- Email: [email protected]
Crimean-Congo hemorrhagic fever: experience at a tertiary care hospital in Karachi, Pakistan
Transactions of the Royal Society of Tropical Medicine and Hygiene (2005) 99, 577—584
Crimean-Congo hemorrhagic fever: experience at a tertiary care hospital in Karachi, Pakistan Bushra Jamil a,b,∗, Rumina S. Hasan b, Arif R. Sarwari c, Jane Burton d, Roger Hewson d, Christopher Clegg d a
Department of Medicine, The Aga Khan University Hospital, Stadium Road, P.O. Box 3500, Karachi 74800, Pakistan b Department of Pathology/Microbiology, The Aga Khan University Hospital, Karachi, Pakistan c Robert C. Byrd Health Sciences Center, West Virginia University, Morgantown, WV, USA d Novel and Dangerous Pathogens, Centre for Emergency Preparedness and Response —– Health Protection Agency, Porton Down, Salisbury, UK Received 30 April 2004 ; received in revised form 11 March 2005; accepted 11 March 2005
KEYWORDS Crimean-Congo hemorrhagic fever; Prognostic markers; Reverse transcriptase—PCR; Nucleotide sequence; Pakistan
Summary Crimean-Congo hemorrhagic fever (CCHF) is endemic in certain rural areas of Pakistan. Since the discovery of CCHF virus (CCHFV) in the country in the 1960s, there have been 13 outbreaks in addition to sporadic cases. An outbreak during 2000 coincided with the movement of sacrificial animals from rural to urban areas for the festival of Eid-ul-Azha. Diagnosis was suspected in patients with fever and thrombocytopenia, and confirmed retrospectively using immunoassays and reverse transcriptase-PCR. Patients were given platelet, plasma and red cell infusions. Management varied due to unfamiliarity with the condition and its treatment, lack of availability of diagnostic laboratory tests and limited supply of ribavirin. Inadequate antiviral treatment and late presentation probably contributed to the death of six of the eight patients. Renal failure, disseminated intravascular coagulation and persistent high-grade fever were associated with mortality. The nucleotide sequence of the small genomic RNA segment of the CCHFV isolated in this outbreak was found to be very closely related to the CCHFV strains previously isolated in Pakistan. © 2005 Published by Elsevier Ltd on behalf of Royal Society of Tropical Medicine and Hygiene.
1. Introduction
* Corresponding author. Tel.: +92 21 4930051x4515; fax: +92 21-4934294/4932095. E-mail addresses: [email protected], [email protected], [email protected] (B. Jamil).
Crimean-Congo hemorrhagic fever (CCHF) is endemic in parts of Africa, southeastern Europe, the Russian Federation, Central Asia and Pakistan (Casals, 1978). The CCHF virus (CCHFV) (genus Nairovirus, family Bunyaviridae) is a small
0035-9203/$ — see front matter © 2005 Published by Elsevier Ltd on behalf of Royal Society of Tropical Medicine and Hygiene. doi:10.1016/j.trstmh.2005.03.002
578 enveloped virus with a genome consisting of three segments of single-stranded RNA of negative polarity. The disease is transmitted through tick bite, or direct contact with viremic animals or humans. Disease manifestations range from self-limiting flu-like symptoms to overt life-threatening hemorrhage (Leshchinskaya, 1965; Swanepoel et al., 1987). In this study, we describe the clinical and laboratory features in eight cases of CCHF who presented to a tertiary care hospital in a non-endemic area during the year 2000 outbreak in Pakistan. We analyze the possible reasons for this outbreak in urban Karachi during the festival of Eid-ul-Azha and the various factors that were associated with increased mortality. Clinical diagnosis of CCHF in this case series was based on history of contact and presence of fever and thrombocytopenia, with or without overt bleeding. Patient management issues arising from lack of familiarity with the condition and limited availability of ribavirin are discussed. Results of nucleotide sequencing of the small (S) genomic RNA segment of the CCHFV isolated from one of the patients in this outbreak are also presented to highlight the role of animal transit in disease spread.
2. Methods The Aga Khan University Hospital (AKUH) is a 647-bed, private, tertiary care teaching hospital that serves the estimated 8—12 million inhabitants of Karachi, Pakistan. The hospital also serves as a referral center for the nearby cities of the Sindh Province and other areas of Pakistan. Between September and November 2000, 29 patients were admitted to AKUH with fever and thrombocytopenia. On the basis of clinical features and suggestive laboratory abnormalities including initial hemoconcentration followed by a drop in hemoglobin/hematocrit, leucopenia, thrombocytopenia and deranged coagulation, a diagnosis of viral hemorrhagic fever (VHF) was made. Confirmatory diagnostic tests for VHF were not available. Crimean-Congo hemorrhagic fever was strongly suspected in 8/29 of these patients. The cause of fever and thrombocytopenia could not be ascertained in the rest of the cases and because of initial lack of suspicion, blood samples could not be collected from these patients for retrospective confirmation of diagnosis of CCHF. These cases were therefore excluded from this study. Serum samples from the suspected cases of VHF were collected and stored at −80 ◦ C. These samples were subsequently sent to the Centers
B. Jamil et al. for Disease Control and Prevention, Atlanta, GA, USA, where they were screened for CCHF antigens, and anti-CCHF IgG and IgM antibodies (details of methodology not available). Stored sera were also sent to the Centre for Emergency Preparedness and Response —– Health Protection Agency, Salisbury, UK, for retrospective confirmation of diagnosis using reverse transcriptase-PCR (RT-PCR). RNA was extracted from serum samples using the Viral RNA Mini kit (Qiagen, USA) according to the manufacturer’s protocol. The method described by Burt et al. (1998) was used to amplify a fragment of the small (S) RNA segment by RT-PCR. Subsequently, the primers 6486 (5 TCTCAAAGAAACACGTGCCGCTTACGC) and 6487 (5 TCTCAAAGATATCGTTGCCGCACAGCCCTT) were used to amplify the complete S RNA segment. The complete nucleotide sequence of the S RNA segment was determined from the RT—PCR products, which were amplified directly from a serum specimen from patient no. 3, confirming the identity of the infecting virus as CCHFV. The SRS server at the European Bioinformatics Institute was used to identify and recover fulllength CCHFV S genomic RNA sequences. These were aligned using Clustalw version 1.82, with the inclusion of full-length S RNA sequences from CCHFV strains Baghdad-12 (Al-Tikriti et al., 1981) and SR3 (this paper). The S RNA sequence of the related Nairovirus Hazara was also included. The resulting alignment was analysed using the program Tree-Puzzle version 5.0 and the output maximum likelihood tree drawn using TreeView.
3. Case reports 3.1. Patients Characteristics of the eight cases diagnosed with CCHF are shown in Table 1. All were males, with an age range of 15—48 years (mean 26.4). The diagnosis was confirmed retrospectively with positive serological tests (antigen detection, IgM and IgG) for CCHFV in 6/8 of these patients, and additionally by recovery of CCHFV sequences by RT—PCR in one patient (Table 1). Patients no. 1 (laboratory technician) and no. 6 (butcher) were from Quetta, Balochistan, an area known to be endemic for CCHF. The other six patients were residents of Karachi and gave no history of travel to any CCHFV-endemic area in the few weeks prior to presentation. For patient no. 2, results of confirmatory tests were not available. However, he was the index case for patient no. 3 and remained in hospital from 13 to 16 October 2000 with active bleeding from different
Crimean-Congo hemorrhagic fever in Pakistan
579
Table 1
Characteristics of patients with Crimean-Congo hemorrhagic fever (CCHF), Karachi, Pakistan, 2000
Patient no.
