Criniviruses infecting vegetable crops

C H A P T E R

12 Criniviruses infecting vegetable crops Varvara I. Maliogkaa, William M. Wintermantelb, Chrysoula G. Orfanidoua, Nikolaos I. Katisa a

Plant Pathology Laboratory, School of Agriculture, Faculty of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, Thessaloniki, Greece bUSDA-ARS, Salinas, CA, United States

12.1 Introduction Criniviruses have emerged recent decades as important plant pathogens. Most of them are associated with serious diseases of vegetables even though a few have also been identified in other crops including horticultural plants and small fruits (reviewed by Wisler et al., 1998a; Tzanetakis et  al., 2013). They are efficiently transmitted by whiteflies; a fact that has contributed significantly to their rapid spread and worldwide distribution (Wisler et al., 1998a). Interestingly, there is a high degree of specificity in the interactions of criniviruses with the whitefly species that transmit them; therefore, the geographic distribution of criniviruses is determined to a great extent by the distribution of their vectors. The rapid increase and spread of whitefly populations to new areas has been documented as a result of the climate change, human activities (monocropping, intensified practices, trade of plant material) and the development of resistance to pesticides (Navas-Castillo et al., 2011). Consequently, this often leads to the emergence of new or known crinivirus diseases in new geographic areas or in novel host species. This chapter focuses on criniviruses infecting major vegetable crops providing both general and species-specific characteristics of this important virus group.

12.2  Description of criniviruses’ characteristics in general 12.2.1  Genome organization, replication and phylogenetic relationships Members of the genus Crinivirus (from latin Crini, meaning hair) are positive sense single stranded RNA viruses that are classified within the family Closteroviridae along with viruses belonging to the genera Closterovirus, Ampelovirus and the newly formed Velarivirus (Martelli et al., 2002, 2011; Al Rwahnih et al., 2012). In contrast with the other family ­members

Applied Plant Biotechnology for Improving Resistance to Biotic Stress https://doi.org/10.1016/B978-0-12-816030-5.00012-4

251

Copyright © 2020 Palmiro Poltronieri and Yiguo Hong. Published by Elsevier Inc. All rights reserved.

252

12.  Criniviruses infecting vegetable crops

they possess segmented genomes that are separately encapsidated in long, filamentous particles (reviewed by Kiss et  al., 2013). With the exception of Potato yellow vein virus (PYVV) which possesses three genomic segments (Livieratos et al., 2004), criniviruses have bipartite genomes (Fig. 12.1), which are capped at their 5′ end (Kiss et al., 2013). Τhe genomic RNAs of criniviruses possess conserved gene modules involved in different processes of viral infection, similar to the other members of the Closteroviridae. RNA1 ranges from 7800 and 9407 nucleotides in length and possesses two conserved open reading frames (ORFs) encoding proteins associated with replication (Karasev, 2000). ORF 1a encodes a long polyprotein, including motifs of a papain-like leader protease (L-Pro), methyltransferase (MTR) and helicase (HEL) domains, which is proteolytically processed. ORF1b encodes the RNA dependent RNA polymerase (RdRp) expressed through a +1 ribosomal frameshift. In most cases one to three additional proteins of low molecular weight are putatively produced from ORFs found at the 3′ end of RNA1, and several have been identified as RNA silencing suppressors, including the p23 of Lettuce chlorosis virus (LCV) (Kubota and Ng, 2016), the p22 of Tomato chlorosis virus (ToCV) (Cañizares et al., 2008), the p25 of Cucurbit yellow stunting disorder virus (CYSDV) (Kataya et al., 2009) and the p22 of Sweet potato chlorotic stunt virus (SPCSV) which is further enhanced by the RNase3, a class I RNAseIII endonuclease (Kreuze et al., 2005) (Fig. 12.1). Other proteins encoded by the 3′ end of RNA1 may play a role in RNA replication. Replication of the Lettuce infectious yellows virus (LIYV) RNA2 has been shown to be dependent on the RNA-1 encoded p34 (Kiss et al., 2013). RNA2 ranges between 7193 and 8556 nucleotides in length and includes 7–10 ORFs (Fig. 12.1) that are not involved in replication (Kiss et al., 2013; Salem et al., 2009). Similarly to the other members of the Closteroviridae several 3′ co-terminal subgenomic RNAs are produced from RNA2 to facilitate translation of the viral proteins encoded from downstream ORFs (Rubio et al., 2002). This genomic fragment codes for the hallmark quintuple gene array characteristic of the family Closteroviridae that includes the small hydrophobic protein of approximately 5 kDa (p5) encoded at the 5′end of RNA1, the heat shock protein 70 homologue (HSP70h), the p60, the coat protein (CP) and the minor CP (CPm) (Karasev, 2000; Dolja et al., 2006). At least four of these proteins (HSP70h, p60, CP, CPm) are structural components of the virion and the CPm has been shown to be critical for association with the whitefly vector and whitefly transmission (Tian et al., 1999; Stewart et al., 2010). Moreover, the CP and CPm of ToCV were found, in addition to the RNA1-encoded p22, to possess silencing suppressor activity (Cañizares et al., 2008). Several low molecular weight proteins are encoded within the 5′ end of RNA2 upstream of the HSP70h, from the region between the HSP70h and p60, the p60 and the CP or from the 3′ end of the genomic RNA with most of them having unknown functions. The 8–10 kDa proteins encoded by ORFs located between the p60 and the CP are unique to members of the genus Crinivirus within the family Closteroviridae. Extensive studies of LIYV, the type member of the genus Crinivirus, and LCV elucidated several aspects of the crinivirus replication process (Kiss et al., 2013; Salem et al., 2009). RNA1 of LIYV can replicate alone in protoplasts while RNA2 requires the presence of RNA1 in the same host cell for its replication, and its synthesis is temporally delayed compared to RNA1 (Kiss et al., 2013). Interestingly and contrary to LIYV, genomic RNAs of LCV show a temporally similar accumulation pattern thus indicating that different replication mechanisms likely exist within the genus Crinivirus (Salem et al., 2009). Recently, it was highlighted that a 3′-end Y-shaped structure in RNA2 of LCV is essential for viral RNA synthesis (Mongkolsiriwattana

12.2  Description of criniviruses’ characteristics in general

FIG. 12.1  Genomic organization of criniviruses sequenced to date. RNA1 and RNA2 are presented for each virus. The RNA3 of Potato yellow vein virus (PYVV) (highlighted in the frame) is also included. The P22 protein from Sweet potato chlorotic stunt virus (SPCSV) is present on some, but not all SPCSV isolates (Cuellar et al., 2008). Nucleotide scales are shown at the bottom of the figure.

253

254

12.  Criniviruses infecting vegetable crops

et al., 2016). During this process, cytoplasmic vesiculated membranous structures are formed that are believed to function as sites of RNA replication (Kiss et al., 2013; Lesemann, 1988). Sequence analysis of several criniviruses indicated the presence of low intraspecies genetic variability (Karasev, 2000; Aguilar et al., 2003; Rubio et al., 2013; Orfanidou et al., 2017a). This contrasts with other members of the family Closteroviridae that mainly infect woody perennial plants and exhibit higher genetic diversity (Rubio et al., 2013). This low divergence could be attributed at least in part to the highly specific interactions of criniviruses with their whitefly vectors (Rubio et  al., 2013). Phylogenetically, criniviruses are classified in three groups based on the analysis of 1a/1b polyprotein sequences (Tzanetakis et al., 2013 and Fig. 12.2), or conserved regions of the RdRp, HSP70h or CP (Wintermantel et al., 2009a; Abrahamian and Abou-Jawdah, 2014). Interestingly, members of each group generally have similar vectors

LCV

100 100

CCYV

99

BnYDV

100

CYSDV

95

Group 2

TVCV SPCSV 100

ToCV PYVV BPYV

87

65

Group 1

BYVaV 92

DVCV 100

SPaV LIYV

100

TICV

Group 3

0.20

FIG. 12.2  Maximum likelihood phylogenetic analysis of criniviruses based on the 1a/1b polyprotein sequences from RNA1. Accession numbers of the sequences obtained from NCBI for each virus are as follows: Beet pseudo-­ yellows virus (BPYV) (LC100131), Bean yellow disorder virus (BnYDV) (NC010560), Blackberry yellow vein virus (BYVaV) (NC006962), Cucurbit chlorotic yellows virus (CCYV) (NC018173), Cucurbit yellow stunting disorder virus (CYSDV) (NC004809), Diodia vein chlorosis virus (DVCV) (GQ225585), Lettuce chlorosis virus (LCV) (NC012909), Lettuce infectious yellows virus (LIYV) (NC003617), Potato yellow vein virus (PYVV) (KR998193), Strawberry pallidosis associated virus (SPaV) (NC005895), Sweet potato chlorotic stunt virus (SPCSV) (KC146842), Tomato infectious chlorosis virus (TICV) (NC013258), Tomato chlorosis virus (ToCV) (KP137100), Tetterwort vein chlorosis virus (TVCV) (KR002686). The bar represents amino acid changes per site.



12.2  Description of criniviruses’ characteristics in general

255

and/or host ranges (Tzanetakis et al., 2013). Members of group 1 are primarily transmitted by Trialeurodes species, whereas the primary vector for members of group 2 is Bemisia tabaci.

12.2.2 Symptomatology Although latency in the host plant is variable, depending on the host plant and the age when the plant becomes infected, symptoms generally develop between 3 and 4 weeks following infection. Criniviruses cause interveinal chlorosis or yellowing of the leaves of infected plants that progresses from older leaves near the base or crown toward the growing point of the plant (Fig. 12.3). Younger leaves near the growing point remain green. The yellowing is sometimes accompanied by necrotic spots, upward leaf curling, and thickening of the leaf, which becomes brittle. Eventually the whole plant may become yellow or chlorotic. As a result the photosynthetic area of the plant is reduced substantially and this leads to yield reduction. The affected plants show reduced vigor and although no symptoms appear in the fruit they are usually fewer and smaller as a result of reduced photosynthetic capacity. In some host plants such as melon, criniviruses can also reduce fruit sugar production (Brix), resulting in poor tasting and therefore unmarketable fruits. Other criniviruses may also cause additional symptoms like Bean yellow disorder virus (BnYDV), which apart from typical leaf yellowing, causes leaf lamina brittleness (Segundo et al., 2004). In some cases, instead of yellowing criniviruses may cause reddening of the leaves. The yellowing symptoms caused by most criniviruses are frequently confused with those caused by nutritional disorders such as magnesium deficiency and pesticide phytotoxicity (Wisler et al., 1998a). Some criniviruses are latent in their host plants especially when they occur in single infections. For example, crinivirus infection of strawberry, blackberry, and sweet potato can remain latent and symptoms only appear when these plants are also co-infected with other viruses due to synergism between the crinivirus and the co-infecting virus (Tzanetakis et al., 2013). Single infections of the strawberry cultivars “Hood” and “Noreaster” by BPYV and Strawberry pallidosis associated virus (SPaV) are asymptomatic (Tzanetakis et  al., 2013). However, when strawberries are co-infected with either of these viruses along with any of several common aphid-transmitted strawberry viruses the plants develop leaf reddening symptoms eventually leading to necrosis, roots become brittle, and plants cease production. Similarly, Sweet potato chlorotic stunt virus (SPCSV) which is asymptomatic in single infections of sweet potato is an important component of the sweet potato virus disease (SPVD) one of

FIG.  12.3  Leaf yellowing induced by A) Tomato infectious chlorosis virus (TICV) in tomato, B) Cucurbit chlorotic yellows virus (CCYV) in melon and C) Cucurbit yellow stunting disorder virus (CYSDV) in watermelon. Photos collection of Plant Pathology Laboratory, School of Agriculture, Aristotle University of Thessaloniki.

256

12.  Criniviruses infecting vegetable crops

the most important sweet potato diseases in sub-Saharan Africa (see Tzanetakis et al., 2013). Sweet potato (Ipomoea batatas L.) plants singly infected by Sweet potato feathery mottle virus (SPFMV, genus Potyvirus) and Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus) show no or only mild symptoms (slight stunting and purpling), respectively. However, plants dually infected with both of these viruses develop severe symptoms in leaves and dwarfing of the plants causing SPVD (Karyeija et al., 2000). In cucumber, co-infection of the criniviruses CCYV and CYSDV and a begomovirus, namely Squash leaf curl virus (SLCV), increase the symptom severity and result in greater yield reductions compared to single or double infections (Abrahamian et al., 2015). Crinivirus concentration in the infected plants can also be affected by the presence of a second virus. For example, in tomato plants dually infected with ToCV and Tomato spotted wilt virus (TSWV), ToCV titer increased substantially (García-Cano et al., 2006). Similarly, a synergistic effect was observed in Nicotiana benthamiana plants co-infected with LIYV and Turnip mosaic virus (TuMV), that resulted in enhanced accumulation of LIYV (Wang et al., 2009a).

12.2.3  Host range Most criniviruses infect host plants in several families, although the number of species, genera and families a virus can infect is known to vary considerably among viruses in the genus. Early studies did not always identify low titer or symptomless host plants. BPYV has one of the broadest known host ranges among criniviruses, infecting plants in at least 12 families, including not only vegetable crops, but also sugar beet, ornamentals, and small fruit crops (Tzanetakis et al., 2013). BPYV was the first crinivirus identified, dating to the 1960s. This fact, and the prevalence of its vector, T. vaporariorum, in both greenhouses and fields in areas with mild climates, has facilitated broad testing of plants and a well-defined host range (Duffus, 1965; Wintermantel, 2004). A few criniviruses have relatively narrow host ranges, although recent studies suggest some of the narrow host range viruses (Wisler et al., 1998a), such as those of Diodia vein chlorosis virus (DVCV) or Abutilon yellows virus (AYV), may be more likely listed as having narrow host ranges because limited studies have been conducted on non-traditional host plants. For example, DVCV is a virus identified as a result of the bright yellow vein symptom it produces on Virginia buttonweed (Diodia virginiana; family Rubiaceae) a weed common in some regions of the United States (Tzanetakis et al., 2011, 2013). Although DVCV has a relatively narrowly defined host range among traditional hosts of vegetable viruses, its host range could be larger among plants of other families or genera that have not been evaluated. Similarly, some poorly characterized viruses, such as AYV, are often deemed to have narrow host ranges only because characterization may be incomplete. A virus with an interesting history with regard to host range is CYSDV. When initially characterized, the virus was believed to have a narrow host range limited to members of the Cucurbitaceae (Célix et al., 1996); however, upon its emergence and establishment in the cucurbit production region in the southwestern United States, it became clear that the virus had a much broader host range than previously believed. A thorough survey of both agriculturally important crops and weeds prevalent within and near production areas, demonstrated infection of species in nine taxonomic families; a host range more typical of other members of the genus (Wintermantel et al., 2009b). Many of these hosts were entirely symptomless, and the



