aliny P. Almeida a , Arlei Marcili a , Romario C. Leite b , Fernanda A. Nieri-Bastos a , Luísa N. Domingues b , João Ricardo Martins c , Marcelo B. Labruna a,∗ a b c
Dept. of Preventive Veterinary Medicine and Animal Health, Faculty of Veterinary Medicine, University of São Paulo, São Paulo, SP, Brazil Dept. of Preventive Veterinary Medicine, School of Veterinary, Federal University of Minas Gerais, Belo Horizonte, MG, Brazil Institute of Veterinary Research “Desidério Finamor”, Fundac¸ão Estadual de Pesquisa Agropecuária, Eldorado do Sul, RS, Brazil
a r t i c l e
i n f o
Article history: Received 30 November 2011 Received in revised form 10 February 2012 Accepted 24 February 2012 Keywords: Soft ticks Coxiella Ornithodoros rostratus Symbiont Brazil
a b s t r a c t In the present study, the presence of tick-associated bacteria and protozoa in Ornithodoros rostratus ticks (adults, nymphs, and eggs) from the Pantanal region of Brazil were determined by molecular detection. In these ticks, DNA from protozoa in the genera Babesia and Hepatozoon, and bacteria from the genera Rickettsia, Borrelia, Anaplasma, and Ehrlichia were not detected. Conversely, all tested ticks (100%) yielded PCR products for 3 Coxiella genes (16S rRNA, pyrG, cap). PCR and phylogenetic analysis of 3 amplified genes (16S rRNA, pyrG, cap) demonstrated that the agent infecting O. rostratus ticks was a member of the genus Coxiella. This organism grouped with Coxiella symbionts of other soft tick species (Argasidae), having different isolates of C. burnetii as a sister group, and these 2 groups formed a clade that grouped with another clade containing Coxiella symbionts of hard tick species (Ixodidae). Analysis of tick mitochondrial 16S rRNA gene database composed mostly of tick species previously shown to harbor Coxiella symbionts suggests a phylogenetic congruence of ticks and their Coxiella symbionts. Furthermore, these results suggest a very long period of coevolution between ticks and Coxiella symbionts and indicates that the original infection may have occurred in an ancestor common to the 2 main tick families, Argasidae (soft ticks) and Ixodidae (hard ticks). However, this evolutionary relationship must be confirmed by more extensive testing of additional tick species and expanded populations. © 2012 Elsevier GmbH. All rights reserved.
Introduction The Gammaproteobacterium Coxiella burnetii is the causative agent of acute Q fever and chronic endocarditis in humans worldwide, including Brazil (Siciliano et al., 2008; Lemos et al., 2011), where the agent is transmitted mostly by aerosol route or ingestion of infected animal fomites (Maurin and Raoult, 1999). C. burnetii is an obligately intracellular, Gram-negative bacterium that often resides in the phagolysosome of infected mammalian cells. Besides C. burnetii, a number of different tick species of both Argasidae (soft ticks) and Ixodidae (hard ticks) families have been reported to harbor microbes related to C. burnetii (Mediannikov et al., 2003; Reeves et al., 2006; Klyachko et al., 2007; Machado-Ferreira et al., 2011). Although more than 40 tick species can be infected with C. burnetii, direct transmission of this agent to humans from infected ticks has never been documented. Ticks may play a significant role in the transmission of C. burnetii among wild vertebrates (Maurin and Raoult, 1999; Kazar, 2005); however, except for C. burnetii, there is
∗ Corresponding author at: Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, Av. Prof. Orlando Marques de Paiva 87, Cidade Universitária, São Paulo 05508-270, SP, Brazil. Tel.: +55 11 3091 1394; fax: +55 11 3091 7928. E-mail address: [email protected] (M.B. Labruna). 1877-959X/$ – see front matter © 2012 Elsevier GmbH. All rights reserved. doi:10.1016/j.ttbdis.2012.02.003
no evidence that demonstrates that such Coxiella-related organisms cause disease in humans or other vertebrate hosts. Hence, these Coxiella-related organisms are thought to be highly prevalent tick endosymbionts that are maintained transovarially (Klyachko et al., 2007; Machado-Ferreira et al., 2011). The soft tick Ornithodoros rostratus (Acari: Argasidae) is known to occur in northern Argentina, Paraguay, Bolivia, and western Brazil (Aragão, 1936; Nava et al., 2007). In Brazil, O. rostratus was recently reported in a Pantanal area of the state of Mato Grosso do Sul, where it was associated with several domestic animals (cattle, horses, pigs), and was also reported to be an important human biting tick (Aragão, 1936; Canc¸ado et al., 2008). Within this context, the present study searched by molecular methods for the presence of tick-associated bacteria and protozoa in O. rostratus ticks from the Pantanal region of Brazil.