Age (years)
Occupation
1
18
2 3 4 5 6 7d 8d
40 30 16 16 28 15 48
Laboratory technician Butcherb Nurse Studentc Studentc Butcher Student Gas company workerc
a b c d
Residence
Month admitted
Duration of symptoms on admission (days)
Quetta
Sept
Karachi Karachi Karachi Karachi Quetta Karachi Karachi
Oct Oct Nov Nov Nov Nov Nov
CCHFV Antigen
IgM
IgG
RT—PCRa
4
−
+
+
−
4 3 3 5 9 2 4
Not tested + + − + + −
− − − + − +
− − − − − −
+ − − − − −
Reverse transcriptase—PCR. Index case for patient no. 3. No documented history of contact. Survived.
sites. Patient no. 3, a nurse at AKUH looked after him and came down with high-grade fever on 19 October and subsequently developed disseminated intravascular coagulation. Patients no. 5 (included despite negative confirmatory tests) and no. 7 were inhabitants of an orphanage, located in the outskirts of Karachi. They had a history of contact with another inhabitant with suspected VHF (outcome of the latter unknown). Patients no. 4 and 8 did not have any obvious risk factors or history suggestive of exposure to CCHF.
Fever and vomiting were the commonest presenting complaints. Other clinical features, either on presentation or during the hospital stay, were gastrointestinal bleeding, myalgias and bleeding from other sites of the body (Figure 1).
The mean duration of symptoms was 4.3 days (range 2—9 days) at the time of admission. Petechiae and/or ecchymoses were seen in three patients (patients 3, 6 and 8) and were present at the time of admission (day 3 to 7 of onset of symptoms). Mucosal bleeding from the respiratory (epistaxis, hemoptysis), gastrointestinal (hematemesis melena/hematochezia) and genitourinary tracts (hematuria) manifested between 4 and 10 days after onset of symptoms. Six out of eight patients had evidence of skin and/or mucosal bleeding. Fever remained high grade (up to 40 ◦ C axillary) throughout the course of illness in all six patients who died (mean 37.9 ◦ C axillary). One of these (patient 6), however, did become afebrile 48 h before death. The two patients who recovered (patients 7 and 8) presented with history of fever but remained afebrile throughout their hospital stay (Figure 2).
Figure 1 Frequency of clinical features of patients with Crimean-Congo hemorrhagic fever, Karachi, Pakistan, 2000.
Figure 2 Average daily body temperatures (axillary) in patients with Crimean-Congo hemorrhagic fever, Karachi, Pakistan, 2000. av d: temperature in those who died; av s: temperature in those who survived.
3.2. Clinical features
580
Table 2
B. Jamil et al.
Blood counts in patients with Crimean-Congo hemorrhagic fever (CCHF), Karachi, Pakistan, 2000
Patient no.
Total leucocyte count (109 /l) Lowest (d)
Highest (d)
1 2 3 4 5 6 7 8
2.7 (11) 1.2 (7) 0.8 (7) 5.7 (5) 2.2 (7) 4 (10) 3.7 (5) 3.9 (13)
12.9 6.3 10.5 5.9 24.2 7.2 4.8 7.3
(5) (5) (14) (4) (9) (15) (4) (17)
Lymphocytes (%) (d)
Atypical lymphocytes (d)
Monocytes (%) (d)
43 (5) 54.2 (7) 40.7 (8) 41.2 (5) 56.4 (7) 32.3 (10) 39.5 (3) 44.1 (16)
− − − + (5) − − + (3) + (15)
8 (5) 7.2 (7) 19.1 (8) 1.5 (4) 22 (6) 15.6 (15) 17.5 (3) 11.5 (13)
Platelets (109 /l) Lowest (d)
Highest (d)
13 9 12 25 17 22 55 1
50 18 46 47 74 99 184 4
(11) (5) (7) (4) (8) (11) (3) (7)
(5) (7) (14) (5) (6) (15) (6) (11)
(d): day of illness.
3.3. Hematological abnormalities Total leucocyte counts varied between 0.8 × 109 /l and 24 × 109 /l. Leucopenia (total leucocyte count ≤4 × 109 /l) was seen in six patients from day 4 to 13 of onset (Table 2). Four patients who had marked leucopenia (total leucocyte count <3 × 109 /l) died while the two patients who survived had counts ≥3.7 × 109 /l (3.9 to 7.3 × 109 /l). On average, white cell counts dropped to a mean of 2.76 × 109 /l in those who died, while the mean white cell count in those who survived was 3.8 × 109 /l. Lymphocytosis (≥40%) was noted during the early phase of infection in 6/8 patients. Atypical lymphocytes were transiently present between days 4 and 15 of onset of symptoms in the two patients who recovered and in one of the patients who died. Elevated monocyte counts were also noted in 2/6 of the patients who died (mean of 12.3% in survivors vs. 7.7% in non-survivors). All patients were thrombocytopenic (platelet count <150 × 109 /l) from day 4 to day 19 after onset of fever (Table 2). Platelet counts varied from 1 to Table 3
184 × 109 /l (normal range 150—400 × 109 /l). Severity of thrombocytopenia did not correlate with disease outcome. Of the two patients who survived, one patient (patient 8) had prolonged thrombocytopenia, which persisted for about a month after recovery from infection and eventually resolved with prednisolone therapy. Bone marrow examination in this patient revealed normal megakaryocytes. This patient did not have disseminated intravascular coagulation (DIC) at any time during the course of his illness. Disseminated intravascular coagulation was a feature in all the six patients who died (patients 1 to 6) with prolonged prothrombin time (PT) and activated partial thromboplastin time (APTT) (Table 3). The mean value of prothrombin time in survivors was 12.5 s (control 13 s, range 10.5—14.7 s) with a mean international normalized ratio (INR) of 1.01, while the mean PT in those who died was 20.3 s (range 10.7—63 s) with a mean INR of 1.78. The range of APTT was 57 to >120 s (control 29—32 s, mean 81.3 s, range 32.2 to >120 s) in the patients who died vs. 30.1 s (range 26.3—36.8 s) in the two survivors. D-dimer (cross-linked fibrin
Laboratory valuesa in patients with Crimean-Congo hemorrhagic fever, Karachi, Pakistan, 2000
Patient no.
PT/INR (s) (d)
APTT (s) (d)
D-dimer (d)
TB mg/dl (d)
AST (IU/l) (d)
ALT (IU/l) (d)
AP (IU/l) (d)
1 2 3 4 5 6 7 8
35.3/3.5 (5) 20.8/1.8 (7) 63/7.41 (14) 25.8/2.17 (4) 19.9/1.67 (9) 12.5/1.05 (10) 10.5/0.87 (3) 14.7/1.17(13)
80 (5) >120 (5) >120 (8—14) 60.9 (4) 57 (9) 60.1 (10) 26.3 (3) 36.8 (13)
4 (5) 8 (5) ND 8 (4) ND 4 (10) ND 0.5 (13)
2.6 0.3 2.8 0.6 1.3 3.3 0.5 0.5
ND ND ND ND ND 7536 (10) 69 (3) 16 (13)
2061 54 684 49 22 2397 34 13
139 130 121 136 121 196 112 37
(5) (5) (5) (4) (6) (10) (13)
(5) (5) (5) (4) (6) (10) (3) (13)
(5) (5) (5) (4) (6) (10) (3) (13)
(d): day of illness; ND: not done. PT: prothrombin time; INR: International normalized ratio; APTT: activated partial thromboplastin time; TB: total bilirubin; AST: aspartate aminotransferase; ALT: alanine aminotransferase; AP: alkaline phosphatase. Normal ranges: APTT: control 29—32 s; D-dimer: control <0.5; TB: 0.2—1.25 mg/dl; AST: 8—46 IU/l; ALT: 0—55 IU/l,; AP: 28—124 IU/l. a Highest value.
Crimean-Congo hemorrhagic fever in Pakistan
581
Table 4 Duration of hospitalization, ribavirin therapy and disease outcome in patients with Crimean-Congo hemorrhagic fever, Karachi, Pakistan, 2000 Patient no.