12.2  Description of criniviruses’ characteristics in general

257

only means by which infection was identified was through RT-PCR amplification of nucleic acid extracts. Many of the symptomless hosts tested positive for the virus, and many were actually effective sources for acquisition and transmission of the virus to melon or squash by B. tabaci MEAM1 (Wintermantel et al., 2016). For example, London rocket (Sisymbrium irio), which is highly susceptible to CYSDV and nearly symptomless, was a highly reliable and effective source for transmissions in laboratory tests, resulting in 89% transmission to squash plants, and 5/6 plants collected from within and near melon fields were also positive for the virus. Surprisingly, CYSDV titers in London rocket were the lowest among the seven noncucurbit host plant species evaluated in standardized tests, yet transmission was very efficient (Wintermantel et  al., 2016, 2017). Lettuce (Lactuca sativa) is a potentially important bridge crop, because the beginning and end of the melon production season overlaps with winter lettuce production. Infected lettuce plants exhibit very mild symptoms when infected with CYSDV, and transmission from infected squash plants resulted in 76% of lettuce test plants becoming infected with the virus. CYSDV titers in lettuce were the highest among the non-cucurbit host plants evaluated in standardized tests (Wintermantel et  al., 2016); however, lettuce was not particularly effective as a source for transmission to squash plants with only 33% percent of squash plants becoming infected in controlled experiments. This demonstrated that although lettuce is a major crop during the winter when cucurbits are not grown in the southwestern United States, and can be infected by the virus, it does not appear to be an effective bridging crop to sustain the virus during non-cucurbit seasons. The message this conveys is that both symptomless and symptomatic hosts can be important reservoirs, but one cannot assume that all host plants that accumulate virus well are important for virus epidemiology. Additional factors including physical characteristics of the infected host plant or vector preference may have a greater influence on the importance of a non-crop host as a virus reservoir for transmission to crop hosts (Wintermantel et al., 2017). Tomato criniviruses, such as TICV and ToCV, were also found to infect a large number of weed species that frequently appear in tomato crops (Orfanidou et al., 2014a). The majority of TICV and ToCV infections in weeds were symptomless or associated with mild abnormalities such as interveinal chlorosis of leaves (Kil et al., 2015b; Orfanidou et al., 2014a). The symptomless infection of weeds can be very important for crinivirus epidemiology because many symptomless infections can escape the attention of growers and crop consultants. In the case of ToCV, a widely distributed crinivirus, more than 36 wild plant species from 19 taxonomic families were identified as hosts (Font et al., 2004; Wintermantel and Wisler, 2006; Orfanidou et al., 2014a; Kil et al., 2015b; Boiteux et al., 2018). Experiments in Greece evaluated four weed species common in tomato production areas (Solanum nigrum, Sonchus oleraceus, Amaranthus retroflexus, Chenopodium album) as viral sources of ToCV for whitefly transmission to tomato and vice versa. Results highlighted the differences in transmission efficiency of ToCV from tomato to weeds as well as from weeds to tomato (Orfanidou et  al., 2016). S. nigrum was shown to be the most significant viral source among the weed species tested, followed by S. oleraceus, A. retroflexus, and, lastly, C. album. Nevertheless, none of these was as efficient as a source of ToCV for further transmission as tomato. This variation could be attributed to differences in virus concentration among plant species and/or possible host preference by the whitefly vector (Orfanidou et al., 2016). Similar studies examining ToCV reservoir hosts and virus movement into and within tomato production fields in Brazil also identified the importance of wild solanaceous hosts in the epidemiology of ToCV (Boiteux et al., 2018; Esquivel

258

12.  Criniviruses infecting vegetable crops

Farina et al., 2019).Several wild Solanum sp. common in areas with tomato production were found to be highly susceptible to ToCV infection in both free choice and no choice transmission tests (Esquivel Farina et al., 2019). Studies have shown primary inoculum is largely responsible for most ToCV epidemics in Brazil (Macedo et al., 2018), with limited secondary spread within fields due to heavy use of insecticides in tomato production. The importance of primary spread and the prevalence of weed reservoir hosts in production regions add further complexity to efforts at management. When CCYV was first characterized, its experimental host range revealed that the virus was capable of infecting 19 Cucurbitaceous and 11 non-Cucurbitaceous species (Okuda et al., 2010). Five years later, the virus was detected for the first time in at least 13 weed species (7 annual and 6 perennial), collected from areas surrounding symptomatic surveyed cucurbit crops on Rhodes Island, Greece (Orfanidou et  al., 2017a). Interestingly, the majority of infected weeds (mainly perennial) were collected in November, when cucurbit crops are absent (Orfanidou et al., 2017a). CCYV has been detected in cucurbit crops on Rhodes Island for the past five years, and its identification in weed hosts when cucurbits are not being grown reinforced the hypothesis that it is established in reservoir host plants. These and other studies demonstrate that it is critical to evaluate not only symptomatic plants as potential virus hosts, but rather to evaluate a broad range of potential weed and crop hosts within and adjacent or near crops, regardless of their symptom status, for infection by criniviruses. Both crop host plants and non-crop or weed plants may function as reservoirs that allow these obligately whitefly-transmitted viruses to persist and survive during seasons in which their primary crop hosts are not present. These alternate hosts can serve as sources for primary transmission to new crops, but their relevance as reservoir hosts should be evaluated in order to recognize important non-crop sources of virus. Weed management in and around fields, and timing of planting of new crops with respect to removal of infected crops is critical to long-term management and disease reduction.

12.2.4 Transmission Viruses in the genus Crinivirus are known to be transmitted exclusively by whitefly species in a semipersistent manner. Some viruses are transmitted by only a single species of whitefly, whereas others can be transmitted by more diverse species, including species from different genera usually with varying levels of transmission efficiency (Wintermantel, 2016). All known vectors are in the genera Bemisia and Trialeurodes, and to some degree genetic variation among viruses within the genus can be differentiated based on their primary whitefly vectors. Those transmitted most efficiently by Trialeurodes species form one clade, whereas those transmitted by Bemisia species form another, although there are two exceptions that form their own clade (Fig. 12.2). Bemisia tabaci cryptic species MEAM1 (formerly biotype B), MED (biotype Q) and NW (biotype A), as well as Trialeurodes vaporariorum and T. abutilonea are the primary vectors of criniviruses. Each virus has a unique relationship with its vectors, and in general although some viruses can be transmitted by multiple whiteflies, occasionally in both genera, the efficiency of transmission can vary greatly among the vectors known to transmit the virus (Wintermantel, 2016). B. tabaci has been described as a complex of cryptic species (Boykin et al., 2007; Dinsdale et al., 2010; De Barro et al., 2011) and has become widespread throughout the world. The cryptic



12.2  Description of criniviruses’ characteristics in general

259

species MEAM1 and MED are arguably the most widely distributed and important whitefly vectors of plant viruses globally, and are associated with transmission of over half the known species in the genus, Crinivirus. The greenhouse whitefly, T. vaporariorum, is one of the most important vectors of criniviruses, although it has been studied far less thoroughly than B. tabaci. T. vaporariorum occurs in temperate and subtropical climates and is known as the greenhouse whitefly due to its prevalence in greenhouses. This vector is able to transmit approximately half of the known crinivirus species, particularly those adapted to temperate, or cooler subtropical climates, including TICV, BPYV, SPaV, BYVaV, and DVCV. Trialeurodes abutilonea is an equally important vector, and although less prevalent than B. tabaci and T. vaporariorum, can transmit some viruses with exceptionally high efficiency (Wintermantel and Wisler, 2006; Wintermantel, 2016). Bemisia afer has been shown to transmit SPCSV (Gamarra et  al., 2010), and it is likely additional B. tabaci cryptic species may also transmit criniviruses with varying efficiencies, although to date studies have not examined alternative vectors. As new B. tabaci cryptic species establish in areas where criniviruses are present as is now occurring in Southern Europe, it will be important to evaluate their efficiency and effectiveness as vectors for transmission of these viruses to agricultural and horticultural crops. 12.2.4.1 Virus acquisition and transmission One of the principal features of viruses in the genus Crinivirus is that they exhibit a great deal of similarity in transmission parameters, particularly virus acquisition, transmission and persistence in the whitefly vector. Longer acquisition access periods (AAP) on virus source plants (up to as much as 48 h) usually lead to increasing rates of virus transmission (Wisler and Duffus, 2001). It has been suggested that this pattern may reflect the amount of time necessary for a whitefly, feeding in phloem, to acquire and retain sufficient numbers of virus particles (Wintermantel, 2016). Generally, transmission increases steadily with longer AAPs up to a point. The maximum AAP differs among criniviruses and quite possibly host plants as well, at which point a longer acquisition period does not impact transmission further. Additional acquisition feeding beyond this point fails to enhance transmission efficiency. This may result from saturation of virus binding sites in the insect foregut where the virus is believed to associate with its vector. At one time, variability in the amount of time required for efficient virus acquisition was believed to directly reflect variation in virus titer in the source plant, such that higher transmission efficiency would be correlated with higher virus titers in feeding sources, and lower efficiency with lower titers (Ng et al., 2004; Wintermantel et al., 2008). This was illustrated through in vitro studies in which B. tabaci NW (biotype A), the only known vector of LIYV, was fed on different concentrations of purified LIYV virions. Furthermore, results demonstrated that virion concentrations of 0.1 ng/μL or greater were required for vector whiteflies feeding on virions suspended in a sucrose solution to acquire and transmit the LIYV. Transmission efficiency increased with increasing virion concentration and whitefly numbers (Ng et al., 2004). Indeed, this relationship may hold true in many crinivirus-host plant combinations, particularly those in which whiteflies feed on a preferred feeding host plant, but it is not universal. Studies evaluating potential reservoir hosts of CYSDV demonstrated this is not always the case, and that some host plants with higher virus titers are not always as effective as reservoirs for acquisition and transmission of CYSDV as others with lower titers (Wintermantel et  al., 2016, 2017). A number of factors were suspected of contributing to such differences,

260

12.  Criniviruses infecting vegetable crops

many involving factors that may have influenced the preference of the whitefly vector to feed steadily on a virus infected source and thereby influence virus acquisition efficiency and ultimately transmission. In other words, multiple factors likely influence vector transmission efficiency of a particular crinivirus from different host plants, including but not limited to virus titer in the host plant, as well as host plant preference by the whitefly vector. Differences exist between preferred and non-preferred hosts with regard to whitefly feeding behavior. Whiteflies do not always feed steadily on non-preferred host plants (Lei et al., 2001; Fereres et  al., 2016); therefore, virus acquisition is often less efficient than with preferred host plants. This was shown about a decade ago in studies on two criniviruses in two weed host plants. Studies demonstrated that transmission of two different criniviruses from the preferred whitefly host plant, Physalis wrightii resulted in comparable rates of transmission. ToCV and TICV were both transmitted with over 90% efficiency from P. wrightii plants infected with each virus individually in separate but parallel experiments by the common vector T. vaporariorum (Wintermantel et al., 2008), even though this whitefly is overall only a moderately efficient vector of ToCV (Wintermantel and Wisler, 2006). In parallel studies, transmission from Nicotiana benthamiana, an excellent virus source plant, but a non-preferred host for T. vaporariorum, resulted in only 50 and 69% transmission of TICV and ToCV, respectively, by this whitefly vector (Wintermantel et al., 2008). These differences in transmission efficiency between preferred and non-preferred hosts may in part be explained by earlier studies conducted by Lei et  al. (2001) in which feeding and stylet penetration patterns for T. vaporariorum were found to differ between host plants. Electrical penetration graph (EPG) experiments showed that T. vaporariorum made numerous short probes, followed by longer xylem and shorter phloem phases when feeding on sweet pepper, a non-preferred host (Lei et  al., 2001). Feeding on cucumber, a preferred host, involved longer probing and shorter xylem phases than on pepper, and fewer but longer phloem feeding phases (Lei et al., 2001). Cucumber tissues appeared to provide greater stimulation and less resistance, whereas sweet pepper provided less stimulation and greater resistance. The authors suggested that host plant rejection often occurred in sweet pepper before stylets reached the phloem, but that even probing on sweet pepper phloem was much shorter than with the preferred host, cucumber (Lei et al., 2001). Criniviruses are phloem-limited viruses. Therefore, phloem feeding is the primary phase during which these viruses are transmitted. This was demonstrated in early studies on LCV, in which LCV was transmitted to Malva parviflora plants in 50% of tests when the B. tabaci vector was shown to be feeding on phloem. In contrast, transmission rates were only 9% when whiteflies probed tissue, but did not enter the phloem feeding phase (Johnson et al., 2002). Similarly, studies by Maluta et  al. (2017) demonstrated a significant increase in the rate of ToCV transmission when whiteflies feed on phloem sieve elements. The degree to which this would occur may vary by host plant type and may exert a substantial influence on efficiency of crinivirus transmission (Maluta et al., 2017). Whitefly attraction to host plants, as well as stimulation and feeding patterns have been shown to vary depending on whether a host plant is infected with a crinivirus or not. Fereres et al. (2016) demonstrated that whiteflies were visually most attracted to virus-infected rather than mock-inoculated leaves, but also found surprisingly, that volatiles produced by ToCVinfected plants deterred feeding by non-viruliferous whiteflies, which would likely reduce secondary spread within fields (Fereres et al., 2016). Furthermore, the whitefly itself responds



12.2  Description of criniviruses’ characteristics in general

261

to the presence of a crinivirus in infected host plants through activation of different physiological and biochemical pathways as shown by differences in gene expression between whiteflies feeding on ToCV infected and healthy tomato plants (Kaur et al., 2017). Similar results have been shown for whiteflies feeding on healthy and CYSDV-infected melon as well (Kaur and Wintermantel, unpublished). 12.2.4.2 Virus retention in the vector Following acquisition, criniviruses are retained for periods ranging from several hours (Wisler and Duffus, 2001) to as long as 12 days (Li et al., 2016; Martin et al., 2011), depending on virus and vector. Transmission efficiency decreases over time following removal from the acquisition host plant. Evaluation of virus persistence, the period during which the virus is retained by the vector in transmissible form, must be determined independently for each virus and each vector. For example, ToCV, which has five distinct known whitefly vectors, persists for only 1 day with the less efficient vectors, T. vaporariorum and B. tabaci NW (biotype A), but for three days in B. tabaci MEAM1 (biotype B) and for five days in T. abutilonea (Wintermantel and Wisler, 2006; Orfanidou et al., 2016; Shi et al., 2018). Transmission decreases gradually over the period of virus retention (Wintermantel and Wisler, 2006; Orfanidou et al., 2016; Shi et al., 2018), with viruses persisting longer in the vector generally transmitted with greater efficiency by fewer whiteflies (Wintermantel, 2016). Criniviruses, like other members of the Closteroviridae, have what is known as Keatings polarized’ virions, in which approximately 95% of the viral RNA is packaged by the major coat protein, but the 5′ end of the virion is packaged by a combination of the CPm (Peremyslov et  al., 2004a; Satyanarayana et  al., 2004) and at least two other virus encoded proteins the HSP70h and P59 (Agranovsky et al., 1995; Febres et al., 1996; Peremyslov et al., 2004b). The structure encapsidating the 5′ end of the viral RNA is commonly referred to as the “rattlesnake tail” due to the physical arrangement of structural proteins at the tip of the virion much like the tail of a rattlesnake. Numerous studies have now shown that the CPm is responsible for retention of the virus within the anterior foregut of the whitefly. The initial experiments to indicate the involvement of the CPm with vector transmission involved infectivity neutralization studies with LIYV and its vector, B. tabaci NW (biotype A) (Tian et al., 1999). Antisera to each of the four structural proteins, HSP70h, P59, CP and CPm, were used to individually interfere with target sites for vector binding. Only antiserum to the CPm prevented transmission of LIYV by B. tabaci NW (Tian et  al., 1999), suggesting the CPm, and not the other structural proteins was likely responsible for virus association within the whitefly vector. Similar research with the closterovirus, Beet yellows virus (BYV), indicated antibodies to the expressed CPm of the closterovirus, BYV, were partially effective in neutralization of aphid transmission of BYV (He et al., 1998), lending further support to the role of the CPm in binding of viruses in the Closteroviridae to their insect vectors. Additionally, Chen et al. (2011) fed B. tabaci NW (biotype A), an efficient vector of LIYV, and B. tabaci MEAM1 (biotype B), a very poor vector of LIYV (Wisler et al., 1998a), with fluorescent antibodies generated against whole LIYV virions and different capsid components, followed by fluorescent localization in the insect. Results demonstrated binding of the CPm in the anterior foregut and further demonstrated that the CPm was retained at a much higher level than any of the other proteins, supporting its involvement in association with the vector (Chen et al., 2011). Finally, a mutant LIYV isolate

262

12.  Criniviruses infecting vegetable crops

that prevented expression of the full-length CPm (Ng and Falk, 2006) was shown to move systemically through the vascular system of N. benthamiana plants, demonstrating the mutant did not affect viral systemic movement in this host; however, the mutant was unable to be transmitted by whiteflies in controlled experiments even when virus titers in plants were of sufficient levels to obtain normal levels of transmission. Restoration of the wild-type sequence in a separate construct, not only allowed the virus to move systemically, in plants but also to be transmitted by B. tabaci (Stewart et al., 2010).