Materials and methods In March 2009, Ornithodoros ticks were collected from the environment at the Nhumirim farm, in the central area of the Brazilian Pantanal, state of Mato Groso do Sul (18◦ 59 S; 56◦ 39 W). Ticks were collected by CO2 traps armed on the sandy soil inside a cattle ranch, as previously described (Canc¸ado et al., 2008). Ecological
Labruna et al. (2004) Breitschwerdt et al. (1998) Stromdahl et al. (2003) Stromdahl et al. (2003) Reeves et al. (2006) Reeves et al. (2006) Masuzawa et al. (1997) This paper 401 360 665 354 504 601 1457 532 50 62 60 60 55 55 58 58 Used in a nested reaction.
GCAAGTATCGGTGAGGATGTAAT GTTAGTGGCAGACGGGTGAGT ACATATTCAGATGCAGACAGAGGT CTTTGATCACTTATCATTCTAATAGCa TTATTTACCAACGTTCCTGAGCCG ATTTAGTGGGTTTCGCGCAT ATTGAAGAGTTTGATTCTGG GGGGAAGAAAGTCTCAAGGGTAATATCCTT gltA 16S rRNA fla fla pyrG cap 16S rRNA 16S rRNA
a
551 574 58 50 GCTTGAAACACTCTARTTTTCTCAAAG ACAATAAAGTAAAAAACAYTTCAAAG
Reverse
CCGTGCTAATTGTAGGGCTAATACA GGTAATTCTAGAGCTAATACATGAGC
Forward
18S rRNA 18S rRNA
GCTTCCTTAAAATTCAATAAATCAGGAT TATAGGTACCGTCATTATCTTCCCTAT GCAATCATAGCCATTGCAGATTGT AACAGCTGAAGAGCTTGGAATGa TTTATCCCGAGCAAATTCAATTATGG CATCAGCATACGTTTCGGGAA CGGCTTCCCGAAGGTTAG TGCATCGAATTAAACCACATGCTCCACCGC
Reference Amplicon size (nt) Annealing temp. (◦ C) Primer sequence (5 –3 )
Babesia spp. Hepatozoon spp. Rickettsia spp. Anaplasmataceae Borrelia spp. Borrelia spp. Coxiella spp. Coxiella spp. Coxiella spp. Coxiella spp.