Hospital stay (days)
1 2 3
8 4 9
4 5 6 7
2 4 11 4
8
10
Ribavirin
Outcome
Not given Not given 2 g i.v. followed by 1 g 6 hourly for 4 days, 500 mg 8 hourly for 1 day; started on admission (day 4 of onset of symptoms) 1.5 g i.v. followed by 400 mg 8 hourly for 2 days; started on admission 400 mg i.v. 8 hourly for 4 days; started on admission 400 mg by mouth, 8 hourly for 9 days; started on admission 720 mg i.v., 6 hourly for 2 days followed by 400 mg by mouth, 8 hourly for 7 days; started on admission Not given
Died day 12 of onset Died day 8 Died day 14
derivative) was checked in five patients; mean value in those who died was 4.8 (control <0.5). The D-dimer value remained within the normal range in one of the two patients who recovered. It was not checked in the other survivor who had no evidence of DIC. The peripheral smear appearance was suggestive of microangiopathy in patients no. 1 and no. 4.
3.4. Hepatic and renal abnormalities Liver function tests were deranged in three of the patients who died; total bilirubin and aminotransferases were elevated (patients 1, 3 and 6) and alkaline phosphatase was concomitantly elevated in patient no. 6 (Table 3). One of these patients (patient 1) also had a positive hepatitis B core antibody (IgM and IgG), and concomitant infection with hepatitis B virus could have contributed to the markedly deranged enzymes. Hepatitis serology was not done in patient no. 6. Liver function tests were within the normal range in the other patients. Serum creatinine remained normal (≤1.1 mg/dl) in those who recovered, but was elevated in all six patients who died (range 1.4—7.1 mg/dl; normal <1.2 mg/dl). Four of these patients also had proteinuria varying from + to +++ (patients 3, 4, 5 and 6).
Died day 5 Died day 9 Died day 19 Recovered Recovered
3.6. Patient management During their hospital stay, the six patients who died all received multiple blood product transfusions, including packed cells, platelets and fresh frozen plasma. Patient no. 8 received platelet transfusions only and patient no. 7 did not require any blood products. The two patients who presented in the earlier part of this outbreak of CCHF, and one patient who presented later with mild disease, did not receive ribavirin. The drug was administered intravenously to four patients and orally to one patient (Table 4). The dose of ribavirin was not uniform and not in accordance with previously recommended schedules (Fisher-Hoch et al., 1995), except in patient no. 3, in whom the disease was recognized promptly and ribavirin was given at a loading dose of 2 gm intravenously on the day of admission (day 4 of onset of symptoms). This was followed by 1 g every 6 hours for 4 days and 500 mg every 8 hours subsequently. Treatment had to be stopped on day 5 in this patient due to acute renal failure. Despite early institution of treatment at an appropriate dose, the patient died on day 12 of his illness. Of the other five patients who received ribavirin, only one patient who had a mild illness (patient 7) survived. Death occurred, with or without ribavirin treatment, between days 5 to 19 of disease onset (Table 4).
3.5. Radiological findings
4. Results of phylogenetic analysis of CCHF RNA
The main findings in the four patients who underwent ultrasound examination of the abdomen were the presence of free fluid in the peritoneal cavity (patients 3, 5 and 6), dilated bowel loops (patient 1) and acalculous cholecystitis (patient 3).
The nucleotide sequence of the S RNA segment from patient no. 3 was compared with previously determined sequences in a phylogenetic analysis (Figure 3). This showed that the virus was very closely related to CCHFV strains isolated from
582
Figure 3 Phylogenetic analysis of Crimean-Congo hemorrhagic fever virus (CCHFV). Sequence data base accession numbers and geographic origin are indicated for each sequence. Branch lengths are proportional to the horizontal distances shown; vertical separations are for clarity only. Quartet puzzling support values (%) are shown as italic numbers. CCHFV strains originating in Pakistan are highlighted.
ticks and from patients in CCHF-endemic and enzootic areas of Pakistan over the last three decades (Hewson et al., 2004).
5. Discussion Crimean-Congo hemorrhagic fever is endemic and enzootic in parts of Pakistan (Burney et al., 1980). After the initial isolation of CCHFV from Hyalomma ticks in the 1960s (Begum et al., 1970), there have been 13 documented outbreaks in the country (Altaf et al., 1998; Athar et al., 2003; Burney
B. Jamil et al. et al., 1980; Casals, 1978; Fisher-Hoch et al., 1995), as well as sporadic cases from the rural enzootic areas of Balochistan. Previous outbreaks in nonendemic urban areas have been attributed to nomadic movement (Burney et al., 1980). In the year 2000, a CCHF epidemic was noted in Loralai District of Balochistan (45 reported cases) from the first week of September to December (unpublished data). This period coincided with transit of sacrificial animals (cattle, goats and sheep) from the North West Frontier Province and Balochistan to Karachi for the Islamic festival of Eid-ul-Azha. The sacrifice, as always, took place on streets and roadside kerbs and involved close contact between animals and humans. During this period, patients were admitted to our hospital with fever and thrombocytopenia, some of whom were suspected to have CCHF. We suggest that some of the animals from CCHF-enzootic areas may have been viremic with CCHFV and/or carried the tick on arrival in the city and thus led to the first outbreak of CCHF in urban Karachi. Viremia in animals and presence of CCHFV-carrying ticks could not be confirmed during the outbreak due to non-availability of diagnostic tests at that time. The tests have since become available and epidemiological studies looking at CCHFV IgG titers in cattle and humans are currently underway. Possible risk factors were occupational and residential. Two patients (butchers) may have had contact with viremic animals. One of these patients, and one other, were resident in an endemic/enzootic area. Factors which led to infection in the remaining patients could not be ascertained. In our patients with CCHF, fever, vomiting and body aches were the commonest presenting complaints. Fever was intermittent, as has been described previously (Swanepoel et al., 1987), and high-grade fever throughout the course of illness was associated with a poor outcome. This association has not been described before. Other features associated with mortality were deranged coagulation profile as has been described previously (Swanepoel et al., 1989) and renal failure. Leucopenia was more severe in those who died. There was no difference in the severity and duration of thrombocytopenia between survivors and non-survivors, and persistent thrombocytopenia was not a prognostic marker. Mortality in our CCHF patients was 75% compared to the 5—30% (Casals, 1978) and 73% (Schwarz et al., 1997) reported in the literature. One of our cases had confirmed and another one had likely nosocomial transmission, which reportedly has a higher mortality, up to 80% (Suleiman et al., 1980; Swanepoel et al., 1987). Late presentation and
Crimean-Congo hemorrhagic fever in Pakistan inadequate antiviral treatment could also have contributed to the high mortality in our patients. Ribavirin has anti-CCHFV activity in vitro and in animal models (Huggins, 1989; Tignor and Hanham, 1993; Watts et al., 1989) and its use has been reported to improve patient outcome (Athar et al., 2003). The prophylactic (van de Wal et al., 1985) and therapeutic (van Eeden et al., 1985) efficacy of ribavirin in CCHF remains to be proven beyond doubt, although recent reports suggest good efficacy (Mardani et al., 2003). Ribavirin was not administered to all the suspected cases because of delay in disease recognition in a non-endemic area and very limited availability of parenteral ribavirin (which was not marketed in Pakistan at the time of the outbreak), so it was not possible to use the drug in accordance with the recommended regimens in all the suspected cases. Of the five patients treated with ribavirin, four died despite early clinical diagnosis (day 3 of onset) and treatment. The early institution of antiviral therapy did not affect the uniformly poor outcome of CCHF patients with DIC. Given the difficulties involved in obtaining parenteral ribavirin and poor health economics of the regions where CCHF is prevalent, administration of ribavirin to every patient with suspected VHF cannot be ensured. In view of the high mortality and the potential for nosocomial spread (Altaf et al., 1998; Burney et al., 1980) it is important that CCHF is rapidly recognized and confirmed. Early recognition is challenging in an area which experiences a surge in cases of dengue fever from time to time (Akram et al., 1998; Qureshi et al., 1997; B. Jamil et al., unpublished data). Additionally, history of exposure or contact with animals, infected individuals or tick bite may not be forthcoming in many patients. Laboratory confirmation of VHF is problematic when the specific diagnostic tests are restricted to a few reference laboratories worldwide. In this outbreak, sera were sent to the Centers for Disease Control and Prevention (USA) and the Centre for Applied Microbiology and Research (UK) for confirmation, with a minimum turnaround time of 3 weeks, which precluded the use of these tests for diagnosis. From an epidemiological point of view, viral phylogenetic analysis is important to allow comparison with other CCHF strains that have been isolated in the country over a period of time as well as with those circulating within the region. Such analysis showed that the virus isolated from one of our patients was very closely related to CCHFV strains isolated from both ticks and patients in CCHF-endemic and enzootic areas of Pakistan (Hewson et al., 2004). This suggests that the
583 outbreak in Karachi was a consequence of spread of CCHFV from endemic/enzootic areas of Pakistan, to a non-endemic urban area, either through infected or tick-bearing cattle, goats and sheep (likely) or through other means, e.g. migrating birds (less likely). Phylogenetic studies further show that CCHFV strains from Pakistan, the United Arab Emirates and Madagascar fall into the Asia 1 genogroup (Hewson et al., 2004) suggesting that the livestock trade, and perhaps bird migration may have brought about links between these distant locations. In conclusion, this outbreak of VHF underscores the need for clinicians to recognize CCHF at an early stage of the illness. This would help patient management through early institution of ribavirin therapy and also ensure that appropriate precautions are taken to prevent nosocomial spread. Conflicts of interest statement The authors have no conflicts of interest concerning the cases reported in this paper.