12.2.5 Detection Disease diagnosis in crinivirus-infected plants is difficult as similar symptoms may be induced by different virus species (e.g. TICV and ToCV in tomato) (Wintermantel and Wisler, 2006) or by abiotic factors (e.g. nutritional disorders). Therefore, it is necessary to apply laboratory techniques for the accurate and reliable determination that symptoms are caused by a crinivirus, and for determining which species is associated with the disease. Criniviruses are phloem restricted and they accumulate at low concentrations within infected host plants (Klaassen et al., 1995; Livieratos et al., 1999; Rubio et al., 1999; Offei et al., 2004; Marco and Aranda, 2005). Therefore, crinivirus virions are difficult to purify in large quantities for production of antibodies. ELISA methods are usually not reliable for the detection of criniviruses; however, antisera have been produced against several criniviruses using viral proteins expressed in bacteria (Hourani and Abou-Jawdah, 2003; Jacquemond et al., 2009; Steel et al., 2010; Kubota et al., 2011). Many of these antisera, both to whole virus and to expressed proteins, have resulted in high background reactions and low sensitivity, suggesting expressed antisera against criniviruses or crinivirus coat protein may be poorly antigenic. For example, the use of antibodies developed against expressed coat proteins of TICV and ToCV yielded some false-negative results, particularly for ToCV (approximately 5% of the samples) (Jacquemond et  al., 2009). For reliable detection of both viruses the authors proposed DAS-ELISA for an initial evaluation and RT-PCR for questionable samples. Antibodies prepared against recombinant coat proteins of CYSDV and CCYV were used successfully for detection of these viruses by using several immunoassays such as immunoelectron microscopy, tissue blot (TBIA) and ELISA (Steel et al., 2010; Kubota et al., 2011). Interestingly, Steel et  al. (2010) expressed the recombinant CP of CYSDV in N. benthamiana plants using agroinfiltration with Agrobacterium tumefaciens. Hourani and Abou-Jawdah (2003) used TBIA with antibodies raised against the recombinant CP of CYSDV for tracking virus localization in the phloem tissue and suggested the method for large scale surveys. Polyclonal antibodies produced against Lettuce chlorosis virus (LCV) reliably detected the virus in indirect ELISA tests in plant hosts such as N. benthamiana and Malva parviflora, but this was not the case in lettuce dually infected with LCV and LIYV (McLain et al., 1998). In general, antisera against criniviruses should be used with caution. Preliminary studies with appropriate controls are necessary with each antiserum to determine its usefulness for a given task. Although many have been produced, few have consistently performed well for routine detection, and even fewer for reliable determination of virus titer. Molecular techniques are currently widely used for the reliable detection of criniviruses. Both broad spectrum and species-specific reverse transcription polymerase chain reaction (RT-PCR) assays have been developed for the generic and specific detection of criniviruses (Tables 12.1 and 12.2). A generic RT-PCR was developed for the detection of known and new

TABLE 12.1  Primers used for the species-specific or genome-wide amplification of criniviruses. Virus/accession number

Primer name

Segment

Position

Coding region

Sequence 5′➔3′

Amplicon size (nt)

BnYDV (EU191905)

F

RNA2

2036–2058

HSP70h

TTATGTATGATCTAGGCGGAGGTC

465

Segundo et al. (2004)

251

Boubourakas et al. (2006)

452

Hammond et al. (2005)

334

Tzanetakis et al. (2003)

364

Boubourakas et al. (2006)

394

Wang et al. (2009a,b)

753

Rubio et al. (2001)

709

Orfanidou et al. (2014b)

804

Gu et al. (2011)

462

Zeng et al. (2011)

303

Ng et al. (2004)

R BPYV (LC100132)

BPYV I

2477–2500 RNA2

BPYV II CYHSPF

RNA2

CYSDV1

RNA2

RNA2

RNA2

CC-RdRp-up

RNA2

RNA1

RNA2

P26-F P26-r2

5206–5226

4927–4949

6141–6165

4874–4895

RNA2

1257–1278

CP

6235–6255 6516–6537

TTTGGAAAAGAACCTGACGAG TTCATCAACAGATTGGCTGC

CP

ATGGCGAGTTCGAGTGAGAATAA ATTACCACAGCCACCTGGTGCTA

RdRp

CCTAATATTGGAGCTTATGAGTACA CATACACTTTAAACACAACCCC

CP

CGCAATCAATAAGGCGGCGACC ACTACAACCTCCCGGTGCCAACT

HSP70h

1699–1718 RNA2

ATG GAC ATG CCT AAC TGT TAC TT ATA GCT GCT GCA GAT GGT TC

5665–568

CCYV-HSP-R1 LIYV (NC_003618.1)

HSP70h

6873–6894

Cp R-5′CCYV-HSP-F1

1408–1427

TTCATATTAAGGATGCGCAGA TGAAAGATGTCCRCTAATGATA

5657–5679

CC-RdRp-do Cp F-5′

CPm

5581–5600

CYSCPr CCYV (ΚΥ400637RNA1, KY400634 RNA2)

5240–5260

GAGCGCCGCACAAGTCATC TACCGCCACCAAAGTCATACATTA

1750–1769

CysCP5600R CYSCPf

HSP70h

5552–5573

CYSDV2 CysCP5206F

845–863

TCG AAA GTC CAA CAA GAC G CTG ATG GTG CGC GAG TG

1273–1296

BP CPm R CYSDV (FJ492808)

HSP70h

1906–1920

CYHSPR BP CPm F

1671–1689

CTGGGTCAATGATACAAGTTAGTC

Reference

TGCGTATGTCAATGGTGTTATG ATCCTTCGCAGTGAAAAACC

P26

GACCACAGCTTTGACGACGGT ACTATCAGTTATCGACACAACT

Continued

TABLE 12.1  Primers used for the species-specific or genome-wide amplification of criniviruses—cont’d Virus/accession number

Primer name

Segment

Position

Coding region

Sequence 5′➔3′

Amplicon size (nt)

LCV (KY271956)

LCV R2a

RNA2

2086–2107

HSP70h

CATGAGGAACGAATCGTAGTGA

548

Ng and Chen (2011)

257

López et al. (2006)

758

Offei et al. (2004)

679

Offei et al. (2004)

774

Qiao et al. (2011)

486

Kashif et al. (2012)

223

Dovas et al. (2002)

501

Vaira et al. (2002)

463

Dovas et al. (2002)

436

Trenado et al. (2007a)

848

Zhao et al. (2013)

775

Wintermantel and Hladky (2010)

LCV F1a PYVV (KR998194)

PYVV-414-F

1560–1581 RNA2

PYVV-670-R PYVVCPF

RNA2

SPSP1

RNA2

RNA2

TIC-3

RNA2

RNA2

ToC-5

RNA2

RNA2

RNA2

CriniRdRp251F CriniRdRp 995R

HSP70h

726–752

757–776

748–774

4633–4652

RNA2

4301–4327

HSP70h

GGGTTAGAGTTCGGTACTACTTTCAGT CGTCGAAAGATTTCTCATCGACT

HSP70h

TCAGTGCGTACGTTAATGGG CACAGTATACAGCAGCGGCA

HSP70h

GGTTTGGATTTTGGTACTACATTCAGT AAACTGCCTGCATGAAAAGTCTC

CP

GTGAGACCCCGATGACAGAT TACAGTTCCTTGCCCTCGTT

CP

5124–5148 RNA1

ATCGGCGTATGTTGGTGGTA GCAGCAGAAGGCTCGTTTAT

5049–5068

CP-R Crinivirus-generic

926–945

ATGRMTACTGRCAAAGTAAACGATG TCAACAGTGAAGACCRGYACCRGTCAA

1191–1213

MA381(−) CP-F

CP

1238–1257

ToC-6 MA380(+)

4462–4486

CTGATGTGCGCACGAAAG CTTTATGTTAGTTCTATA

932–954

TICV-532(−) ToCV (JQ952601)

HSP70h

1392–1411

TIC-4 TICV-32(+)

1914–1931

ATGGAAATCCGATCGTGGAACCT CTACTCAATAGATCCTGCTA

5209–5235

CL43L TICV (FJ815441)

CP

2575–2592

SPSP4 CL43U

4284–4306

GAC CGC CGA CTT GTT GAA TT TTG CTG CAT TCT TGA ACA GGT AA

5022–5041

PYVVHSPFR SPCSV (KC146843)

CP

4954–4976

PYVVCPR PYVVHSPF

4720–4739

CTTTCTCGACTATTAGTGCATA

Reference

GAATCTTTTAGAAGCTTTGGTTTAAGG GATCCTCTTGATCCTCATAGATTTC

RdRp

TNGGNAARGGNGARAG GTRTTNGAYAACCAHGTRTTHG

TABLE 12.2  Primers and probes used for real-time RT-PCR detection of criniviruses. Virus/accession number

Primer name

Sequence (5′-3′)

Coding region

Position

Amplicon size (bp)

ToCV (EU284744)

ToCV F

TCTCGAACCTGCTTATGAAAAGAAA

CP

5009–5033

80

ToCV R

ATGCAAGTTGGTTAACGTTGTACAGT

5089–5064

Papayiannis et al. (2011)

ToCV TAQ (FAM labeled)

TTTGTGCAAGGGTAACGAGGGCAAGG

5037–5062

ToCV-258F

GTCTGTTCCGGCTGATTACAAGT

74

ToCV-331R

AATTGAAACCCAAAGAGGAACAAA

1234–1211

Morris et al. (2006)

ToCV-Taq (FAM labeled)

TGGGCAGAGACTTTTCATGCAGGCA

1184–1208 771

Shi et al. (2018)

89

Papayiannis et al. (2011)

122

Abrahamian et al. (2013)

152

Li et al. (2016)

87

Abrahamian et al. (2013)

88

Gil-Salas et al. (2007)

ToCV-2F

a

ATGGAGAACAGTGCCGTTGC

a

TTAGCAACCAGTTATCGATGC

ToCV-2R TICV (FJ815441)

CCYV (AB523789)

CP

1161–1183

4333–4352 5105–5085

TICV F

AAAGCGGGACATTTTTTATCATATG

TICV R

TGTTTCCAGACTAGATCGCATGAAT

4836–4813

TICV TAQ (TEX labeled)

CGTCAGGTCACCCAAACGCTCTAAGG

4784–4809

CcHSP-F1

GTTTAGCCATAACCATTACGGGA

CcHSP-R

GATTTTATCTACACCAACCCATCTC

1440–1416

CcHSP-Taq (FAM labeled)

AGTTAGCCACCTCGTCTTCCTCAA

1373–1396

CCYV-Fa

GCGACCATCATCTACAGGCA

CCYV-R CYSDV (FJ492808)

HSP70h

a

CP

HSP70h

CP

CCGACTTGTTCCTTTCAGAGC

4747–4771

1319–1341

5488–5507 5637–5619

CyHSP-F1

CCTACCTGTTTAGCCATAACGTC

HSP70h

CyHSP-R

ACAGTTAGGCATGTCACTATTAGAC

1422–1398

CyHSP-Taq (YAK labeled)

AGCGGGACCTCCAACAACCACATCA

1365–1389

CYSDV-For

GCTTAATGTGGGAGAAGTTCTCCTA

CYSDV-Rev

TCTGGATATAACCTTCAGACACTCCTT

956–930

CYSDV-Lid (VIC labeled)

CTCCGTGCGCTCGTTAGGTACCGG

822–905

5’-UTR

1336–1358

843–867

Reference

Continued

TABLE 12.2  Primers and probes used for real-time RT-PCR detection of criniviruses.—cont’d Virus/accession number

Primer name

Sequence (5′-3′)

Coding region

Position

Amplicon size (bp)

CYSDV (EF547827)

CYSDV F

CTGATGATGGGAAGGTTAGAGTGG

RdRp

7243–7266

81

CYSDV R

AATCTGACCTTCGGATCGGG

7304–7323

Papayiannis et al. (2010)

CYSDV TAQ (FAM labeled)

AGATGCACAGAGGATGTTCGAGAAGTTGTCC

7271–7301

LIYV_RNA1_F

TGTTCGCCCAGGTTAGATTTG

84

LIYV_RNA1_R

TTCACCATATCCTTTCAGCCC

1822–1802

Qiao and Falk (2018)

LIYV RNA1_Probe

AGACACATCCAAAGGGCCACAGT

1772–1794

F

CGAATCAACGGATCGGAATT

71

R

CCACCGACTATTACATCACCACTCT

1031–1007

Kokkinos and Clark (2006)

TaqMan (FAM labeled)

ATCCCAACGTGTTTATCTA

982–1000

PYVV-591-F

CGGAGATTATGTCAATGGTTCGA

79

PYVV-670-R

TTGCTGCATTCTTGAACAGGTAA

4976–4954

López et al. (2006)

PYVV-T (FAM labeled)

AACCAACATTTCTGATGATGATTTGACTGCAA

4921–4952

LIYV (U15440)

SPCSV (KU511274)

PYVV (KR998194)

a

Primers used in SYBR-Green assays.