Amplicons were not generated from the O. rostratus ticks by the PCR assays targeting the protozoa genera Babesia and Hepatozoon
Gene
Results
Target organisms
details of the study region have also been previously described by Canc¸ado et al. (2008). Live ticks were brought to the laboratory and taxonomically identified (Barros-Battesti et al., 2006) as 20 nymphs, 8 females, and 5 males of Ornithodoros rostratus Aragão. All 20 nymphs and 3 females were separated for molecular analyses (described below), and the remaining adults were used to form a laboratory colony. Ticks were fed on tick-naïve rabbits; then engorged ticks were transferred to an incubator and maintained at 25 ◦ C and 85% relative humidity. In the laboratory, ticks were subjected individually to DNA extraction by the guanidine isothiocynate-phenol technique (Sangioni et al., 2005), and tested by a battery of PCR assays targeting protozoa of the genera Babesia and Hepatozoon, and bacteria of the genera Rickettsia, Borrelia, and Coxiella, and the family Anaplasmataceae (genera Anaplasma and Ehrlichia). PCR was performed with genus-specific primers shown in Table 1. In each PCR assay, negative controls (water) and an appropriate positive control sample (DNA of Babesia canis, Hepatozoon canis, Rickettsia parkeri, Borrelia anserina, C. burnetii, or Ehrlichia canis) were run together with the O. rostratus DNA samples. PCR products of the expected size for each assay were purified with ExoSap (USB) and sequenced in an automatic sequencer (Applied Biosystems/PerkinElmer, model ABI Prism 310 Genetic, Foster City, CA) according to the manufacturer’s protocol, using the same primers (forward and reverse) used for the PCR. Partial sequences obtained were submitted to BLAST analysis (Altschul et al., 1990) to determine the closest similarities in GenBank. Partial sequences of 3 Coxiella genes (16S rRNA, pyrG, cap) generated in the present study were aligned by Clustal X (Thompson et al., 1997) and manually refined by Genedoc (Nicholas et al., 1997) with corresponding Coxiella sequences available in GenBank. The 16S rRNA gene was analyzed separately, while pyrG and cap were concatenated and then aligned. The bacterial 16S rRNA gene was chosen in this study because it is the most widely employed gene for primary identification of tick symbionts; pyrG and cap were used because they were recently used for molecular characterization of a Coxiella symbiont of soft ticks (Reeves et al., 2006). Two phylogenetic trees (one for the 16S rRNA gene and one for pyrG-cap) were constructed by the parsimony method using Paup *4.0b10 software (Swofford, 2002). Corresponding sequences of Legionella pneumophila or L. longbeachae were included as outgroup. Confidence values for individual branches of the resulting trees were determined by bootstrap analysis with 1000 replicates. Three egg pools (each containing 20 eggs) derived from 3 different females, and 10 individual eggs were taken from the O. rostratus colony and subjected to DNA extraction as described above. These samples were tested by PCR targeting the 3 Coxiella genes listed in Table 1. PCR products generated from 6 individual eggs were purified and sequenced as described above. Tick DNA was also tested by PCR targeting the 16S rRNA mitochondrial gene, as previously described (Mangold et al., 1998). The PCR products of 2 ticks (1 female, 1 nymph) were DNA-sequenced as described above, and the resulting sequence was submitted to BLAST analysis in order to certify the taxonomic identification of the tick. In addition, a phylogenetic tree using the same methods described above was constructed based on the alignment of tick mitochondrial 16S rDNA sequences of the tick species (and a few close-related species) from which Coxiella symbionts have been reported. The sequence of Allothyridae (a tick sister group) was included as an outgroup.
This paper This paper
A.P. Almeida et al. / Ticks and Tick-borne Diseases 3 (2012) 203–206
Table 1 PCR primers used to test DNA extracts of Ornithodoros rostratus from Pantanal, State of Mato Grosso do Sul, Brazil.
204
A.P. Almeida et al. / Ticks and Tick-borne Diseases 3 (2012) 203–206
205
Fig. 1. (A) Molecular phylogenetic analysis of the Coxiella agent of Ornithodoros rostratus from Brazil. A total of 987 aligned nucleotide sites of the 16S rRNA bacterial gene was subjected to analysis. (B) Molecular phylogenetic analysis of hard and soft ticks from which Coxiella symbionts have been reported. A total of 406 aligned nucleotide sites of the tick mitochondrial 16S rRNA gene were subjected to analysis. Bootstrap values under 1000 replicates are shown at the nodes. Numbers in brackets are GenBank accession numbers. Scale bars indicate nucleotide substitutions per site.