Acknowledgements We would like to thank Dr Amna Rehana Siddiqui for her advice and Dr Stuart Nichol and the Special Pathogens Branch at the Centre for Disease Control and Prevention, Atlanta, GA, USA for serodiagnosis. Work at Centre for Emergency Preparedness and Response on CCHFV was supported by the Department of Health of England and Wales and by the Wellcome Trust (project grant no. 061414). The views expressed in this publication are those of the authors and not necessarily those of the Department of Health.
References Akram, D.S., Igarashi, A., Takasu, T., 1998. Dengue virus infection among children with undifferentiated fever in Karachi. Indian J. Pediatr. 65, 735—740. Al-Tikriti, S.K., Al-Ani, F., Jurji, F.J., Tantawi, H., Al-Moslih, M., Al-Janabi, N., Mahmud, M.I.A., Al-Bana, A., Habib, H., AlMunthri, H., Al-Junabi, Sh., Al-Jawahry, K., Yonan, M., Hassan, F., Simpson, D.I.H., 1981. Congo/Crimean haemorrhagic fever in Iraq. Bull. World Health Org. 59, 85—90. Altaf, A., Luby, S., Ahmed, A.J., Zaidi, N., Khan, A.J., Mirza, S., McCormick, J., Fisher-Hoch, S., 1998. Outbreak of CrimeanCongo hemorrhagic fever in Quetta, Pakistan: contact tracing and risk assessment. Trop. Med. Int. Health 3, 878—882. Athar, M.N., Baqai, H.Z., Ahmad, M., Khalid, M.A., Bashir, N., Ahmad, A.M., Balouch, A.H., Bashir, K., 2003. Short report: Crimean-Congo hemorrhagic fever outbreak in Rawalpindi, Pakistan, February 2002. Am. J. Trop. Hyg. 69, 284—287. Begum, F., Wisseman Jr., C.L., Casals, J., 1970. Tick-borne viruses of West Pakistan. IV. Viruses similar to or identi-
584 cal with Crimean hemorrhagic fever (Congo-Semunya), Wad Medani and Pak Argas 461 isolated from ticks of the Changa Manga Forest, Lahore District, and of Hunza, Gilgit Agency, West Pakistan. Am. J. Epidemiol. 92, 197—202. Burney, M.I., Ghafoor, A., Saleen, M., Webb, P.A., Casals, J., 1980. Nosocomial outbreak of viral hemorrhagic fever caused by Crimean hemorrhagic fever-Congo virus in Pakistan, January 1976. Am. J. Trop. Med. Hyg. 29, 941—947. Burt, F.J., Leman, P.A., Smith, J.F., Swanepoel, R., 1998. The use of a reverse transcription-polymerase chain reaction for the detection of viral nucleic acid in the diagnosis of CrimeanCongo hemorrhagic fever. J. Virol. Meth. 70, 129—137. Casals, J., 1978. Crimean-Congo hemorrhagic fever. In: Proceedings of an International Colloquium on Ebola Virus Infection and Other Haemorrhagic Fevers held in Antwerp, Belgium, 68 December, 1977. Elsevier/North Holland Biomedical Press, Amsterdam. Fisher-Hoch, S.P., Khan, J.A., Rehman, S., Mirza, S., Khurshid, M., McCormick, J.B., 1995. Crimean-Congo hemorrhagic fever treated with oral ribavirin. Lancet 346, 472—475. Hewson, R., Chamberlain, J., Mioulet, V., Lloyd, G., Jamil, B., Hasan, R., Gmy, A., Gmyl, L., Smirnova, S.E., Lukashev, A., Karganova, G., Clegg, C., 2004. Crimean-Congo hemorrhagic fever virus: sequence analysis of the small RNA segments from a collection of viruses world wide. Virus Res. 102, 185—189. Huggins, J.W., 1989. Prospects for treatment of viral hemorrhagic fevers with ribavirin, a broad-spectrum antiviral drug. Rev. Infect. Dis. 11 (Suppl. 4), S750—S761. Leshchinskaya, E.V., 1965. Clinical picture of Crimean hemorrhagic fever. Trudy Inst Polio Virus Enstaf Akad Med Nauk SSSR 7, 226—236 (in Russian). Mardani, M., Jahromi, M.K., Naieni, K.H., Zeinali, M., 2003. The efficacy of oral ribavirin in the treatment of Crimean-Congo hemorrhagic fever in Iran. Clin. Infect. Dis. 36, 1613—1618.
B. Jamil et al. Qureshi, J.A., Notta, N.J., Salahuddin, N., Zaman, V., Khan, J.A., 1997. An epidemic of dengue fever in Karachi — associated clinical manifestations. J. Pak. Med. Assoc. 47, 178—181. Schwarz, T.F., Nsanze, H., Ameen, A.M., 1997. Clinical features of Crimean-Congo hemorrhagic fever in the United Arab Emirates. Infection 25, 364—367. Suleiman, M.N., Muscat-Baron, J.M., Harries, J.R., Satti, A.G., Platt, G.S., Bowen, E.T., Simpson, D.I., 1980. Congo-Crimean hemorrhagic fever in Dubai. An outbreak at the Rashid hospital. Lancet ii, 939—941. Swanepoel, R., Gill, D.E., Shepard, A.J., Leman, P.A., Mynhardt, J.H., Harvey, S., 1989. The clinical pathology of Crimean-Congo Hemorrhagic Fever. Rev. Inf. Dis. II (Suppl. 4), S794—S800. Swanepoel, R., Shepard, A.J., Leman, P.A., Shepard, S.P., McGillivray, G.M., Erasmus, M.J., Searle, L.A., Gill, D.E., 1987. Epidemiological and clinical features of Crimean-Congo hemorrhagic fever in Southern Africa. Am. J. Trop. Med. Hyg. 36, 120—132. Tignor, G.H., Hanham, C.A., 1993. Ribavirin efficacy in an in vivo model of Crimean-Congo hemorrhagic fever virus (CCHF) infection. Antiviral Res. 22, 309—325. van de Wal, B.W., Joubert, J.R., van Eeden, P.J., King, J.B., 1985. A nosocomial outbreak of Crimean-Congo hemorrhagic fever at Tygerberg Hospital. Part IV. Preventive and prophylactic measures. S. Afr. Med. J. 68, 729—732. van Eeden, P.J., van Eeden, S.F., Joubert, J.R., King, J.B., van de Wal, B.W., Michell, W.L., 1985. A nosocomial outbreak of Crimean-Congo hemorrhagic fever at Tygerberg Hospital. Part II. Management of patients. S. Afr. Med. J. 68, 718— 721. Watts, D.M., Ussery, M.A., Nash, D., Peters, C.J., 1989. Inhibition of Crimean-Congo hemorrhagic fever viral infectivity yields in vitro by ribavirin. Am. J. Trop. Med. Hyg. 41, 581—585.