RdRp

HSP70h

CP

1739–1759

962–980

4897–4919

Reference



12.2  Description of criniviruses’ characteristics in general

267

criniviruses using a universal degenerate primer set targeting the RdRp (Wintermantel and Hladky, 2010). In the same publication (2010) Wintermantel and Hladky also developed multiplex RT-PCR assays targeting the RdRp for the simultaneous detection and discrimination of viruses infecting the same host group. Four host groups (cucurbits, leafy greens, Solanaceae, small fruits) were selected based on the types of crops in which certain criniviruses are known to occur. Degenerate reverse primers were used in RT and PCR to amplify all members of each host group, and were coupled with species-specific forward primers. Moreover, several species-specific RT-PCRs were developed for most of the known criniviruses (Table 12.1). Most of these are quite reliable given the low intraspecies diversity of criniviruses. The most frequent target of primer pairs for crinivirus detection has been the highly conserved HSP70h gene encoded on RNA2. The RdRp gene encoded by RNA1 is similarly well-conserved among crinivirus species and is also frequently used for virus detection, as are the more virus-specific CP and CPm genes (Table 12.1). Of high value are the multiplex RT-PCR assays that permit the simultaneous detection of several viruses infecting the same host such as the multiplex nested RT-PCR developed by Dovas et al. (2002) for the detection of TICV and ToCV in tomato. Real time RT-PCR assays have become widely used recently for quick, reliable and sensitive virus detection, as well as for quantification of plant viruses in their hosts and arthropod vectors. Such methods were successfully developed for criniviruses and have been applied both for diagnostic purposes and for plant-virus-vector interaction studies (Papayiannis et al., 2011; Abrahamian et al., 2013; Li et al., 2016). RT-qPCR assays have been developed for TICV, ToCV, CCYV, CYSDV, LIYV, SPCSV and PYVV (Papayiannis et al., 2010, 2011; López et al., 2006; Gil-Salas et al., 2007; Abrahamian et al., 2013; Li et al., 2016; Morris et al., 2006; Kokkinos and Clark, 2006; Shi et al., 2018; Qiao and Falk, 2018) (Table 12.2). Most of the methods use probes, mainly TaqMan® probes, for virus detection but in two cases a SYBR green approach was used (Li et al., 2016; Shi et al., 2018) (Table 12.2). As with traditional RT-PCR detection methods, the most frequent gene targets for RT-qPCR were the RdRp, HSP70h and CP. Two real-time RT-PCR detection schemes were optimized for the multiplex detection of TICV and ToCV, and for CCYV and CYSDV respectively, thus successfully detecting and discriminating these crinivirus species from one another in tomato and cucurbit plants, respectively, as well as in their whitefly vectors (Papayiannis et al., 2011; Abrahamian et al., 2013). These methods exhibited much higher sensitivity compared to conventional RT-PCR assays (Papayiannis et al., 2011; Abrahamian et al., 2013). More recently, reverse transcription loop-mediated isothermal amplification (RT-LAMP) methods were developed for sensitive and rapid detection of CCYV and ToCV in their host plants or in whitefly vectors (Wang et al., 2014; Kil et al., 2015a; Zhao et al., 2015; Okuda et al., 2015). The RT-LAMP assays are often more sensitive than the conventional RT-PCR (Wang et al., 2014; Zhao et al., 2015), and offer the potential for rapid and efficient molecular based detection of criniviruses as such assays become more widely available.

12.2.6 Control Control of criniviruses in mainly focused on the management of their whitefly vectors (Tzanetakis et al., 2013) through control of non-crop host plants, or timing of planting and harvesting to prevent movement of viruliferous vectors between crops. The use of resistant

268

12.  Criniviruses infecting vegetable crops

varieties/hybrids (directly to the virus or indirectly to the whitefly-vector) is increasing as sources of resistance are identified and introgressed to commercial cultivars. As is the case with other viruses, crinivirus control is most effective through integrated pest management (IPM). 12.2.6.1 Traditional screening of germplasm for resistance Use of resistant genotypes is the most effective and environmentally friendly way of combating viral diseases (Tzanetakis et al., 2013) when resistance is available. Criniviruses, with the exception of BPYV (Duffus, 1965), are generally considered newly emerging viruses because most were identified within the past 20 years (Tzanetakis et al., 2013). Research on host resistance has not been conducted extensively for most crop hosts impacted by crinivirus infection, and in many cases studies have involved a limited number of host plants. When resistance has been identified, it is usually in wild accessions and therefore, further work is required to incorporate such sources into commercially acceptable cultivars/hybrids. To date, host plant resistance against criniviruses is only available for a limited number of host plants. BPYV. Tolerance to BPYV has been identified to Asian melon (Esteva and Nuez, 1992). However, to date no cultivars/hybrids are currently available in the market. CCYV. Although CCYV has only been reported recently (Gyoutoku et al., 2009), Okuda et al. (2013) evaluated 51 melon accessions and showed that at least one accession appears to be particularly promising because it possesses resistance to CCYV (Okuda et al., 2013), and this may be associated with inhibition of virus replication. A recent study demonstrated that this resistance is recessive and a major locus for the resistance is located on chromosome 1 (Kawazu et al., 2018). CYSDV. A number of sources of resistance have been identified against CYSDV in melon. The melon line, TGR-1551, originally collected in Zimbabwe, was initially identified as a dominant resistance allele carried at a single locus (Lopez-Sese and Gomez-Guillamon, 2000; Marco et al., 2003). More recent studies have clarified and confirmed the resistance in TGR-1551 as a recessive or quantitative resistance (Sinclair, 2003; McCreight et al., 2017), controlled by two loci on melon linkage group V (Palomares-Rius et al., 2018). A second source of resistance to CYSDV was identified in the Indian melon line PI 313970, and this resistance was also determined to be recessively inherited (McCreight and Wintermantel, 2011). Neither PI 313970 nor TGR-1551 provides immunity. Another source of recessively inherited resistance to CYSDV in melon was found in TGR-1937 but this source may be allelic to the resistance in TGR-1551 or PI 313970 (Wintermantel et al., 2017). Several additional sources of possible resistance to CYSDV in melon are being evaluated with the hope of identifying sources with both resistance to CYSDV and improved fruit quality (McCreight et al., 2016). A canary type melon was also recently reported to be resistant to CYSDV (Palomares-Rius et al., 2018), and tolerance to CYSDV has also been reported to occur in cucumber (Eid et al., 2006; Aguilar et al., 2006). LIYV. A source of resistance to LIYV was identified in PI 313970, and is controlled by a dominant allele at a single locus, designated Lettuce infectious yellows (Liy) (McCreight, 2000). PYVV. No resistance to this virus has been identified to date in potato. ToCV/TICV. There are no commercial hybrids showing resistance to either ToCV or TICV. However, different wild tomato genotypes were screened for resistance to ToCV, and the results showed that two sources of resistance were identified in genotypes showing reduced virus titer and symptom expression (García-Cano et  al., 2010). Further research is needed



12.2  Description of criniviruses’ characteristics in general

269

to introgress these resistance sources into the domesticated tomato (Solanum lycopersicum). Α group of Brazilian researchers screened 56 tomato genotypes for resistance to ToCV and they only found one genotype highly resistant to the virus (Mansilla-Cordova et al., 2018). Additionally, a germplasm screening of 33 Solanum accessions two accessions from Solanum habrochaites PI 127827 and two from S. peruvianum and S. pennelli, showed tolerance to ToCV (Gonzalez-Arcos et al., 2018). These sources of resistance may ultimately be useful for control of ToCV if incorporated into tomato breeding programs. 12.2.6.2 Transgenic resistance Transgenic Nicotiana benthamiana plants harboring a hairpin construct of RdRp sequence exhibited immunity to LIYV and this was due to the accumulation of 24 nucleotide trangenederived siRNAs (Qiao et al., 2018). Similarly, they also developed melon (Cucumis melo) plants with apparent immunity to CYSDV. 12.2.6.3  Resistance to the whitefly vectors Resistance to whitefly vectors has been more durable than resistance against viruses as virus populations tend to drift toward resistant-breaking genotypes over time when exposed to virus resistant host plants (see review by Lecoq et al., 2004). However, to date application of resistance to whiteflies has only seen limited application. Several Citrullus introductions have been identified that offer resistance to B. tabaci MEAM1 (biotype B) (Simmons and Levi, 2002a,b). Additionally, resistance traits derived from the wild tomato Solanum pimpinellifolium to the whitefly B. tabaci affects the preference and feeding behavior of B. tabaci, and was shown to reduce spread of Tomato yellow leaf curl virus, a circulative begomovirus (RodríguezLópez et al., 2011). This type of resistance is mediated by the production of acylsucrose which deterred landing and settling of B. tabaci. A limited field study was conducted to determine the efficacy of using tomato lines that overexpressed type IV glandular trichomes that exude acylsugars to reduce infection by TICV in an area of coastal southern California with high levels of annual TICV infection of tomato. Tomato breeding lines and wild Solanum accessions that expressed acylsugars developed interveinal yellowing symptoms and detectable levels of TICV on average one month later than tomato lines that did not express acylsugars (Mutschler and Wintermantel, 2006). Although such an approach will not prevent infection by criniviruses, significantly delayed virus accumulation through vector deterrence approaches offer the potential to enhance virus control when combined with other IPM strategies. 12.2.6.4 Virus-free propagative material In recent years there has been a transition in most countries from farmers who produce their own seedlings (or propagative material) to farmers purchasing seedlings from nursery companies. This has generally improved the health quality of seedlings. Additionally, use of certified PYVV-free seed potato is considered to be an effective method to control PYVV because the abundance of this virus has been attributed to the commercialization of low quality infected propagules (Cuadros et al., 2017). 12.2.6.5  Application of chemicals that induce resistance It is very well established that no agrochemicals like fungicides and insecticides are available that can be applied to combat viral diseases under field conditions. Therefore, different

270

12.  Criniviruses infecting vegetable crops

chemicals that act as resistance inducers have been studied for many years to reduce virus spread (see the review Palukaitis et  al., 2017). These inducers can include either naturally occurring (e.g. salicylic acid, SA) or synthetic (e.g. acibenzolar-S-methyl, ASM) chemicals or beneficial microorganisms (see review Palukaitis et al., 2017). Chemical inducers of resistance stimulate endogenous resistance mechanisms against a broad spectrum of pathogens including fungi, bacteria and viruses. Therefore, when ASM was applied in tobacco it induced resistance to Tomato spotted wilt virus (TSWV) by increased expression of pathogenesis-related genes (Mandal et al., 2008). Additionally, ASM induced chitinase in cantaloupe seedlings and protected them against fungal (Colletotrichum lagenarium) and viral (Cucumber mosaic virus, CMV) infection (Smith-Becker et al., 2003). Similarly, melon plants infected with CCYV and treated with ASM exhibited increased expression of pathogenesis-related 1a gene (Takeshita et al., 2013). When ASM was applied before virus inoculation, systemic symptoms were suppressed and virus concentration was decreased whereas application of ASM after inoculation reduced disease severity and virus accumulation (Takeshita et al., 2013). Application of resistance inducers may also be useful to limit the incidence of other criniviruses especially when this method will be combined with other approaches (e.g. chemical control of insect vectors) (Pappu et al., 2000) as was the case with TSWV. 12.2.6.6  Chemical control of whitefly vectors Although chemical control of whitefly vectors has been extensively used to reduce vector populations and associated virus transmission (Tzanetakis et al., 2013), this strategy has not always been effective because most criniviruses are actually acquired and transmitted by whiteflies in a rather short period of time (Wisler and Duffus, 2001). Furthermore, resistance of whiteflies to insecticides has been well documented in many countries (Roditakis et al., 2009). Exceptions exist, however, as foliar and soil applied analog insecticides resulted in lower CYSDV transmission both in greenhouse and field experiments (Castle et al., 2017a,b), and foliar applications have been shown to be more effective. In another study, although two systemic insecticides reduced CYSDV incidence in melon crops under field conditions, two others exacerbated its incidence (Castle et al., 2017b). Although the basis for these differences remains under investigation it was suggested that some of the insecticides were not as effective as others against the whitefly vector. 12.2.6.7  Biological and alternative control of whitefly vectors Biological control of whiteflies has been extensively applied in many countries in order to reduce direct crop losses. However, data concerning the effect of this method of whitefly control to reduce the spread of the viruses they transmit are rather limited. Combining host resistance to the whitefly B. tabaci and reflective mulching has additively reduced the populations of B. tabaci in bitter cucumber (Citrullus colocynthis) plantations (Simmons et al., 2010). This might offer an alternative strategy for the management of whiteflies and the criniviruses they transmit. Although coverage of the crop with insect-proof nets and fine mesh screenhouses can be very effective in reducing whitefly populations reaching the plants, they also reduce ventilation and therefore may increase the presence of other pathogens such as fungi and bacteria. In the case of indoor crops fine insect mesh in windows and double doors and negative pressure systems associated with entry and exit should reduce vector ingress and associated virus transmission.



271

12.3  Analytic description of each virus according to their major host

12.2.6.8  Elimination of virus sources and whitefly hosts both in cultivated and weed species Effective management of virus reservoir hosts and whitefly hosts can also contribute to virus elimination especially when this is combined with other methods. Cultivated plants themselves contribute to virus presence and also act as whitefly hosts under field conditions. Therefore, eradication of virus-infected plants, especially at the first stages when disease incidence is low, may also reduce the rate of the spread within the crop. Similarly, timing of planting to reduce spread from adjacent infected crops to new susceptible crops will limit spread from infected reservoir sources. Arable weeds and some ornamental species also play an important role in Crinivirus epidemiology as virus reservoir hosts of criniviruses between the growing seasons because these viruses are not seed-borne (Wintermantel et  al., 2009b; Tzanetakis et al., 2013; Orfanidou et al., 2016).

12.3  Analytic description of each virus according to their major host An analytic description of vegetable-infecting criniviruses (Tables 12.3 and 12.4) is provided below.

12.3.1  Viruses of tomato 12.3.1.1 Tomato infectious chlorosis virus (TICV) TICV was discovered in 1993 in tomato crops from the Irvine area of Orange County, California (Duffus et al., 1996a). The virus induced interveinal yellowing and subsequent necrosis of the leaves, leading to severe yield losses. Since then, TICV emerged as a new threat for tomato crops in several regions of the world from North America (Duffus et al., 1996a; ­Méndez-Lozano

TABLE 12.3  List of criniviruses infecting vegetable crops. Tomato

Pepper

Cucurbits

Bean

Potato

ToCV

+

+

+

+

+

TICV

+ +

CCYV

+

BPYV

+

+

+

+

+ +

+ +

SPCSV BnYDV a

+

a

LIYV

Lettuce

+

CYSDV

LCV

Sweet potato

+

A recombinant strain of LCV (LCV-SP) infects legumes and not lettuce (Ruiz et al., 2018).

272

12.  Criniviruses infecting vegetable crops

TABLE 12.4  Whitefly vectors and transmission characteristics of criniviruses infecting vegetable crops.