and bacterial genera Rickettsia, Borrelia, Anaplasma, and Ehrlichia, although positive control samples always yielded visible amplicons of the expected size. On the other hand, all 23 ticks (20 nymphs, 3 females) and all egg samples (3 pools and 10 individual eggs) yielded PCR products for the 3 Coxiella genes (16S rRNA, pyrG, cap) tested. In addition, the 23 ticks yielded products by the tick mitochondrial 16S rRNA PCR, from which sequences generated from 2 ticks were identical to each other and 98.7% (368/373-bp) identical to the corresponding sequence of O. rostratus from Argentina (DQ295780), available in GenBank. DNA sequences were generated from the PCR products of all 20 nymphs, 3 females, and 2 eggs for the Coxiella cap as well as from 10 nymphs and 2 eggs for pyrG and from 2 females and 2 eggs for the 16S rRNA gene. Considering each of the 3 genes separately, all sequences were identical to each other. By Blast analysis, the partial sequence of the 16S rRNA gene was closest (97.0%; 1415/1459) to a Coxiella symbiont of O. moubata (AB001521), and 98.8% (1200/1215) identical to the corresponding sequence of C. burnetii (CP001019). The cap partial sequence was 94.2% (502/533) identical to the corresponding sequence of a Coxiella symbiont of Carios capensis (=Ornithodoros capensis) (DQ150580) and 95.2% (494/519) identical to C. burnetii (CP001020); and the pyrG partial sequence was 96.3% (413/429) identical to both Coxiella symbiont of Carios capensis (DQ150578) and C. burnetii (CP001019). Phylogenetic analysis inferred from the 3 genes (16S rRNA, pyrG, cap) show that the agent infecting 100% of the O. rostratus ticks of the present study belonged to the genus Coxiella (Figs. 1 and 2). In the 16S rRNA gene tree (Fig. 1A), the partial sequence of the Coxiella agent of O. rostratus grouped with Coxiella symbionts of other soft tick species (Argasidae) under 74% bootstrap support, having different isolates of C. burnetii as a sister group (97% bootstrap support). These 2 groups formed a clade that grouped under 77% bootstrap support with another clade containing Coxiella symbionts of hard
Fig. 2. Molecular phylogenetic analysis of the Coxiella agent of Ornithodoros rostratus from Brazil. A total of 1005 aligned nucleotide sites of the concatenated pyrG and cap genes were subjected to analysis. Bootstrap values under 1000 replicates are shown at the nodes. Numbers in brackets are GenBank accession numbers. Scale bars indicate nucleotide substitutions per site.
tick species (Ixodidae). This hard tick clade included a Coxiella pathogen of birds, namely Candidatus ‘Coxiella avium’. A phylogenetic analysis inferred from the tick mitochondrial 16S rRNA gene, composed mostly by tick species from which Coxiella symbionts have been reported (Fig. 1B), suggest a phylogenetic congruence of ticks and their Coxiella symbionts. Phylogenetic concatenated analysis inferred from pyrG-cap also placed the Coxiella agent of O. rostratus with an argasid Coxiella symbiont (Carios capensis), having a sister group composed by different isolates of C. burnetii (Fig. 2). No other Coxiella symbiont sequences were available for this pyrGcap concatenated analysis. The GenBank nucleotide sequence accession numbers for the partial sequences of the Coxiella symbiont generated in this study are JN887879 for the 16S rRNA gene, JN887880 for pyrG, and
206
A.P. Almeida et al. / Ticks and Tick-borne Diseases 3 (2012) 203–206