Crimean-Congo hemorrhagic fever: experience at a tertiary care hospital in Karachi, Pakistan Bushra Jamil a,b,∗, Rumina S. Hasan b, Arif R. Sarwari c, Jane Burton d, Roger Hewson d, Christopher Clegg d a
Department of Medicine, The Aga Khan University Hospital, Stadium Road, P.O. Box 3500, Karachi 74800, Pakistan b Department of Pathology/Microbiology, The Aga Khan University Hospital, Karachi, Pakistan c Robert C. Byrd Health Sciences Center, West Virginia University, Morgantown, WV, USA d Novel and Dangerous Pathogens, Centre for Emergency Preparedness and Response —– Health Protection Agency, Porton Down, Salisbury, UK Received 30 April 2004 ; received in revised form 11 March 2005; accepted 11 March 2005
KEYWORDS Crimean-Congo hemorrhagic fever; Prognostic markers; Reverse transcriptase—PCR; Nucleotide sequence; Pakistan
Summary Crimean-Congo hemorrhagic fever (CCHF) is endemic in certain rural areas of Pakistan. Since the discovery of CCHF virus (CCHFV) in the country in the 1960s, there have been 13 outbreaks in addition to sporadic cases. An outbreak during 2000 coincided with the movement of sacrificial animals from rural to urban areas for the festival of Eid-ul-Azha. Diagnosis was suspected in patients with fever and thrombocytopenia, and confirmed retrospectively using immunoassays and reverse transcriptase-PCR. Patients were given platelet, plasma and red cell infusions. Management varied due to unfamiliarity with the condition and its treatment, lack of availability of diagnostic laboratory tests and limited supply of ribavirin. Inadequate antiviral treatment and late presentation probably contributed to the death of six of the eight patients. Renal failure, disseminated intravascular coagulation and persistent high-grade fever were associated with mortality. The nucleotide sequence of the small genomic RNA segment of the CCHFV isolated in this outbreak was found to be very closely related to the CCHFV strains previously isolated in Pakistan. © 2005 Published by Elsevier Ltd on behalf of Royal Society of Tropical Medicine and Hygiene.
1. Introduction
* Corresponding author. Tel.: +92 21 4930051x4515; fax: +92 21-4934294/4932095. E-mail addresses: [email protected], [email protected], [email protected] (B. Jamil).
Crimean-Congo hemorrhagic fever (CCHF) is endemic in parts of Africa, southeastern Europe, the Russian Federation, Central Asia and Pakistan (Casals, 1978). The CCHF virus (CCHFV) (genus Nairovirus, family Bunyaviridae) is a small
0035-9203/$ — see front matter © 2005 Published by Elsevier Ltd on behalf of Royal Society of Tropical Medicine and Hygiene. doi:10.1016/j.trstmh.2005.03.002
578 enveloped virus with a genome consisting of three segments of single-stranded RNA of negative polarity. The disease is transmitted through tick bite, or direct contact with viremic animals or humans. Disease manifestations range from self-limiting flu-like symptoms to overt life-threatening hemorrhage (Leshchinskaya, 1965; Swanepoel et al., 1987). In this study, we describe the clinical and laboratory features in eight cases of CCHF who presented to a tertiary care hospital in a non-endemic area during the year 2000 outbreak in Pakistan. We analyze the possible reasons for this outbreak in urban Karachi during the festival of Eid-ul-Azha and the various factors that were associated with increased mortality. Clinical diagnosis of CCHF in this case series was based on history of contact and presence of fever and thrombocytopenia, with or without overt bleeding. Patient management issues arising from lack of familiarity with the condition and limited availability of ribavirin are discussed. Results of nucleotide sequencing of the small (S) genomic RNA segment of the CCHFV isolated from one of the patients in this outbreak are also presented to highlight the role of animal transit in disease spread.
2. Methods The Aga Khan University Hospital (AKUH) is a 647-bed, private, tertiary care teaching hospital that serves the estimated 8—12 million inhabitants of Karachi, Pakistan. The hospital also serves as a referral center for the nearby cities of the Sindh Province and other areas of Pakistan. Between September and November 2000, 29 patients were admitted to AKUH with fever and thrombocytopenia. On the basis of clinical features and suggestive laboratory abnormalities including initial hemoconcentration followed by a drop in hemoglobin/hematocrit, leucopenia, thrombocytopenia and deranged coagulation, a diagnosis of viral hemorrhagic fever (VHF) was made. Confirmatory diagnostic tests for VHF were not available. Crimean-Congo hemorrhagic fever was strongly suspected in 8/29 of these patients. The cause of fever and thrombocytopenia could not be ascertained in the rest of the cases and because of initial lack of suspicion, blood samples could not be collected from these patients for retrospective confirmation of diagnosis of CCHF. These cases were therefore excluded from this study. Serum samples from the suspected cases of VHF were collected and stored at −80 ◦ C. These samples were subsequently sent to the Centers
B. Jamil et al. for Disease Control and Prevention, Atlanta, GA, USA, where they were screened for CCHF antigens, and anti-CCHF IgG and IgM antibodies (details of methodology not available). Stored sera were also sent to the Centre for Emergency Preparedness and Response —– Health Protection Agency, Salisbury, UK, for retrospective confirmation of diagnosis using reverse transcriptase-PCR (RT-PCR). RNA was extracted from serum samples using the Viral RNA Mini kit (Qiagen, USA) according to the manufacturer’s protocol. The method described by Burt et al. (1998) was used to amplify a fragment of the small (S) RNA segment by RT-PCR. Subsequently, the primers 6486 (5 TCTCAAAGAAACACGTGCCGCTTACGC) and 6487 (5 TCTCAAAGATATCGTTGCCGCACAGCCCTT) were used to amplify the complete S RNA segment. The complete nucleotide sequence of the S RNA segment was determined from the RT—PCR products, which were amplified directly from a serum specimen from patient no. 3, confirming the identity of the infecting virus as CCHFV. The SRS server at the European Bioinformatics Institute was used to identify and recover fulllength CCHFV S genomic RNA sequences. These were aligned using Clustalw version 1.82, with the inclusion of full-length S RNA sequences from CCHFV strains Baghdad-12 (Al-Tikriti et al., 1981) and SR3 (this paper). The S RNA sequence of the related Nairovirus Hazara was also included. The resulting alignment was analysed using the program Tree-Puzzle version 5.0 and the output maximum likelihood tree drawn using TreeView.
3. Case reports 3.1. Patients Characteristics of the eight cases diagnosed with CCHF are shown in Table 1. All were males, with an age range of 15—48 years (mean 26.4). The diagnosis was confirmed retrospectively with positive serological tests (antigen detection, IgM and IgG) for CCHFV in 6/8 of these patients, and additionally by recovery of CCHFV sequences by RT—PCR in one patient (Table 1). Patients no. 1 (laboratory technician) and no. 6 (butcher) were from Quetta, Balochistan, an area known to be endemic for CCHF. The other six patients were residents of Karachi and gave no history of travel to any CCHFV-endemic area in the few weeks prior to presentation. For patient no. 2, results of confirmatory tests were not available. However, he was the index case for patient no. 3 and remained in hospital from 13 to 16 October 2000 with active bleeding from different
Crimean-Congo hemorrhagic fever in Pakistan
579
Table 1
Characteristics of patients with Crimean-Congo hemorrhagic fever (CCHF), Karachi, Pakistan, 2000
Patient no.