Virus

Vector

Host

Minimum Transmission acquisition efficiency (%)a time

BnYDV

B. tabaci MED

P. vulgaris

35.0

3 h

14

Martin et al. (2011)

SPCSV

B. tabaci MEAM1

Ipomoea nil

15.2

Nd

2

Sim et al. (2000), Gamarra et al. (2010)

T. abutiloneus

Ipomoea nil

3.2

Nd

Nd

Sim et al. (2010)

B. afer sensu lato Ipomoea nil

13.0

Nd

Nd

Gamarra et al. (2010)

LIYV

B. tabaci New World

Lactuca sativa

22.0

10 min

3

Duffus et al. (1986)

LCV

B. tabaci New World

Malva parviflora

2.9

1 h

4

Duffus et al. (1996b)

B. tabaci MEAM1

Malva parviflora

0.0

Nd

Nd

Duffus et al. (1996b)

CYSDV

B. tabaci

Cucumis melo

3.0

2 h

9

Célix et al. (1996)

ToCV

B. tabaci MEAM1

Physalis wrightii

18.0

Nd

3

Wintermantel and Wisler (2006)

T. abutilonea

Physalis wrightii

8.0

Nd

5

Wintermantel and Wisler (2006)

T. vaporariorum

Physalis wrightii

0.0

Nd

1

Wintermantel and Wisler (2006)

B. tabaci New World

Physalis wrightii

0.0

Nd

1

Wintermantel and Wisler (2006)

B. tabaci MEAM1

Solanum lycopersicum

Nd

Nd

2

Shi et al. (2018)

B. tabaci MED

Solanum lycopersicum

Nd

Nd

5

Orfanidou et al. (2016), Shi et al. (2018)

TICV

T. vaporariorum

Physalis wrightii

8.0

1 h

4

Duffus et al. (1996a)

CCYV

B. tabaci MEAM1

Cucumis sativus

Nd

90 min

6

Shakeel et al. (2018)

B. tabaci MED

Cucumis sativus

Nd

Nd

4

Li et al. (2016), Orfanidou et al. (2017a)

BPYV

T. vaporariorum

Capsella bursa-pastoris

10.4

1 h

7

Duffus (1965)

PYVV

T. vaporariorum

Nd

Nd

Nd

Not studied yet

a

Tested using single insects. Nd, not determined.

Persistence (days)

Reference



12.3  Analytic description of each virus according to their major host

273

et al., 2012), Europe (Dovas et al., 2002; Accotto et al., 2001; Dalmon et al., 2005; Font et al., 2002), Middle East and Asia (Verhoeven et al., 2003; Tsai et al., 2004; Hartono et al., 2003; Anfoka and Abhary, 2007). In addition to tomato, the following cultivated plants have been recorded as natural hosts of TICV: Lactuca sativa (lettuce), Physalis ixocarpa (tomatillo), Cynara scolymus (artichoke), Petunia hybrida (petunia), Ranunculus sp., Zinnia elegans, Callistephus chinensis (China aster) (Wisler et al., 1998a; Caciagli, 2001; Tsai et al., 2004). Additionally, at least 26 weed species belonging to 15 taxonomic families have been reported to be infected by TICV (Tsai et al., 2004; Orfanidou et al., 2014a). TICV is exclusively transmitted in a semi-persistent manner by the whitefly species T. vaporariorum (Wisler et al., 1996). During the past decade, the incidence and distribution of TICV has been reduced (Navas-Castillo et al., 2011). This may be attributed to the fact that another crinivirus, Tomato chlorosis virus (ToCV), also infects tomato crops and has an advantage of being transmitted by both T. vaporariorum and B. tabaci. The latter vector species, which is a more efficient vector of ToCV, is capable of adaptation to widely variable conditions in a wide range of plant hosts and it has efficiently displaced T. vaporariorum in many countries worldwide (Célix et  al., 1996; Berdiales et  al., 1999; Rubio et  al., 1999; Abou-Jawdah et  al., 2000a). Even in countries such as Greece where TICV prevails in the mainland due to the wide distribution of T. vaporariorum (Orfanidou et al., 2014a), the situation seems to have been altered recently as suggested by the progressive spread of ToCV and its B. tabaci vector in the northern regions of Greece (Orfanidou et al., unpublished data). 12.3.1.2 Tomato chlorosis virus (ToCV) The cause of “yellow leaf disorder” was originally identified in north-central Florida (USA) in 1989 and it was attributed to nutritional or physiological disorders, pesticide phytotoxicity and other causes (Simone et al., 1996). Nevertheless, the causal agent of the disease in tomato crops in Florida was found to be a distinct crinivirus species ultimately named ToCV (Wisler et al., 1998b). ToCV induces nearly identical symptoms to those of TICV on tomato and diagnosis/discrimination by symptomatology is impossible. ToCV has been reported in more than 20 countries worldwide (Al-Saleh et al., 2014; Dovas et al., 2002; Navas-Castillo et al., 2011; Wisler et al., 1998b; Zhao et al., 2013) and it can reduce tomato yield by 50–100% (Lozano et al., 2006; Velasco et al., 2008). ToCV can also infect other cultivated crops, such as sweet pepper (Capsicum annuum), ­potato (S. tuberosum), tobacco (Nicotiana tabacum), eggplant (S. melongena) lettuce (Lactuca sativa), pumpkin (Cucurbita moschata) and cowpea (Vigna unguiculata) (Zhou et al., 2015; Lozano et al., 2004; Fortes and Navas-Castillo, 2012; Fiallo-Olivé et al., 2014; Orfanidou et al., 2014a; Sun et al., 2016; Wang et al., 2018). In addition, more than 36 wild plant species from 19 different families (Alvarez-Ruiz et al., 2007; Arruabarrena et al., 2015; Boiteux et al., 2018; Fonseca et al., 2013; Font et al., 2004; Kil et al., 2015b; Orfanidou et al., 2014a; Solórzano-Morales et al., 2011; Trenado et al., 2007a; Tsai et al., 2004) were found to be infected with ToCV, while the virus is able to infect 21 additional plant species (eight families) under experimental conditions (Morris et al., 2006; Wintermantel and Wisler, 2006; Wisler et al., 1998b). ToCV is transmitted by at least five different types of whitefly: T. vaporariorum, T. abutilonea and the cryptic species B. tabaci NW, MEAM1 and MED (formerly known as biotypes A, B and Q, respectively) (Wintermantel and Wisler, 2006; Orfanidou et al., 2016; Shi et al., 2018). Whitefly species differ in their ability to transmit ToCV. Thus, T. abutilonea, B. tabaci MEAM1

274

12.  Criniviruses infecting vegetable crops

and MED are very efficient vectors, whereas B. tabaci NW and T. vaporariorum are inefficient vectors (Wintermantel and Wisler, 2006; Shi et al., 2018). Persistence in the vector also varies among the different vectors; ToCV persists in T. abutilonea up to 5 days, in MED 5 days, in MEAM1 2 days and in B. tabaci NW and T. vaporariorum only 1 day (Table 12.4) (Wintermantel and Wisler, 2006; Orfanidou et al., 2016; Shi et al., 2018).

12.3.2  Viruses of cucurbits 12.3.2.1  Beet pseudo-yellows virus (BPYV) BPYV was the first described crinivirus, characterized in 1965 (Duffus, 1965). It was initially reported infecting sugarbeets in the Salinas Valley in California, but was also found to infect other crops, including spinach, cucumber, flax, lettuce, carrot, ornamentals and both strawberries and blackberries (Duffus, 1965; Tzanetakis et al., 2013). The virus has been reported from the USA, Costa Rica, Europe, Australia and Asia, and Japan mainly causing disease on cucurbit crops (Lot et al., 1983; van Dorst et al., 1983; Duffus and Johnstone, 1981; Boubourakas et al., 2006; Tzanetakis and Martin, 2004; Tomassoli et al., 2003; Hartono et al., 2003; Clover et  al., 2002). BPYV was also reported in strawberry crops in 2002 from near the same area where it was first described in 1965. When either BPYV or the closely related crinivirus, Strawberry pallidosis associated virus (SPaV) are present, strawberries remain symptomless. However, in the presence of any of several aphid-transmitted viruses, either BPYV or SPaV can contribute to strawberry decline, a severe disease leading to loss of fruit production (Tzanetakis et al., 2003). In addition, BPYV was reported as a partner in a similar synergistic disease on blackberry, blackberry yellow vein disease, in the southeastern United States (Tzanetakis and Martin, 2004). BPYV is solely transmitted by T. vaporariorum (Duffus, 1965). Although the virus remains a periodic threat to small fruit production in the western United States, the virus has exhibited a rather limited distribution in Mediterranean regions in recent years, and it has been assumed that it was supplanted by a Bemisia-transmitted crinivirus, CYSDV. In fact, studies from many Mediterranean countries such as Portugal, Spain, Italy, Lebanon and Cyprus suggest that CYSDV has become the most prevalent virus and B. tabaci the most widespread vector, after literally displacing the traditional whitefly species T. vaporariorum necessary for transmission of BPYV (Célix et al., 1996; Berdiales et al., 1999; Rubio et al., 1999; Abou-Jawdah et al., 2000a; Papayiannis et al., 2006). 12.3.2.2  Cucurbit yellow stunting disorder virus (CYSDV) CYSDV was initially reported in the United Arab Emirates in 1982 (Hassan and Duffus, 1991). Since then, the virus has become widely distributed throughout the world, and is now present in the Mediterranean region, Middle East and United States (Abou-Jawdah et  al., 2000b; Célix et al., 1996; Desbiez et al., 2000; Louro et al., 2000; Kao et al., 2000; Boubourakas et  al., 2006; Manglli et  al., 2016; Keshevarz et  al., 2013). Early studies on the host range of CYSDV indicated that the virus was restricted to members of the family Cucurbitaceae (Célix et al., 1996). However, within the last decade several species from different taxonomic ­families were reported as new hosts for the virus; alfalfa (Medicago sativa), lettuce (Lactuca sativa), snap bean (Phaseolus vulgaris) and potato (S. tuberosum) (Wintermantel et  al., 2009b; Orfanidou



12.3  Analytic description of each virus according to their major host

275

et al., 2018). Cucurbit hosts show the highest CYSDV titers and they are consistently efficient sources for virus acquisition. Non-cucurbit hosts show significantly lower titers than cucurbit hosts, and vary in their capacity to serve as sources for virus transmission (Wintermantel et al., 2016). CYSDV is transmitted exclusively by the sweet potato whitefly, B. tabaci, and more specifically by both of the widely prevalent cryptic species, MEAM1 and MED (Célix et al., 1996). Although studies have not thoroughly examined transmission by other cryptic species of B. tabaci (Dinsdale et al., 2010; De Barro et al., 2011), it is likely that other B. tabaci cryptic species may be vectors of this virus (Wintermantel et al., 2017). Weeds play an important role in the epidemiology of CYSDV. To date, at least 15 species from 9 families have been reported as alternative hosts for the virus (Wintermantel et al., 2009b; Webster et al., 2011; Orfanidou et al., 2018). 12.3.2.3  Cucurbit chlorotic yellows virus (CCYV) In 2004, leaf yellowing symptoms were observed on greenhouse-grown melon, cucumber and watermelon plants in Kumamoto Prefecture, Japan, along with high density populations of B. tabaci MED (biotype Q) (Gyoutoku et al., 2009). In order to determine the etiology of the disease, degenerate closterovirus primers were used for RT-PCR amplification of a DNA fragment of the expected size (Dovas and Katis, 2003), followed by sequence analysis. The nucleotide sequence revealed the presence of another crinivirus that shared ~75% nt similarity with CYSDV. The virus was named CCYV and exhibits the same symptomatology with CYSDV and BPYV, making diagnosis a laborious task. CCYV has been reported in Middle East and Asian countries (Al-Saleh et al., 2015; Bananej et al., 2013; Gu et al., 2011; Hamed et al., 2011; Huang et al., 2010; Okuda et al., 2010), as well as in the Mediterranean region (Abrahamian et al., 2012; Amer, 2015; Orfanidou et al., 2014b, 2017b), and recently in the United States (California) (Wintermantel et al., 2019). CCYV has mainly been reported in cucurbit crops such as melon, watermelon, cucumber and zucchini. However, alfalfa plants were found to be naturally infected by CCYV as well (Orfanidou et al., 2017a) and may also be an important reservoir host for this virus. CCYV shares a similar transmission pathway as CYSDV, because it is transmitted by both B. tabaci MEAM1 and MED (Okuda et al., 2010), two of the most widely distributed cryptic species of B. tabaci. Studies on comparative transmission of CCYV by both species revealed that MED is more effective in transmission of the virus than MEAM1, as CCYV had stronger effects on the feeding behavior of MED by increasing duration of phloem salivation and sap ingestion (Lu et al., 2017). Furthermore, it has been demonstrated that weeds play a pivotal role in preservation of the virus especially during periods when the main crop host is absent (Orfanidou et al., 2017a). Thirteen weed species belonging to 11 families have been found to be naturally infected by CCYV (Orfanidou et al., 2017a).

12.3.3  Viruses of lettuce 12.3.3.1  Lettuce infectious yellows virus (LIYV) LIYV was discovered in the southwestern desert agricultural regions of the United States in 1981 (Duffus and Flock, 1982). It was the first crinivirus sequenced, and was the prototype

276

12.  Criniviruses infecting vegetable crops

member of the genus Crinivirus. This virus has a wide host range including beet and chard (Beta vulgaris), lettuces (Lactuca sativa), squashes and pumpkins (Cucurbita pepo, C. maxima, C. moschata), melons (Cucumis melo), watermelon (Citrullus lanatus) and the wild cucurbit, buffalo gourd (Cucurbita foetidissima). Other natural hosts include carrots (Daucus carota) and various weeds, such as Helianthus spp., Ipomoea spp., Lactuca canadensis, Malva parviflora and Physalis heterophylla (Duffus et al., 1986). LIYV is transmitted by B. tabaci NW over 100 times more efficiently than by MEAM1 (Wisler and Duffus, 2001). An elegant study demonstrated that LIYV virions are specifically localized in the anterior foregut or cibarium of a whitefly vector (Chen et al., 2011), and research has demonstrated the involvement of the minor capsid protein (CPm) in the ability of whitefly vectors to transmit LIYV and likely other members of the genus (Tian et al., 1999; Stewart et al., 2010). The virus was a major problem for agricultural production in the southwestern United States and northern Mexico during the 1980s. However, B. tabaci biotype A (NW) rapidly disappeared over a period of several months with the establishment of B. tabaci MEAM1 (biotype B), and this resulted in disappearance of LIYV (Cohen et al., 1992; Duffus and Liu, 1994; Brown et al., 1995). LIYV has not been reported since the early 1990s in North America and it is absent from Europe or Asia. Due to the apparent complete disappearance of its lone vector from areas where the virus was known to occur, LIYV is believed to no longer exist in the wild. 12.3.3.2  Lettuce chlorosis virus (LCV) In the 1990s, yellowing symptoms began to appear in vegetable fields in the southwestern United States (Duffus et al., 1996b) and resembled those caused by LIYV. This coincided with the introduction of the B. tabaci MEAM1 into the region, and as noted above, MEAM1 completely displaced the resident NW population. This resulted in significant changes in LIYV epidemiology (Duffus and Liu, 1994), as MEAM1 is an exceptionally poor vector of LIYV. Virus purification and electron microscopy revealed the presence of a new clostero-like virus distinct from LIYV and other whitefly-transmitted viruses in a number of significant aspects (Duffus et  al., 1996b). It was named Lettuce chlorosis virus (LCV), and has not been found to infect members of the family Cucurbitaceae (Duffus et al., 1996b). LCV is serologically distinct from LIYV in ELISA. Complete characterization and phylogenetic analysis of the genome showed that LCV is most closely related to BnYDV and CYSDV (Salem et al., 2009). LCV occurs in the southwestern USA, where B. tabaci is prevalent and where it periodically causes disease outbreaks in winter lettuce (Salem et al., 2009). The last four years the virus has been detected in Europe (Spain) and Asia (China) in bean, tomato and tobacco crops (Ruiz et  al., 2014; Zhang et  al., 2017; Zhao et  al., 2018). Transmission experiments from LCV-infected bean plants failed to result in infection of healthy lettuce plants. Partial molecular characterization of ORF1a and HSP70h showed 92% nt and 90% nt identity, respectively, with the California isolate, a fact that suggests the existence of a new putative strain of LCV, LCV-SP. Furthermore, a study by Zhao et al. (2018) showed the presence of another strain in Nicotiana tabacum plants in China, which shares high similarity with a Chinese isolate from Solanum lycopersicum (Zhang et al., 2017). In China, LCV has also been detected in Catharanthus roseus, an ornamental and medicinal plant, inducing interveinal yellowing, leaf curl, and plant dwarfing (Tian et al., 2018). The virus is transmitted by both



12.3  Analytic description of each virus according to their major host

277

cryptic species, NW and MEAM1 (Duffus et al., 1996a; Wisler and Duffus, 2001), however, there is no data regarding the potential transmission by MED.