JN887881 for cap; the accession number for the O. rostratus mitochondrial 16S rRNA partial sequence is JN887882. Discussion Herein, we report a high level of infectivity (100%) of a novel Coxiella agent in O. rostratus ticks, which is consistent with reports of other Coxiella symbionts in hard and soft ticks (Mediannikov et al., 2003; Reeves et al., 2006; Klyachko et al., 2007; MachadoFerreira et al., 2011). Because we found that all of the O. rostratus eggs were also infected, it is likely that the Coxiella agent is effectively maintained transovarially in O. rostratus ticks. These findings, in association with our phylogenetic analyses that placed the Coxiella agent of O. rostratus with different Coxiella symbionts of ticks, suggests that this agent infecting O. rostratus ticks in Brazil is also a symbiont. Our phylogenetic analyses indicate that the Coxiella symbiont of O. rostratus is unique, but is related to Coxiella symbionts of other soft ticks. These symbionts group together within a larger monophyletic group of Coxiella symbionts of both soft and hard ticks (Fig. 1A). Because the phylogenetic relatedness of all known tick-associated Coxiella symbionts tend to be congruent to the phylogenetic relatedness of their specific tick hosts (Fig. 1B) and because ticks generally have very high infection rates (e.g., 100%), this finding suggests that the original infection occurred in an ancestor common to the 2 main tick families, Argasidae (soft ticks) and Ixodidae (hard ticks). However, further testing of more tick species and populations is needed to firmly establish this conclusion. Previous studies with insects and symbionts have reported congruent phylogenies between hosts and their bacterial symbionts (Bandi et al., 1995; Gruwell et al., 2007). On the other hand, our analyses also suggest that at a few points of the tick-Coxiella coevolution, the bacterium evolved to pathogenic agents, resulting in the organisms C. burnetii and Candidatus ‘Coxiella avium’. While the former pathogen is the etiological agent of Q fever world wide (Maurin and Raoult, 1999), the latter agent was recently described causing severe disease in birds (Shivaprasad et al., 2008). Because of the likely long coevolution process and high infection rates in tick populations, it is possible that the infection by Coxiella symbionts is beneficial for ticks. Further studies employing microscopic and biochemical methods are needed to confirm the symbiotic nature of the Coxiella agent of O. rostratus and to test a possible mutual benefit of this tick-bacterium interaction. Acknowledgments We are grateful to Jere McBride (University of Texas Medical Branch) for revising the manuscript. This work was supported by Fundac¸ão de Amparo a Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410.
Aragão, H., 1936. Ixodidas brasileiros e de alguns paizes limitrophes. Mem. Inst. Oswaldo Cruz 31, 759–843. Bandi, C., Sironi, M., Damiani, G., Magrassi, L., Nalepa, C.A., Laudani, U., Sacchi, L., 1995. The establishment of intracellular symbiosis in an ancestor of cockroaches and termites. Proc. Biol. Sci. 259, 293–299. Barros-Battesti, D.M., Arzua, M., Bechara, G.H., 2006. Carrapatos de importância médico-veterinária da Região Neotropical: um guia ilustrado para identificac¸ão de espécies. Vox/ICTTD-3/Butantan, São Paulo. Breitschwerdt, E.B., Hegarty, B.C., Hancock, S.I., 1998. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J. Clin. Microbiol. 36, 2645–2651. Canc¸ado, P.H., Piranda, E.M., Mourão, G.M., Faccini, J.L., 2008. Spatial distribution and impact of cattle-raising on ticks in the Pantanal region of Brazil by using the CO2 tick trap. Parasitol. Res. 103, 371–377. Gruwell, M.E., Morse, G.E., Normark, B.B., 2007. Phylogenetic congruence of armored scale insects (Hemiptera: Diaspididae) and their primary endosymbionts from the phylum Bacteroidetes. Mol. Phylogenet. Evol. 44, 267–280. Kazar, J., 2005. Coxiella burnetii infection. Ann. N.Y. Acad. Sci. 1063, 105–114. Klyachko, O., Stein, B.D., Grindle, N., Clay, K., Fuqua, C., 2007. Localization and visualization of a coxiella-type symbiont within the lone star tick, Amblyomma americanum. Appl. Environ. Microbiol. 