Age (years)
Occupation
1
18
2 3 4 5 6 7d 8d
40 30 16 16 28 15 48
Laboratory technician Butcherb Nurse Studentc Studentc Butcher Student Gas company workerc
a b c d
Residence
Month admitted
Duration of symptoms on admission (days)
Quetta
Sept
Karachi Karachi Karachi Karachi Quetta Karachi Karachi
Oct Oct Nov Nov Nov Nov Nov
CCHFV Antigen
IgM
IgG
RT—PCRa
4
−
+
+
−
4 3 3 5 9 2 4
Not tested + + − + + −
− − − + − +
− − − − − −
+ − − − − −
Reverse transcriptase—PCR. Index case for patient no. 3. No documented history of contact. Survived.
sites. Patient no. 3, a nurse at AKUH looked after him and came down with high-grade fever on 19 October and subsequently developed disseminated intravascular coagulation. Patients no. 5 (included despite negative confirmatory tests) and no. 7 were inhabitants of an orphanage, located in the outskirts of Karachi. They had a history of contact with another inhabitant with suspected VHF (outcome of the latter unknown). Patients no. 4 and 8 did not have any obvious risk factors or history suggestive of exposure to CCHF.
Fever and vomiting were the commonest presenting complaints. Other clinical features, either on presentation or during the hospital stay, were gastrointestinal bleeding, myalgias and bleeding from other sites of the body (Figure 1).
The mean duration of symptoms was 4.3 days (range 2—9 days) at the time of admission. Petechiae and/or ecchymoses were seen in three patients (patients 3, 6 and 8) and were present at the time of admission (day 3 to 7 of onset of symptoms). Mucosal bleeding from the respiratory (epistaxis, hemoptysis), gastrointestinal (hematemesis melena/hematochezia) and genitourinary tracts (hematuria) manifested between 4 and 10 days after onset of symptoms. Six out of eight patients had evidence of skin and/or mucosal bleeding. Fever remained high grade (up to 40 ◦ C axillary) throughout the course of illness in all six patients who died (mean 37.9 ◦ C axillary). One of these (patient 6), however, did become afebrile 48 h before death. The two patients who recovered (patients 7 and 8) presented with history of fever but remained afebrile throughout their hospital stay (Figure 2).
Figure 1 Frequency of clinical features of patients with Crimean-Congo hemorrhagic fever, Karachi, Pakistan, 2000.
Figure 2 Average daily body temperatures (axillary) in patients with Crimean-Congo hemorrhagic fever, Karachi, Pakistan, 2000. av d: temperature in those who died; av s: temperature in those who survived.
3.2. Clinical features
580
Table 2
B. Jamil et al.
Blood counts in patients with Crimean-Congo hemorrhagic fever (CCHF), Karachi, Pakistan, 2000
Patient no.
Total leucocyte count (109 /l) Lowest (d)
Highest (d)
1 2 3 4 5 6 7 8
2.7 (11) 1.2 (7) 0.8 (7) 5.7 (5) 2.2 (7) 4 (10) 3.7 (5) 3.9 (13)
12.9 6.3 10.5 5.9 24.2 7.2 4.8 7.3
(5) (5) (14) (4) (9) (15) (4) (17)
Lymphocytes (%) (d)
Atypical lymphocytes (d)
Monocytes (%) (d)
43 (5) 54.2 (7) 40.7 (8) 41.2 (5) 56.4 (7) 32.3 (10) 39.5 (3) 44.1 (16)
− − − + (5) − − + (3) + (15)
8 (5) 7.2 (7) 19.1 (8) 1.5 (4) 22 (6) 15.6 (15) 17.5 (3) 11.5 (13)
Platelets (109 /l) Lowest (d)
Highest (d)
13 9 12 25 17 22 55 1
50 18 46 47 74 99 184 4
(11) (5) (7) (4) (8) (11) (3) (7)
(5) (7) (14) (5) (6) (15) (6) (11)
(d): day of illness.
3.3. Hematological abnormalities Total leucocyte counts varied between 0.8 × 109 /l and 24 × 109 /l. Leucopenia (total leucocyte count ≤4 × 109 /l) was seen in six patients from day 4 to 13 of onset (Table 2). Four patients who had marked leucopenia (total leucocyte count <3 × 109 /l) died while the two patients who survived had counts ≥3.7 × 109 /l (3.9 to 7.3 × 109 /l). On average, white cell counts dropped to a mean of 2.76 × 109 /l in those who died, while the mean white cell count in those who survived was 3.8 × 109 /l. Lymphocytosis (≥40%) was noted during the early phase of infection in 6/8 patients. Atypical lymphocytes were transiently present between days 4 and 15 of onset of symptoms in the two patients who recovered and in one of the patients who died. Elevated monocyte counts were also noted in 2/6 of the patients who died (mean of 12.3% in survivors vs. 7.7% in non-survivors). All patients were thrombocytopenic (platelet count <150 × 109 /l) from day 4 to day 19 after onset of fever (Table 2). Platelet counts varied from 1 to Table 3
184 × 109 /l (normal range 150—400 × 109 /l). Severity of thrombocytopenia did not correlate with disease outcome. Of the two patients who survived, one patient (patient 8) had prolonged thrombocytopenia, which persisted for about a month after recovery from infection and eventually resolved with prednisolone therapy. Bone marrow examination in this patient revealed normal megakaryocytes. This patient did not have disseminated intravascular coagulation (DIC) at any time during the course of his illness. Disseminated intravascular coagulation was a feature in all the six patients who died (patients 1 to 6) with prolonged prothrombin time (PT) and activated partial thromboplastin time (APTT) (Table 3). The mean value of prothrombin time in survivors was 12.5 s (control 13 s, range 10.5—14.7 s) with a mean international normalized ratio (INR) of 1.01, while the mean PT in those who died was 20.3 s (range 10.7—63 s) with a mean INR of 1.78. The range of APTT was 57 to >120 s (control 29—32 s, mean 81.3 s, range 32.2 to >120 s) in the patients who died vs. 30.1 s (range 26.3—36.8 s) in the two survivors. D-dimer (cross-linked fibrin
Laboratory valuesa in patients with Crimean-Congo hemorrhagic fever, Karachi, Pakistan, 2000
Patient no.
PT/INR (s) (d)
APTT (s) (d)
D-dimer (d)
TB mg/dl (d)
AST (IU/l) (d)
ALT (IU/l) (d)
AP (IU/l) (d)
1 2 3 4 5 6 7 8
35.3/3.5 (5) 20.8/1.8 (7) 63/7.41 (14) 25.8/2.17 (4) 19.9/1.67 (9) 12.5/1.05 (10) 10.5/0.87 (3) 14.7/1.17(13)
80 (5) >120 (5) >120 (8—14) 60.9 (4) 57 (9) 60.1 (10) 26.3 (3) 36.8 (13)
4 (5) 8 (5) ND 8 (4) ND 4 (10) ND 0.5 (13)
2.6 0.3 2.8 0.6 1.3 3.3 0.5 0.5
ND ND ND ND ND 7536 (10) 69 (3) 16 (13)
2061 54 684 49 22 2397 34 13
139 130 121 136 121 196 112 37
(5) (5) (5) (4) (6) (10) (13)
(5) (5) (5) (4) (6) (10) (3) (13)
(5) (5) (5) (4) (6) (10) (3) (13)
(d): day of illness; ND: not done. PT: prothrombin time; INR: International normalized ratio; APTT: activated partial thromboplastin time; TB: total bilirubin; AST: aspartate aminotransferase; ALT: alanine aminotransferase; AP: alkaline phosphatase. Normal ranges: APTT: control 29—32 s; D-dimer: control <0.5; TB: 0.2—1.25 mg/dl; AST: 8—46 IU/l; ALT: 0—55 IU/l,; AP: 28—124 IU/l. a Highest value.
Crimean-Congo hemorrhagic fever in Pakistan
581
Table 4 Duration of hospitalization, ribavirin therapy and disease outcome in patients with Crimean-Congo hemorrhagic fever, Karachi, Pakistan, 2000 Patient no.