12.3.4  Viruses of tuber crops 12.3.4.1  Sweet potato chlorotic stunt virus (SPCSV) SPCSV was initially characterized at a biochemical level in 1992 (Winter et al., 1992) and 10 years later it was fully sequenced (Kreuze et al., 2002). The symptoms of SPCSV in Ipomoea batatas plants vary geographically. In East Africa the virus may cause color changes (purpling or yellowing) of lower or middle leaves (Gibson et al., 1998) depending on the variety. Elsewhere, symptoms include mild vein yellowing, a few sunken secondary veins on adaxial leaf surfaces, and swollen veins on abaxial surfaces (Cohen et al., 1992). The virus may also occur symptomlessly. An interesting aspect of SPCSV is the fact that it interacts synergistically with Sweet potato feathery mottle potyvirus (SPFMV) and causes sweet potato virus disease (SPVD) (Schaefers and Terry, 1976). The severe disease caused by this virus complex is due to SPCSV inducing an increase in the replication and concentration of SPFMV (or other potyviruses) of up to 600fold (Karyeija et al., 2000) and it is considered the main viral disease affecting sweet potato crop in many regions worldwide (Gutiérrez et al., 2003; Karyeija et al., 2000; Trenado et al., 2007b; Hahn, 1979; Milgram et al., 1996; Gibson et al., 1998; Njeru et al., 2004; Zhang et al., 2005). In addition, SPCSV has been detected along with SPFMV and Sweet potato mild speckling virus (SPMSV) in Argentina (and possibly in Brazil and Peru) inducing sweet potato chlorotic dwarf disease (SPCDD) (Di Feo et al., 2000). SPCDD-affected plants are stunted, the leaves exhibit mosaic, distortion and reduced leaf lamina. Yield reduction may reach up to 80% (Di Feo et al., 2000). SPCSV seems to be restricted to species belonging to the family Convolvulaceae, as 12 species have been recorded so far as natural hosts of the virus (Ipomoea cumina, I. crepidiformis, I. hildebrandtii, I. purpurea, I. repens, I. obscura, I. cairica, I. acuminata, I. sinensis, I. tenuirostris, Hewittia sublobata and Lepistemon owariensis) (Tugume et al., 2017). B. tabaci MEAM1 and T. abutilonea have been shown to transmit SPCSV in a semi-persistent manner (Gamarra et al., 2010; Sim et al., 2000), and B. afer sensu lato was also reported as a vector of SPCSV (Gamarra et al., 2010). 12.3.4.2  Potato yellow vein virus (PYVV) Potato yellow vein disease (PYVD) has been recorded in potato crops for over 60 years from Colombia and disease incidence rapidly spread to many fields (Salazar et al., 2000). The disease had been assumed to be caused by a virus agent and it was linked to the presence of the whitefly species T. vaporariorum. A study by Salazar et al. (2000) provided substantial evidence that a closterovirus, eventually namely Potato yellow vein virus (PYVV) was associated with PYVD. Early infections of PYVV induce bright yellow veins and interveinal yellowing of leaves. Later the leaves become yellow and the veins may become green. For this reason, a few farmers consider the name “yellow vein” to be misleading (Salazar et al., 2000). Tubers may be deformed, with large protruding eyes; as a result, yield reduction may reach up to 50% in

278

12.  Criniviruses infecting vegetable crops

plots where all plants are infected (Salazar et al., 2000). It is worth mentioning that symptomatology alone is not a reliable diagnostic criterion for PYVD, because the disease may remain latent in certain cultivars and the virus titer in infected plants can be extremely low (Wisler et al., 1998a; Salazar et al., 2000). PYVV has only been detected in the South American countries Colombia, Ecuador, Peru and Venezuela (Guzmán et al., 2006; Salazar et al., 2000), where its vector T. vaporariorum is present. In addition to transmission by T. vaporariorum the virus is also transmitted through tubers (Salazar et al., 2000). In fact, it has been recently suggested that movement of infected seed tubers might be the main mechanism of dispersion, and could be a key driver for the PYVV infection among potato crops (Cuadros et al., 2017). Several weed species belonging to the genus Polygonum were identified as natural hosts of PYVV. The virus has been also found in Rumex obtusifolium, Tagetes spp. and Catharanthus roseus (Salazar et al., 2000).

12.3.5  Viruses of bean 12.3.5.1  Bean yellow disorder virus (BnYDV) BnYDV was first observed during the autumn of 2003, causing heavy losses in French bean (Phaseolus vulgaris L.) grown commercially in Spain (Segundo et al., 2004). Symptoms included interveinal mottling and yellowing of leaves mainly appearing at the lower part of the plant and subsequently expanding to the new foliage. Affected plants were all observed in glasshouses infested with B. tabaci. In fact, disease incidence in bean-growing greenhouses increased from 34% to 50% in one year (Segundo et al., 2008). The virus was fully sequenced in 2008 (Martin et al., 2008). To date, BnYDV has only been detected in bean crops grown in greenhouses. There is no further information regarding its natural host range, which seems to be restricted under experimental conditions (Martin et al., 2011). The virus is transmitted by B. tabaci MED, but the possibility of transmission by other species of the B. tabaci complex remains unknown. Transmission experiments revealed efficiencies that exceeded 35% using single whiteflies with 24 h AAP and IAP, respectively (Martin et al., 2011). A much more surprising result was the ability of B. tabaci MED to retain BnYDV for up to 14 days when most criniviruses are retained for less than a week (Martin et al., 2011) (Table 12.4).

12.3.6  Viruses of other plants Although most viruses in the genus Crinivirus, affect vegetable crops, a subset, particularly those in Group 1 that are transmitted by T. vaporariorum (Fig. 12.2), are primarily pests of small fruit crops and wild species. Strawberry pallidosis associated virus (SPaV), as well as BPYV are part of a virus complex on strawberry that causes the disease, strawberry decline, which is associated with leaf reddening and dieback of plants (Martin and Tzanetakis, 2006; Tzanetakis et al., 2013). Neither crinivirus causes obvious symptoms on strawberry in single infection or even when both criniviruses are present in the strawberry plant. However, when plants are co-infected with either crinivirus along with any one of several aphid-transmitted viruses of strawberry, the co-infected plants develop strawberry decline symptoms. Viruses known to cause strawberry decline upon co-infection with either BPYV or SPaV include Strawberry crinkle virus, Strawberry vein banding virus, Strawberry mottle virus and Strawberry



12.4  Future prospects

279

mild yellow edge virus (Tzanetakis et al., 2006, 2013). It is possible that additional viruses may also contribute to strawberry decline during co-infection as well. Interestingly, titer of SPaV and BPYV within infected strawberry decline in the summer, and plants can put energy into regrowth during this period; however, symptoms will again recur as titers increase. A similar association between a crinivirus and partner viruses was also observed in blackberry and other caneberry plants, affected by blackberry yellow vein disease (Martin et al., 2004, 2013; Tzanetakis et  al., 2013), which can cause vein yellowing, oak-leaf patterns and irregular chlorosis on blackberry leaves, as well as misshapen floricanes (Susaimuthu et al., 2007, 2008). As with strawberry decline, blackberry yellow vein disease only occurs when a crinivirus, either BPYV or BYVaV co-infects blackberry plants along with a partner virus. Interestingly, BYVaV isolates from the southeastern United States exhibit as much as 12% genetic variability among isolates collected from cultivated and wild blackberries (Poudel et al., 2012, 2013). This level of genetic variation is unusually high for members of the genus Crinivirus. Two additional Group 1 viruses are noteworthy. DVCV is a virus identified from Virginia buttonweed (Diodia virginiana L.), a member of the Rubiaceae, which occurs in temperate wetland regions where T. abutilonea and T. vaporariorum can be found. Infected plants exhibit veinal chlorosis or netting. DVCV is not known to be a threat to any agricultural crops, but is interesting with respect to its vector transmissibility and genetic relationships with other members of the genus Crinivirus (Tzanetakis et al., 2011, 2013). AYV is a partially characterized crinivirus originally collected from velvetleaf (Abutilon theophrasti Medic.) from Illinois in the late 1970s. AYV has never been observed affecting agricultural or horticultural crops, and it is only known to be transmitted by T. abutilonea (Tzanetakis et al., 2013). Sequencing of the coat protein gene of AYV, the only gene of this virus available in public databases, placed it within Group 1, along with other criniviruses transmitted by Trialeurodes species. Recent high throughput sequencing of the genome of AYV suggests its closest known relative is likely SPaV (Hladky, Mollov, and Wintermantel, unpublished).

12.4  Future prospects Criniviruses have a significant economic impact on vegetable crops worldwide. Even though a large number of plant virologists around the world are involved with their study, there are still several aspects of their biology, epidemiology and genetics that remain largely unknown. Further insights are needed with regard to crinivirus-plant host and criniviruswhitefly interactions, as well as studies to evaluate the interactions of criniviruses with other plant viruses that are frequently infecting the same hosts. This will provide greater insight into factors affecting their epidemiology and disease development. Moreover, future research should focus on the generation of cDNA infectious clones for additional members of the genus. Currently clones have been generated for LIYV, LCV, ToCV, CCYV and CYSDV (Wang et al., 2009b; Chen et al., 2012; Orílio et al., 2014; Shi et al., 2016; Owen et al., 2016). Research on this field will aid toward the elucidation of crinivirus gene function through the application of standard and reverse genetic approaches. Finally, given the difficulty to control viruses of this important whitefly-transmitted genus, more studies should be performed on the development of novel strategies for efficient disease

280

12.  Criniviruses infecting vegetable crops

management. Continued efforts toward identification of resistance sources and development of resistant vegetable varieties for control of agriculturally important criniviruses are of paramount importance. Further research on the application of plant defense activators against crinivirus may also unveil new effective means of disease control.

Acknowledgments Chrysoula Orfanidou is a recipient of a scholarship funded by General Secretariat for Research and Technology (GSRT) and the Hellenic Foundation for Research and Innovation (HFRI) (Scholarship Code: 984).

References Abou-Jawdah Y, Sobh H, El-Zamma S, Fayyad A, Lecoq H. Incidence and management of virus diseases of cucurbits in Lebanon. Crop Prot 2000a;19:217–24. Abou-Jawdah Y, Sobh H, Fayad A, Lecoq H, Delecolle B, Trad-Ferre J. Cucurbit yellow stunting disorder virus—a new threat to cucurbits in Lebanon. J Plant Pathol 2000b;82:55–60. Abrahamian PE, Abou-Jawdah Y. Whitefly-transmitted criniviruses of cucurbits: current status and future prospects. Virus Dis 2014;25:26–38. Abrahamian PE, Sobh H, Abou-Jawdah Y. First report of Cucurbit chlorotic yellows virus on cucumber in Lebanon. Plant Dis 2012;96:1704. Abrahamian  PE, Seblani  R, Sobh  H, Abou-Jawdah  Y. Detection and quantitation of two cucurbit criniviruses in mixed infection by real-time RT-PCR. J Virol Methods 2013;193:320–6. Abrahamian PE, Sobh H, Seblani R, Abou-Jawdah Y. Co-infection of two criniviruses and a begomovirus enhances the disease severity in cucumber. Eur J Plant Pathol 2015;142:521–30. Accotto GP, Vaira AM, Vecchiati M. First report of Tomato chlorosis virus in Italy. Plant Dis 2001;85:1208. Agranovsky AA, Lesemann DE, Maiss E, Hull R, Atabekov JG. Rattlesnake structure of a filamentous plant RNA virus built of two capsid proteins. Proc Natl Acad Sci U S A 1995;92:2470–3. Aguilar  JM, Franco  M, Marco  CF, Berdiales  B, Rodriguez-Cerezo  E, Truniger  V, Aranda  MA. Further variability within the genus Crinivirus, as revealed by determination of the complete RNA genome sequence of Cucurbit yellow stunting disorder virus. J Gen Virol 2003;84:2555–64. Aguilar  JM, Abad  J, Aranda  MA. Resistance to Cucurbit yellow stunting disorder virus in cucumber. Plant Dis 2006;90:583–6. Al Rwahnih M, Dolja VV, Daubert S, Koonin EV, Rowhani A. Genomic and biological analysis of Grapevine leafroll-­ associated virus 7 reveals a possible new genus within the family Closteroviridae. Virus Res 2012;163:302–9. Al-Saleh  MA, Al-Shahwan  I, Shakeel  MT, Amer  MA, Orfanidou  C, Katis  NI. First report of Tomato chlorosis virus (ToCV) in tomato crops in Saudi Arabia. Plant Dis 2014;98:1590. Al-Saleh MA, Al-Shahwan I, Amer MA, Shakeel MT, Abdalla AO, Orfanidou C, Katis NI. First report of Cucurbit chlorotic yellows virus in cucumber in Saudi Arabia. Plant Dis 2015;99:73. Alvarez-Ruiz P, Jimenez CG, Leyva-López NE, Méndez-Lozano J. First report of Tomato chlorosis virus infecting tomato crops in Sinaloa, Mexico. Plant Pathol 2007;56:1043. Amer MA. Serological and molecular characterization of Cucurbit chlorotic yellows virus affecting cucumber plants in Egypt. Int J Virol 2015;11:1–11. Anfoka  GH, Abhary  MK. Occurrence of Tomato infectious chlorosis virus (TICV) in Jordan. Bull OEPP/EPPO Bull 2007;37:186–90. Arruabarrena A, Rubio L, González-Arcos M, Maeso D, Sánchez-Campos S, Fonseca MEN. First report of Solanum sisymbriifolium and S. americanum as natural weed hosts of Tomato chlorosis virus (genus Crinivirus) in South America. Plant Dis 2015;99:895. Bananej K, Menzel W, Vahdat A, Winter S. First report of Cucurbit chlorotic yellows virus infecting cucumber, melon, and squash in Iran. Plant Dis 2013;97:1005. Berdiales B, Bernal JJ, Saez E, Would B, Beitia F, Rodriguez-Cerezo E. Occurrence of Cucurbit yellow stunting disorder virus (CYSDV) and Beet pseudo-yellows virus (BPYV) in cucurbit crops in Spain and transmission by two biotypes of Bemisia tabaci. Eur J Plant Pathol 1999;105:211–5.