73, 6584–6594. Labruna, M.B., Whitworth, T., Horta, M.C., Bouyer, D.H., McBride, J.W., Pinter, A., Popov, V., Gennari, S.M., Walker, D.H., 2004. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 42, 90–98. Lemos, E.R., Rozental, T., Mares-Guia, M.A., Almeida, D.N., Moreira, N., Silva, R.G., Barreira, J.D., Lamas, C.C., Favacho, A.R., Damasco, P.V., 2011. Q fever as a cause of fever of unknown origin and thrombocytosis: first molecular evidence of Coxiella burnetii in Brazil. Vector Borne Zoonotic Dis. 11, 85–87. Machado-Ferreira, E., Dietrich, G., Hojgaard, A., Levin, M., Piesman, J., Zeidner, N.S., Soares, C.A., 2011. Coxiella symbionts in the Cayenne tick Amblyomma cajennense. Microb. Ecol. 62, 134–142. Mangold, A.J., Bargues, M.D., Mas-Coma, S., 1998. Mitochondrial 16SrDNA sequences and phylogenetic relationships of species of Rhipicephalus and other tick genera among Metastriata (Acari: Ixodidae). Parasitol. Res. 84, 478–484. Maurin, M., Raoult, D., 1999. Q fever. Clin. Microbiol. Rev. 12, 518–553. Masuzawa, T., Sawaki, K., Nagaoka, H., Akiyama, M., Hirai, K., Yanagihara, Y., 1997. Identification of rickettsiae isolated in Japan as Coxiella burnetii by 16S rRNA sequencing. Int. J. Syst. Bacteriol. 47, 883–884. Mediannikov, O., Ivanov, L., Nishikawa, M., Saito, R., Sidelnikov, Y.N., Zdanovskaya, N.I., Tarasevich, I.V., Suzuki, H., 2003. Molecular evidence of Coxiella-like microorganism harbored by Haemaphysalis concinnae ticks in the Russian Far East. Ann. N.Y. Acad. Sci. 990, 226–228. Nava, S., Lareschi, M., Rebollo, C., Benítez Usher, C., Beati, L., Robbins, R.G., Durden, L.A., Mangold, A.J., Guglielmone, A.A., 2007. The ticks (Acari: Ixodida: Argasidae, Ixodidae) of Paraguay. Ann. Trop. Med. Parasitol. 101, 255–270. Nicholas, K.B., Nicholas, H.B.J., Deerfield, D.W.I., 1997. GeneDoc: analysis and visualization of genetic variation. EMBNEW NEWS 4, 14. Reeves, W.K., Loftis, A.D., Sanders, F., Spinks, M.D., Wills, W., Denison, A.M., Dasch, G.A., 2006. Borrelia, Coxiella, and Rickettsia in Carios capensis (Acari: Argasidae) from a brown pelican (Pelecanus accidentalis) rookery in South Carolina, USA. Exp. Appl. Acarol. 39, 321–329. Sangioni, L.A., Horta, M.C., Vianna, M.C., Gennari, S.M., Soares, R.M., Galvão, M.A., Schumaker, T.T., Ferreira, F., Vidotto, O., Labruna, M.B., 2005. Rickettsial infection in animals and Brazilian spotted fever endemicity. Emerg. Infect. Dis. 11, 265–270. Shivaprasad, H.L., Cadenas, M.B., Diab, S.S., Nordhausen, R., Bradway, D., Crespo, R., Breitschwerdt, E.B., 2008. Coxiella-like infection in psittacines and a toucan. Avian Dis. 52, 426–432. Siciliano, R.F., Ribeiro, H.B., Furtado, R.H.M., Castelli, J.B., Sampaio, R.O., Santos, F.C.P., Colombo, S., Grinberg, M., Strabelli, T.M.V., 2008. Endocardite por Coxiella burnetii (Febre Q). Doenc¸a rara ou pouco diagnosticada? Relato de caso. Rev. Soc. Bras. Med. Trop. 41, 409–412. Stromdahl, E., Williamson, P., Kollars, T., Evans, S.R., Barry, R.K., Vince, M.A., Dobbs, N.A., 2003. Evidence of Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J. Clin. Microbiol. 41, 5557–5562. Swofford, D.L., 2002. PAUP*. Phylogenetic analysis using parsimony (* and Other Methods). Version 4. Sinauer & Associates, Sunderland, Massachusasetts. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.