Hospital stay (days)
1 2 3
8 4 9
4 5 6 7
2 4 11 4
8
10
Ribavirin
Outcome
Not given Not given 2 g i.v. followed by 1 g 6 hourly for 4 days, 500 mg 8 hourly for 1 day; started on admission (day 4 of onset of symptoms) 1.5 g i.v. followed by 400 mg 8 hourly for 2 days; started on admission 400 mg i.v. 8 hourly for 4 days; started on admission 400 mg by mouth, 8 hourly for 9 days; started on admission 720 mg i.v., 6 hourly for 2 days followed by 400 mg by mouth, 8 hourly for 7 days; started on admission Not given
Died day 12 of onset Died day 8 Died day 14
derivative) was checked in five patients; mean value in those who died was 4.8 (control <0.5). The D-dimer value remained within the normal range in one of the two patients who recovered. It was not checked in the other survivor who had no evidence of DIC. The peripheral smear appearance was suggestive of microangiopathy in patients no. 1 and no. 4.
3.4. Hepatic and renal abnormalities Liver function tests were deranged in three of the patients who died; total bilirubin and aminotransferases were elevated (patients 1, 3 and 6) and alkaline phosphatase was concomitantly elevated in patient no. 6 (Table 3). One of these patients (patient 1) also had a positive hepatitis B core antibody (IgM and IgG), and concomitant infection with hepatitis B virus could have contributed to the markedly deranged enzymes. Hepatitis serology was not done in patient no. 6. Liver function tests were within the normal range in the other patients. Serum creatinine remained normal (≤1.1 mg/dl) in those who recovered, but was elevated in all six patients who died (range 1.4—7.1 mg/dl; normal <1.2 mg/dl). Four of these patients also had proteinuria varying from + to +++ (patients 3, 4, 5 and 6).
Died day 5 Died day 9 Died day 19 Recovered Recovered
3.6. Patient management During their hospital stay, the six patients who died all received multiple blood product transfusions, including packed cells, platelets and fresh frozen plasma. Patient no. 8 received platelet transfusions only and patient no. 7 did not require any blood products. The two patients who presented in the earlier part of this outbreak of CCHF, and one patient who presented later with mild disease, did not receive ribavirin. The drug was administered intravenously to four patients and orally to one patient (Table 4). The dose of ribavirin was not uniform and not in accordance with previously recommended schedules (Fisher-Hoch et al., 1995), except in patient no. 3, in whom the disease was recognized promptly and ribavirin was given at a loading dose of 2 gm intravenously on the day of admission (day 4 of onset of symptoms). This was followed by 1 g every 6 hours for 4 days and 500 mg every 8 hours subsequently. Treatment had to be stopped on day 5 in this patient due to acute renal failure. Despite early institution of treatment at an appropriate dose, the patient died on day 12 of his illness. Of the other five patients who received ribavirin, only one patient who had a mild illness (patient 7) survived. Death occurred, with or without ribavirin treatment, between days 5 to 19 of disease onset (Table 4).
3.5. Radiological findings
4. Results of phylogenetic analysis of CCHF RNA
The main findings in the four patients who underwent ultrasound examination of the abdomen were the presence of free fluid in the peritoneal cavity (patients 3, 5 and 6), dilated bowel loops (patient 1) and acalculous cholecystitis (patient 3).
The nucleotide sequence of the S RNA segment from patient no. 3 was compared with previously determined sequences in a phylogenetic analysis (Figure 3). This showed that the virus was very closely related to CCHFV strains isolated from
582
Figure 3 Phylogenetic analysis of Crimean-Congo hemorrhagic fever virus (CCHFV). Sequence data base accession numbers and geographic origin are indicated for each sequence. Branch lengths are proportional to the horizontal distances shown; vertical separations are for clarity only. Quartet puzzling support values (%) are shown as italic numbers. CCHFV strains originating in Pakistan are highlighted.
ticks and from patients in CCHF-endemic and enzootic areas of Pakistan over the last three decades (Hewson et al., 2004).
5. Discussion Crimean-Congo hemorrhagic fever is endemic and enzootic in parts of Pakistan (Burney et al., 1980). After the initial isolation of CCHFV from Hyalomma ticks in the 1960s (Begum et al., 1970), there have been 13 documented outbreaks in the country (Altaf et al., 1998; Athar et al., 2003; Burney
B. Jamil et al. et al., 1980; Casals, 1978; Fisher-Hoch et al., 1995), as well as sporadic cases from the rural enzootic areas of Balochistan. Previous outbreaks in nonendemic urban areas have been attributed to nomadic movement (Burney et al., 1980). In the year 2000, a CCHF epidemic was noted in Loralai District of Balochistan (45 reported cases) from the first week of September to December (unpublished data). This period coincided with transit of sacrificial animals (cattle, goats and sheep) from the North West Frontier Province and Balochistan to Karachi for the Islamic festival of Eid-ul-Azha. The sacrifice, as always, took place on streets and roadside kerbs and involved close contact between animals and humans. During this period, patients were admitted to our hospital with fever and thrombocytopenia, some of whom were suspected to have CCHF. We suggest that some of the animals from CCHF-enzootic areas may have been viremic with CCHFV and/or carried the tick on arrival in the city and thus led to the first outbreak of CCHF in urban Karachi. Viremia in animals and presence of CCHFV-carrying ticks could not be confirmed during the outbreak due to non-availability of diagnostic tests at that time. The tests have since become available and epidemiological studies looking at CCHFV IgG titers in cattle and humans are currently underway. Possible risk factors were occupational and residential. Two patients (butchers) may have had contact with viremic animals. One of these patients, and one other, were resident in an endemic/enzootic area. Factors which led to infection in the remaining patients could not be ascertained. In our patients with CCHF, fever, vomiting and body aches were the commonest presenting complaints. Fever was intermittent, as has been described previously (Swanepoel et al., 1987), and high-grade fever throughout the course of illness was associated with a poor outcome. This association has not been described before. Other features associated with mortality were deranged coagulation profile as has been described previously (Swanepoel et al., 1989) and renal failure. Leucopenia was more severe in those who died. There was no difference in the severity and duration of thrombocytopenia between survivors and non-survivors, and persistent thrombocytopenia was not a prognostic marker. Mortality in our CCHF patients was 75% compared to the 5—30% (Casals, 1978) and 73% (Schwarz et al., 1997) reported in the literature. One of our cases had confirmed and another one had likely nosocomial transmission, which reportedly has a higher mortality, up to 80% (Suleiman et al., 1980; Swanepoel et al., 1987). Late presentation and
Crimean-Congo hemorrhagic fever in Pakistan inadequate antiviral treatment could also have contributed to the high mortality in our patients. Ribavirin has anti-CCHFV activity in vitro and in animal models (Huggins, 1989; Tignor and Hanham, 1993; Watts et al., 1989) and its use has been reported to improve patient outcome (Athar et al., 2003). The prophylactic (van de Wal et al., 1985) and therapeutic (van Eeden et al., 1985) efficacy of ribavirin in CCHF remains to be proven beyond doubt, although recent reports suggest good efficacy (Mardani et al., 2003). Ribavirin was not administered to all the suspected cases because of delay in disease recognition in a non-endemic area and very limited availability of parenteral ribavirin (which was not marketed in Pakistan at the time of the outbreak), so it was not possible to use the drug in accordance with the recommended regimens in all the suspected cases. Of the five patients treated with ribavirin, four died despite early clinical diagnosis (day 3 of onset) and treatment. The early institution of antiviral therapy did not affect the uniformly poor outcome of CCHF patients with DIC. Given the difficulties involved in obtaining parenteral ribavirin and poor health economics of the regions where CCHF is prevalent, administration of ribavirin to every patient with suspected VHF cannot be ensured. In view of the high mortality and the potential for nosocomial spread (Altaf et al., 1998; Burney et al., 1980) it is important that CCHF is rapidly recognized and confirmed. Early recognition is challenging in an area which experiences a surge in cases of dengue fever from time to time (Akram et al., 1998; Qureshi et al., 1997; B. Jamil et al., unpublished data). Additionally, history of exposure or contact with animals, infected individuals or tick bite may not be forthcoming in many patients. Laboratory confirmation of VHF is problematic when the specific diagnostic tests are restricted to a few reference laboratories worldwide. In this outbreak, sera were sent to the Centers for Disease Control and Prevention (USA) and the Centre for Applied Microbiology and Research (UK) for confirmation, with a minimum turnaround time of 3 weeks, which precluded the use of these tests for diagnosis. From an epidemiological point of view, viral phylogenetic analysis is important to allow comparison with other CCHF strains that have been isolated in the country over a period of time as well as with those circulating within the region. Such analysis showed that the virus isolated from one of our patients was very closely related to CCHFV strains isolated from both ticks and patients in CCHF-endemic and enzootic areas of Pakistan (Hewson et al., 2004). This suggests that the
583 outbreak in Karachi was a consequence of spread of CCHFV from endemic/enzootic areas of Pakistan, to a non-endemic urban area, either through infected or tick-bearing cattle, goats and sheep (likely) or through other means, e.g. migrating birds (less likely). Phylogenetic studies further show that CCHFV strains from Pakistan, the United Arab Emirates and Madagascar fall into the Asia 1 genogroup (Hewson et al., 2004) suggesting that the livestock trade, and perhaps bird migration may have brought about links between these distant locations. In conclusion, this outbreak of VHF underscores the need for clinicians to recognize CCHF at an early stage of the illness. This would help patient management through early institution of ribavirin therapy and also ensure that appropriate precautions are taken to prevent nosocomial spread. Conflicts of interest statement The authors have no conflicts of interest concerning the cases reported in this paper.