References 281

Boiteux  LS, Lima  MF, Fonseca  MEN, Mendonça  JL, Costa  AF, Silva-Filho  JG, Fontes  MG, González-Arcos  M. Identification of eight solanum (subgenus Leptostemonum) species as novel natural hosts of Tomato chlorosis virus in Brazil. Plant Dis 2018;102:1673. Boubourakas  IN, Avgelis  AD, Kyriakopoulou  PE, Katis  NI. Occurrence of yellowing viruses (Beet pseudo-yellows virus, Cucurbit yellow stunting disorder virus and Cucurbit aphid-borne yellows virus) affecting cucurbits in Greece. Plant Pathol 2006;55:276–83. Boykin  LM, Shatters  RG, Rosell  RC, McKenzie  CL, Bagnall  RA, De Barro  P, Frohlich  DR. Global relationships of Bemisia tabaci (Hemiptera: Aleyrodidae) revealed using Bayesian analysis of mitochondrial CO1 DNA sequences. Mol Phylogenet Evol 2007;44:1306–19. Brown JK, Frohlich DR, Rosell RC. The sweetpotato or silverleaf whiteflies: biotypes of Bemisia tabaci or a species complex? Annu Rev Entomol 1995;40:511–34. Caciagli PC. Whitefly-borne viruses in continental Europe. In: Harris KF, Smith OP, Duffus JE, editors. Virus-insectplant interactions. New York: Academic Press; 2001. p. 279–92. Cañizares MC, Navas-Castillo J, Moriones E. Multiple suppressors of RNA silencing encoded by both genomic RNAs of the crinivirus, Tomato chlorosis virus. Virology 2008;379:168–74. Castle SJ, Palumbo JP, Merten P. Field evaluation of Cucurbit yellow stunting disorder virus transmission by Bemisia tabaci. Virus Res 2017a;241:220–7. Castle S, Palumbo J, Merten P, Cowden C, Prabhaker N. Effects of foliar and systemic insecticides on whitefly transmission and incidence of Cucurbit yellow stunting disorder virus. Pest Manag Sci 2017b;73:1462–72. Célix A, Lopez-Sesé A, Alwarza N, Gomez-Guillamón ML, Rodriguez-Cerezo E. Characterization of Cucurbit yellow stunting disorder virus, a Bemisia tabaci-transmitted closterovirus. Phytopathology 1996;86:1370–6. Chen AYS, Walker GP, Carter D, Ng JCK. A virus capsid component mediates virion retention and transmission by its insect vector. Proc Natl Acad Sci U S A 2011;108:16777–82. Chen AY, Pavitrin A, Ng JCK. Agroinoculation of the cloned infectious cDNAs of Lettuce chlorosis virus results in systemic plant infection and production of whitefly transmissible virions. Virus Res 2012;169:310–5. Clover GRG, Elliott DR, Tang Z, Alexander BJR. Occurrence of Beet pseudo-yellows virus in cucumber in New Zealand. Plant Pathol 2002;51:389. Cohen S, Duffus JE, Liu H-Y. A new Bemisia tabaci (Gennadius) biotype in southwestern United States and its role in silverleaf of squash and transmission of Lettuce infectious yellows virus. Phytopathology 1992;82:86–90. Cuadros DF, Hernandez A, Torres MF, Torres DM, Branscum AJ, Rincon DF. Vector transmission alone fails to explain the Potato yellow vein virus epidemic among potato crops in Colombia. Front Plant Sci 2017;8:1654. https:// doi.org/10.3389/fpls.2017.01654. Cuellar WJ, Tairo F, Kreuze JF, Valkonen JP. Analysis of gene content in Sweet potato chlorotic stunt virus RNA1 reveals the presence of the p22 RNA silencing suppressor in only a few isolates: implications for viral evolution and synergism. J Gen Virol 2008;89:573–82. Dalmon A, Boyer S, Cailly M, Girard M, Lecoq H, Desbiez C, Jacquemond M. First report of Tomato chlorosis virus and Tomato infectious chlorosis virus in tomato crops in France. Plant Dis 2005;89:1242. De Barro  PJ, Liu  SS, Boykin  LM, Dinsdale  AB. Bemisia tabaci: a statement of species status. Annu Rev Entomol 2011;56:1–19. Desbiez C, Lecoq H, Aboulama S, Peterschmitt M. First report of Cucurbit yellow stunting disorder virus in Morocco. Plant Dis 2000;84:596. Di Feo L, Nome SF, Biderbost E, Fuentes S, Salazar LF. Etiology of sweet potato chlorotic dwarf disease in Argentina. Plant Dis 2000;84:35–9. Dinsdale  A, Cook  L, Riginos  C, Buckley  YM, De Barro  PJ. Refined global analysis of Bemisia tabaci (Hemiptera: sternorrhyncha: Aleyrodoidea: Aleyrodidae) mitochondrial cytochrome oxidase I to identify species level genetic boundaries. Ann Entomol Soc Am 2010;103:196–208. Dolja VV, Kreuze JF, Valkonen JP. Comparative and functional genomics of closteroviruses. Virus Res 2006;117:38–51. Dovas CI, Katis NI. A spot multiplex nested RT-PCR for the simultaneous and generic detection of viruses involved in the aetiology of grapevine leafroll and rugose wood of grapevine. J Virol Methods 2003;109:217–26. Dovas CI, Katis NI, Avgelis AD. Multiplex detection of criniviruses associated with epidemics of a yellowing disease of tomato in Greece. Plant Dis 2002;86:1345–9. Duffus JE. Beet pseudo-yellows virus, transmitted by the greenhouse whitefly, Trialeurodes vaporariorum. Phytopathology 1965;55:450–3. Duffus JE, Flock RA. Whitefly-transmitted disease complex of the desert southwest. Calif Agric 1982;36:4–6.

282

12.  Criniviruses infecting vegetable crops

Duffus  JE, Johnstone  GR. Beet pseudo-yellows virus in Tasmania: the first report of a whitefly transmitted virus in Australasia. Australas Plant Pathol 1981;10:68–9. Duffus JE, Liu HY. The effects of whitefly population changes on Lettuce infectious yellows virus epidemiology. In: Sweetpotato whitefly: Supplement to the five-year plan; 1994. p. 48. USDA ARS No. 112. Duffus JE, Larsen RC, Liu HY. Lettuce infectious yellows virus—a new type of whitefly-transmitted virus. Phytopathology 1986;74:97–100. Duffus JE, Liu H-Y, Wisler GC. Tomato infectious chlorosis virus—a new clostero-like virus transmitted by Trialeurodes vaporariorum. Eur J Plant Pathol 1996a;102:219–26. Duffus  JE, Liu  HY, Wisler  GC, Li  R. Lettuce chlorosis virus—a new whitefly-transmitted closterovirus. Eur J Plant Pathol 1996b;102:591–6. Eid S, Sbou-Jawdah Y, El Mohtar C, Sobh H, Havey M. Tolerance to cucumber to Cucurbit yellow stunting disorder virus. Plant Dis 2006;90:645–9. Esquivel Farina A, Rezende JAM, Wintermantel WM. Expanding knowledge of the host range of Tomato chlorosis virus and host plant preference of Bemisia tabaci MEAM1. Plant Dis 2019. https://doi.org/10.1094/PDIS-11-18-1941-RE. Esteva J, Nuez F. Tolerance to a whitefly-transmitted virus causing muskmelon yellows disease in Spain. Theor Appl Genet 1992;84:693–7. Febres VJ, Ashoulin L, Mawassi M, Frank A, Bar-Joseph M, Manjunath KL, Lee RF, Niblett CL. The p27 protein is present at one end of Citrus tristeza virus particles. Phytopathology 1996;86:1331–5. Fereres A, Peñaflor MF, Favaro CF, Azevedo KE, Landi CH, Maluta NK, Bento JM, Lopes JR. Tomato infection by whitefly-transmitted circulative and non-circulative viruses induce contrasting changes in plant volatiles and vector behaviour. Viruses 2016;8. https://doi.org/10.3390/v8080225. Fiallo-Olivé E, Espino AI, Botella-Guillén M, Gómez-González E, Reyes-Carlos JA, Navas-Castillo J. Tobacco: a new natural host of Tomato chlorosis virus in Spain. Plant Dis 2014;98:1162. Fonseca MEN, Boiteux LS, Abreu H, Nogueira I, Pereira-Carvalho RC. Physalis angulata: a new natural host of Tomato chlorosis virus in Brazil. Plant Dis 2013;97:692. Font MI, Martínez-Culebras P, Jordá MC, Louro D, Vaira AM, Accotto GP. First report of Tomato infectious chlorosis virus in Spain. Plant Dis 2002;86:696. Font MI, Juárez M, Martínez O, Jordá C. Current status and newly discovered natural hosts of Tomato infectious chlorosis virus and Tomato chlorosis virus in Spain. Plant Dis 2004;88:82. Fortes IM, Navas-Castillo J. Potato, an experimental and natural host of the crinivirus Tomato chlorosis virus. Eur J Plant Pathol 2012;134:81–6. Gamarra HA, Fuentes S, Morales FJ, Glover R, Malumphy C, Barker I. Bemisia afer sensu lato, a vector of Sweet potato chlorotic stunt virus. Plant Dis 2010;94:510–4. García-Cano E, Resende RO, Fernández-Muñoz R, Moriones E. Synergistic interaction between Tomato chlorosis virus and Tomato spotted wilt virus results in breakdown of resistance in tomato. Phytopathology 2006;96:1263–9. García-Cano E, Navas-Castillo J, Moriones E, Fernández-Muñoz R. Resistance to Tomato chlorosis virus in wild tomato species that impair virus accumulation and disease symptom expression. Phytopathology 2010;100:582–92. Gibson RW, Mpembe I, Alicai T, Carey EE, Mwanga ROM, Seal SE, Vetten HJ. Symptoms, etiology and serological analysis of sweet potato virus disease in Uganda. Plant Pathol 1998;47:95–102. Gil-Salas FM, Morris J, Colyer A, Budge G, Boonham N, Cuadrado IM, Janssen D. Development of real-time RTPCR assays for the detection of Cucumber vein yellowing virus (CVYV) and Cucurbit yellow stunting disorder virus (CYSDV) in the whitefly vector Bemisia tabaci. J Virol Methods 2007;146:45–51. Gonzalez-Arcos  M, Fonseca  MED, Arruabarrena  A, Lima  MF, Michereff  M, Moriones  E, Fernandez-Munoz  R, Boiteux LS. Identification of genetic sources with attenuated Tomato chlorosis virus-induced symptoms in Solanum (section Lycopersicon) germplasm. Euphytica 2018;214:178. https://doi.org/10.1007/s10681-018-2253-9. Gu QS, Liu YH, Wang YH, Huangfu WG, Gu HF, Xu L, Song FM, Brown JK. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in China. Plant Dis 2011;95:73. Gutiérrez D, Fuentes S, Salazar LF. Sweet potato virus disease (SPVD): distribution, incidence, and effect on sweet potato yield in Peru. Plant Dis 2003;87:297–302. Guzmán M, Ruiz E, Arciniegas N, Coutts RHA. Occurrence and variability of Potato yellow vein virus in three departments of Colombia. J Phytopathol 2006;154:748–50. Gyoutoku Y, Okazaki S, Furuta A, Etho T, Mizobe M, Kuno K, Hayashida S, Okuda M. Chlorotic yellows disease of melon caused by Cucurbit chlorotic yellows virus, a new crinivirus. Jpn J Phytopathol 2009;75:109–11. Hahn SK. Effects of viruses (SPVD) on growth and yield of sweet potato. Exp Agric 1979;15:1–5.

References 283

Hamed K, Menzel W, Dafalla G, Gadelseed AMA, Winter S. First report of Cucurbit chlorotic yellows virus infecting muskmelon and cucumber in Sudan. Plant Dis 2011;95:1321. Hammond RW, Hernandez E, Mora F, Ramirez P. First report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica. Plant Dis 2005;89:1130. Hartono S, Natsuki T, Sayama H, Atarashi H, Okuda S. Yellowing disease of tomatoes caused by Tomato infectious chlorosis virus newly recognized in Japan. J Gen Plant Pathol 2003;69:61–4. Hassan AA, Duffus JE. A review of a yellowing and stunting disorder of cucurbits in the United Arab Emirates. Emir J Food Agric 1991;2:1–16. He X, Harper K, Grantham G, Yang CH, Creamer R. Serological characterization of the 3′-proximal encoded proteins of Beet yellows closterovirus. Arch Virol 1998;143:1349–63. Hourani H, Abou-Jawdah Y. Immunodiagnosis of Cucurbit yellow stunting disorder virus using polyclonal antibodies developed against recombinant coat protein. J Plant Pathol 2003;85:197–204. Huang L-H, Tseng H-H, Li J-T, Chen T-C. First report of Cucurbit chlorotic yellows virus infecting cucurbits in Taiwan. Plant Dis 2010;94:1168. Jacquemond M, Verdin E, Dalmon A, Guilbaud L, Gognalons P. Serological and molecular detection of Tomato chlorosis virus and Tomato infectious chlorosis virus in tomato. Plant Pathol 2009;58:210–20. Johnson DD, Walker GP, Creamer R. Stylet penetration behavior resulting in inoculation of a semipersistently transmitted closterovirus by the whitefly Bemisia argentifolii. Entomol Exp Appl 2002;102:115–23. Kao J, Jia L, Tian T, Rubio L, Falk BW. First report of Cucurbit yellow stunting disorder virus (genus Crinivirus) in North America. Plant Dis 2000;84:101. Karasev AV. Genetic diversity and evolution of closteroviruses. Annu Rev Phytopathol 2000;38:293–324. Karyeija RF, Kreuze JF, Gibson RW, Valkonen JPT. Synergistic interactions of a potyvirus and a phloem-limited crinivirus in sweet potato plants. Virology 2000;269:26–36. Kashif M, Pietilä S, Artola K, Jones RAC, Tugume AK, Mäkinen V, Valkonen JPT. Detection of viruses in sweetpotato from Honduras and Guatemala augmented by deep-sequencing of small-RNAs. Plant Dis 2012;96:1430–7. Kataya ARA, Suliman MNS, Kalantidis K, Livieratos IC. Cucurbit yellow stunting disorder virus p25 is a suppressor of post-transcriptional gene silencing. Virus Res 2009;145:48–53. Kaur N, Chen W, Zheng Y, Hasegawa DK, Ling K-S, Fei Z, Wintermantel WM. Transcriptome analysis of the whitefly, Bemisia tabaci MEAM1 during feeding on tomato infected with the crinivirus, Tomatochlorosis virus, identifies a temporal shift in gene expression and differential regulation of novel orphan genes. BMC Genomics 2017;18. https://doi.org/10.1186/s12864-017-3751-1. Kawazu Y, Shikomura K, Maeda S, Yamato Y, Ueda S, Okuda M, Sugiyama M. QTL mapping for resistance to Cucurbit chlorotic yellows virus in melon (Cucumis melo L.). Euphytica 2018;214. https://doi.org/10.1007/s10681-018-2321-1. Keshevarz T, Shams-Bakhsh M, Izadpanah K, Nassaj Hossini SM. Geographic distribution and phylogenetic analysis of Cucurbit yellow stunting disorder virus in Iran. Acta Virol 2013;57:415–20. Kil EJ, Kim S, Lee YJ, Kang EH, Lee M, Cho SH, Kim MK, Lee KY, Heo NY, Choi HS, Kwon ST, Lee S. Advanced loop-mediated isothermal amplification method for sensitive and specific detection of Tomato chlorosis virus using a uracil DNA glycosylase to control carry-over contamination. J Virol Methods 2015a;213:68–74. Kil E-J, Lee J-J, Cho S, Auh C-K, Kim D, Lee K-Y, Kim M-K, Choi H-S, Kim C-S, Lee S. Identification of natural weed hosts of Tomato chlorosis virus in Korea by RT-PCR with root tissues. Eur J Plant Pathol 2015b;142:419–26. Kiss  ZA, Medina  V, Falk  BW. Crinivirus replication and host interactions. Front Microbiol 2013;4. https://doi. org/10.3389/fmicb.2013.00099. Klaassen  VA, Boeshore  ML, Koonin  EV, Tian  T, Falk  BW. Genome structure and phylogenetic analysis of Lettuce infectious yellows virus, a whitefly-transmitted closterovirus. Virology 1995;208:99–110. Kokkinos CD, Clark CA. Real-time PCR assays for detection and quantification of sweetpotato viruses. Plant Dis 2006;90:1347–52. Kreuze JF, Savenkov EI, Valkonen JP. Complete genome sequence and analyses of the subgenomic RNAs of Sweet potato chlorotic stunt virus reveal several new features for the genus Crinivirus. J Virol 2002;76:9260–70. Kreuze JF, Savenkov EI, Cuellar W, Li X, Valkonen JPT. Viral class 1 RNase III involved in suppression of RNA silencing. J Virol 2005;79:7227–38. Kubota K, Ng JCK. Lettuce chlorosis virus p23 suppresses RNA silencing and induces local necrosis with increased severity at raised temperatures. Phytopathology 2016;106:653–62. Kubota K, Usugi T, Tsuda S. Production of antiserum and immunodetection of Cucurbit chlorotic yellows virus, a novel whitefly-transmitted crinivirus. J Gen Plant Pathol 2011;77:116–20.