Acknowledgements We would like to thank Dr Amna Rehana Siddiqui for her advice and Dr Stuart Nichol and the Special Pathogens Branch at the Centre for Disease Control and Prevention, Atlanta, GA, USA for serodiagnosis. Work at Centre for Emergency Preparedness and Response on CCHFV was supported by the Department of Health of England and Wales and by the Wellcome Trust (project grant no. 061414). The views expressed in this publication are those of the authors and not necessarily those of the Department of Health.
References Akram, D.S., Igarashi, A., Takasu, T., 1998. Dengue virus infection among children with undifferentiated fever in Karachi. Indian J. Pediatr. 65, 735—740. Al-Tikriti, S.K., Al-Ani, F., Jurji, F.J., Tantawi, H., Al-Moslih, M., Al-Janabi, N., Mahmud, M.I.A., Al-Bana, A., Habib, H., AlMunthri, H., Al-Junabi, Sh., Al-Jawahry, K., Yonan, M., Hassan, F., Simpson, D.I.H., 1981. Congo/Crimean haemorrhagic fever in Iraq. Bull. World Health Org. 59, 85—90. Altaf, A., Luby, S., Ahmed, A.J., Zaidi, N., Khan, A.J., Mirza, S., McCormick, J., Fisher-Hoch, S., 1998. Outbreak of CrimeanCongo hemorrhagic fever in Quetta, Pakistan: contact tracing and risk assessment. Trop. Med. Int. Health 3, 878—882. Athar, M.N., Baqai, H.Z., Ahmad, M., Khalid, M.A., Bashir, N., Ahmad, A.M., Balouch, A.H., Bashir, K., 2003. Short report: Crimean-Congo hemorrhagic fever outbreak in Rawalpindi, Pakistan, February 2002. Am. J. Trop. Hyg. 69, 284—287. Begum, F., Wisseman Jr., C.L., Casals, J., 1970. Tick-borne viruses of West Pakistan. IV. Viruses similar to or identi-
584 cal with Crimean hemorrhagic fever (Congo-Semunya), Wad Medani and Pak Argas 461 isolated from ticks of the Changa Manga Forest, Lahore District, and of Hunza, Gilgit Agency, West Pakistan. Am. J. Epidemiol. 92, 197—202. Burney, M.I., Ghafoor, A., Saleen, M., Webb, P.A., Casals, J., 1980. Nosocomial outbreak of viral hemorrhagic fever caused by Crimean hemorrhagic fever-Congo virus in Pakistan, January 1976. Am. J. Trop. Med. Hyg. 29, 941—947. Burt, F.J., Leman, P.A., Smith, J.F., Swanepoel, R., 1998. The use of a reverse transcription-polymerase chain reaction for the detection of viral nucleic acid in the diagnosis of CrimeanCongo hemorrhagic fever. J. Virol. Meth. 70, 129—137. Casals, J., 1978. Crimean-Congo hemorrhagic fever. In: Proceedings of an International Colloquium on Ebola Virus Infection and Other Haemorrhagic Fevers held in Antwerp, Belgium, 68 December, 1977. Elsevier/North Holland Biomedical Press, Amsterdam. Fisher-Hoch, S.P., Khan, J.A., Rehman, S., Mirza, S., Khurshid, M., McCormick, J.B., 1995. Crimean-Congo hemorrhagic fever treated with oral ribavirin. Lancet 346, 472—475. Hewson, R., Chamberlain, J., Mioulet, V., Lloyd, G., Jamil, B., Hasan, R., Gmy, A., Gmyl, L., Smirnova, S.E., Lukashev, A., Karganova, G., Clegg, C., 2004. Crimean-Congo hemorrhagic fever virus: sequence analysis of the small RNA segments from a collection of viruses world wide. Virus Res. 102, 185—189. Huggins, J.W., 1989. Prospects for treatment of viral hemorrhagic fevers with ribavirin, a broad-spectrum antiviral drug. Rev. Infect. Dis. 11 (Suppl. 4), S750—S761. Leshchinskaya, E.V., 1965. Clinical picture of Crimean hemorrhagic fever. Trudy Inst Polio Virus Enstaf Akad Med Nauk SSSR 7, 226—236 (in Russian). Mardani, M., Jahromi, M.K., Naieni, K.H., Zeinali, M., 2003. The efficacy of oral ribavirin in the treatment of Crimean-Congo hemorrhagic fever in Iran. Clin. Infect. Dis. 36, 1613—1618.
B. Jamil et al. Qureshi, J.A., Notta, N.J., Salahuddin, N., Zaman, V., Khan, J.A., 1997. An epidemic of dengue fever in Karachi — associated clinical manifestations. J. Pak. Med. Assoc. 47, 178—181. Schwarz, T.F., Nsanze, H., Ameen, A.M., 1997. Clinical features of Crimean-Congo hemorrhagic fever in the United Arab Emirates. Infection 25, 364—367. Suleiman, M.N., Muscat-Baron, J.M., Harries, J.R., Satti, A.G., Platt, G.S., Bowen, E.T., Simpson, D.I., 1980. Congo-Crimean hemorrhagic fever in Dubai. An outbreak at the Rashid hospital. Lancet ii, 939—941. Swanepoel, R., Gill, D.E., Shepard, A.J., Leman, P.A., Mynhardt, J.H., Harvey, S., 1989. The clinical pathology of Crimean-Congo Hemorrhagic Fever. Rev. Inf. Dis. II (Suppl. 4), S794—S800. Swanepoel, R., Shepard, A.J., Leman, P.A., Shepard, S.P., McGillivray, G.M., Erasmus, M.J., Searle, L.A., Gill, D.E., 1987. Epidemiological and clinical features of Crimean-Congo hemorrhagic fever in Southern Africa. Am. J. Trop. Med. Hyg. 36, 120—132. Tignor, G.H., Hanham, C.A., 1993. Ribavirin efficacy in an in vivo model of Crimean-Congo hemorrhagic fever virus (CCHF) infection. Antiviral Res. 22, 309—325. van de Wal, B.W., Joubert, J.R., van Eeden, P.J., King, J.B., 1985. A nosocomial outbreak of Crimean-Congo hemorrhagic fever at Tygerberg Hospital. Part IV. Preventive and prophylactic measures. S. Afr. Med. J. 68, 729—732. van Eeden, P.J., van Eeden, S.F., Joubert, J.R., King, J.B., van de Wal, B.W., Michell, W.L., 1985. A nosocomial outbreak of Crimean-Congo hemorrhagic fever at Tygerberg Hospital. Part II. Management of patients. S. Afr. Med. J. 68, 718— 721. Watts, D.M., Ussery, M.A., Nash, D., Peters, C.J., 1989. Inhibition of Crimean-Congo hemorrhagic fever viral infectivity yields in vitro by ribavirin. Am. J. Trop. Med. Hyg. 41, 581—585.