284

12.  Criniviruses infecting vegetable crops

Lecoq  H, Moury  B, Desbiez  C, Palloix  A, Pitrat  M. Durable virus resistance in plants through conventional approaches: a challenge. Virus Res 2004;100:31–9. Lei H, van Lenteren JC, Xu RM. Effects of plant tissue factors on the acceptance of four greenhouse vegetable host plants by the greenhouse whitefly: an electrical penetration graph (EPG) study. Eur J Entomol 2001;98:31–6. Lesemann D-E. Cytopathology. In: Milne RG, editor. The plant viruses—The filamentous plant viruses. New York: Plenum Press; 1988. p. 179–235. Li J, Liang X, Wang X, Shi Y, Gu Q, Kuo Y-W, Falk BW, Yan F. Direct evidence for the semipersistent transmission of Cucurbit chlorotic yellows virus by a whitefly vector. Sci Rep 2016;6:36604. https://doi.org/10.1038/srep36604. Livieratos IC, Avgelis AD, Coutts RHA. Molecular characterization of the Cucurbit yellow stunting disorder virus coat protein. Phytopathology 1999;89:1050–5. Livieratos IC, Eliasco E, Muller G, Olsthoorn RCL, Salazar LF, Pleij CW, Coutts RH. Analysis of the RNA of Potato yellow vein virus: evidence for a tripartite genome and conserved 3′-terminal structures among members of the genus Crinivirus. J Gen Virol 2004;85:2065–75. López R, Asensio C, Guzman MM, Boonham N. Development of real-time and conventional RT-PCR assays for the detection of Potato yellow vein virus (PYVV). J Virol Methods 2006;136:24–9. Lopez-Sese AI, Gomez-Guillamon ML. Resistance to Cucurbit yellowing stunting disorder virus (CYSDV) in Cucumis melo L. Hortic Sci 2000;35:110–3. Lot  H, Delecolle  B, Lecoq  H. A whitefly transmitted virus causing muskmelon yellows in France. Acta Hortic 1983;127:175. Louro D, Vicente M, Vaira AM, Accotto GP, Nolasco G. Cucurbit yellow stunting disorder virus (genus Crinivirus) associated with the yellowing disease of cucurbit crops in Portugal. Plant Dis 2000;84:1156. Lozano G, Moriones E, Navas-Castillo J. First report of sweet pepper (Capsicum annuum) as a natural host plant for Tomato chlorosis virus. Plant Dis 2004;88:224. Lozano G, Moriones E, Navas-Castillo J. Complete nucleotide sequence of the RNA2 of the crinivirus Tomato chlorosis virus. Arch Virol 2006;151:581–7. Lu S, Li J, Wang X, Song D, Bai R, Shi Y, Gu Q, Kuo Y-W, Falk BW, Yan F. A semi-persistent plant virus differentially manipulates feeding behaviors of different sexes and biotypes of its whitefly vector. Viruses 2017;9:4. https://doi. org/10.3390/v9010004. Macedo  MA, Inoue-Nagata  AK, Silva  TNZ, Freitas  DMS, Rezende  JAM, Barbosa  JC, Michereff-Filho  M, Nascimento AR, Lourenção AL, Bergamin Filho A. Temporal and spatial progress of the diseases caused by the crinivirus Tomato chlorosis virus and the begomovirus Tomato severe rugose virus in tomatoes in Brazil. Plant Pathol 2018;68:72–84. Maluta NKP, Garzo E, Moreno A, Navas-Castillo J, Fiallo-Olive E, Lopes JRS, Fereres A. Stylet penetration activities of the whitefly Bemisia tabaci associated with inoculation of the crinivirus Tomato chlorosis virus. J Gen Virol 2017;98:515–20. Mandal B, Mandal S, Csinos AS, Martinez N, Culbreath AK, Pappu HR. Biological and molecular analyses of the acibenzolar-S-methyl-induced systemic acquired resistance in flue-cured tobacco against Tomato spotted wilt virus. Phytopathology 2008;98:196–204. Manglli A, Murenu M, Sitzia M, Tomassoli L. First report of Cucurbit yellow stunting disorder virus infecting cucurbits in Italy. New Dis Rep 2016;34:23. Mansilla-Cordova PJ, Bampi DN, Rondinel-Mendoza VP, Melo CT, Lourenc AL, Rezende JAM. Screening tomato genotypes for resistance and tolerance to Tomato chlorosis virus. Plant Pathol 2018;67:1231–7. Marco CF, Aranda MA. Genetic diversity of a natural population of Cucurbit yellow stunting disorder virus. J Gen Virol 2005;86:815–22. Marco CF, Aquilar JM, Abad J, Gomez-Guillamon ML, Aranda MA. Melon resistance to Cucurbit yellowing stunting disorder virus is characterized by reduced virus accumulation. Phytopathology 2003;93:844–52. Martelli GP, Agranovsky AA, Bar-Joseph M, Boscia D, Candresse T, Coutts RHA, Dolja VV, Falk BW, Gonsalves D, Jelkmann W, Karasev AV, Minafra A, Namba S, Vetten HJ, Wisler GC, Yoshikawa N. The family Closteroviridae revised. Arch Virol 2002;147:2039–44. Martelli  GP, Agranovsky  AA, Bar-Joseph  M, Boscia  D, Candresse  T, Coutts  RHA, Dolja  VV, Hu  JS, Jelkmann  W, Karasev  AV, Martin  RR, Minafra  A, Namba  S, Vetten  HJ. Family Closteroviridae. In: King  AMQ, Adams  MJ, Carstens EB, Lefkowitz EJ, editors. Virus taxonomy: Ninth report of the International Committee on Taxonomy of Viruses. London: Elsevier Academic Press; 2011. p. 987–1001.

References 285

Martin  RR, Tzanetakis  IE. Characterization, detection and management of strawberry viruses. Plant Dis 2006;90:384–96. Martin RR, Tzanetakis IE, Gergerich RC, Fernandez G, Pesic Z. Blackberry yellow vein associated virus: a new crinivirus found in blackberry. Acta Hortic 2004;656:137–42. Martin G, Velasco L, Segundo E, Cuadrado IM, Janssen D. The complete nucleotide sequence and genome organization of Bean yellow disorder virus, a new member of the genus Crinivirus. Arch Virol 2008;153:999–1001. Martin G, Cuadrado IM, Janssen D. Bean yellow disorder virus: parameters of transmission by Bemisia tabaci and host plant range. Insect Sci 2011;18:50–6. Martin RR, MacFarlane S, Sabanadzovic S, Quito D, Poudel B, Tzanetakis IE. Viruses and virus diseases of Rubus. Plant Dis 2013;97:168–82. McCreight JD. Inheritance of resistance to Lettuce infectious yellows virus in melon. Hortic Sci 2000;35:1118–20. McCreight JD, Wintermantel WM. Genetic resistance in melon PI 313970 to Cucurbit yellow stunting disorder virus. Hortic Sci 2011;46:1582–7. McCreight JD, Wintermantel WM, Natwick ET. New sources of resistance to CYSDV in melon. In: Kozik EU, Paris HS, editors. Cucurbitaceae 2016, XIth Eucarpia Meeting on Genetics and Breeding of Cucurbitaceae. Warsaw, Poland. 2016. p. 61–5. McCreight JD, Wintermantel WM, Natwick ET, Sinclair JW, Crosby KM, Gomez-Guillamon ML. Recessive resistance to Cucurbit yellow stunting disorder virus in melon TGR 1551. Acta Hortic 2017;1151:101–7. McLain J, Castle S, Holmes G, Creamer R. Physicochemical characterization and field assessment of Lettuce chlorosis virus. Plant Dis 1998;82:1248–52. Méndez-Lozano  J, Magallanes-Tapia  MA, Romero-Romero  JL, Camacho Beltrán  E, Orduño-Vega  WL, LeyvaLópez NE, Santos-Cervantes ME. Tomato infectious chlorosis virus associated with tomato diseases in Baja California, Mexico. Plant Dis 2012;96:1229. Milgram M, Cohen J, Loebenstein G. Effects of Sweet potato feathery mottle virus and Sweet potato sunken vein virus on sweet potato yields and rates of reinfection of virus-free planting material in Israel. Phytoparasitica 1996;24:189–93. Mongkolsiriwattana C, Zhou JS, Ng JC. A 3′-end structure in RNA2 of a crinivirus is essential for viral RNA synthesis and contributes to replication-associated translation activity. Sci Rep 2016;6. https://doi.org/10.1038/srep34482. Morris J, Steel E, Smith P, Boonham N, Spence N, Barker I. Host range studies for Tomato chlorosis virus, and Cucumber vein yellowing virus transmitted by Bemisia tabaci (Gennadius). Eur J Plant Pathol 2006;114:265–73. Mutschler  MA, Wintermantel  WM. Reducing virus associated crop loss through resistance to insect vectors. In: Loebenstein G, Carr JP, editors. Natural resistance mechanisms of plants to viruses. New York: Springer; 2006. p. 241–60. Navas-Castillo J, Fiallo-Olive E, Sanches-Campos S. Emerging virus diseases transmitted by whiteflies. Annu Rev Phytopathol 2011;49:219–48. Ng JCK, Chen AYS. Acquisition of Lettuce infectious yellows virus by Bemisia tabaci perturbs the transmission of Lettuce chlorosis virus. Virus Res 2011;156:64–71. Ng JCK, Falk BW. Bemisia tabaci transmission of specific Lettuce infectious yellows virus genotypes derived from in vitro synthesized transcript-inoculated protoplasts. Virology 2006;352:209–15. Ng JCK, Tian T, Falk BW. Quantitative parameters determining whitefly (Bemisia tabaci) transmission of Lettuce infectious yellows virus and an engineered defective RNA. J Gen Virol 2004;85:2697–707. Njeru RW, Mburu MW, Cheramgoi EC, Gibson RW, Kiburi ZM, Obudho E, Yobera D. Studies on the physiological effects of viruses on sweet potato yield in Kenya. Ann Appl Biol 2004;145:71–6. Offei SK, Arciniegas N, Müller G, Guzmán M, Salazar LF, Coutts RHA. Molecular variation of Potato yellow vein virus isolates. Arch Virol 2004;149:821–7. Okuda M, Okazaki S, Yamasaki S, Okuda S, Sugiyama M. Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus Crinivirus. Phytopathology 2010;100:560–6. Okuda S, Okazaki M, Sugiyama M, Sakata Y, Takeshita M, Iwai H. Resistance in melon to Cucurbit chlorotic yellows virus, a whitefly-transmitted crinivirus. Eur J Plant Pathol 2013;135:313–21. Okuda M, Okuda S, Iwai H. Detection of Cucurbit chlorotic yellows virus from Bemisia tabaci captured on sticky traps using reverse transcription loop-mediated isothermal amplification (RT-LAMP) and simple template preparation. J Virol Methods 2015;221:9–14. Orfanidou CG, Dimitriou C, Papayiannis LC, Maliogka VI, Katis NI. Epidemiology and genetic diversity of criniviruses associated with tomato yellows disease in Greece. Virus Res 2014a;186:120–9.

286

12.  Criniviruses infecting vegetable crops

Orfanidou C, Maliogka VI, Katis NI. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis 2014b;98:1446. Orfanidou C, Pappi P, Efthimiou K, Katis NI, Maliogka VI. Transmission of Tomato chlorosis virus (ToCV) by Bemisia tabaci biotype Q and evaluation of four weed species as viral sources. Plant Dis 2016;100:2043–9. Orfanidou CG, Baltzi A, Dimou NA, Katis NI, Maliogka VI. Cucurbit chlorotic yellows virus: insights into its natural host range, genetic variability, and transmission parameters. Plant Dis 2017a;101:2053–8. Orfanidou CG, Maliogka VI, Katis NI, Kontosfyris G, Smith T, Caglayan K. First report of Cucurbit chlorotic yellows virus in cucumber in Turkey. J Plant Pathol 2017b;99:533. Orfanidou CG, Papayiannis LC, Pappi P, Katis NI, Maliogka VI. Criniviruses associated with Cucurbit yellows disease in Greece and Cyprus: an ever changing scene. Plant Pathol 2019;68:764–74. Orílio AF, Fortes IM, Navas-Castillo J. Infectious cDNA clones of the crinivirus Tomato chlorosis virus are competent for systemic plant infection and whitefly-transmission. Virology 2014;464–465:365–74. Owen CA, Moukarzel R, Huang X, Kassem MA, Eliasco E, Aranda MA, Coutts RH, Livieratos IC. In vitro synthesized RNA generated from cDNA clones of both genomic components of Cucurbit yellow stunting disorder virus replicates in cucumber protoplasts. Viruses 2016;8:170. https://doi.org/10.3390/v8060170. Palomares-Rius FJ, Garces-Claver A, Pico MB, Esteras C, Yuste-Lisbona FJ, Gomez-Guillamon ML. ‘Carmen’, a yellow canary melon breeding line resistant to Podosphaera xanthii, Aphis gossypii, and Cucurbit yellow stunting disorder virus. Hortic Sci 2018;53. https://doi.org/10.21273/HORTSCI13013-18. Palukaitis P, Yoon J-Y, Choi S-K, Carr JP. Manipulation of induced resistance to viruses. Curr Opin Virol 2017;26:141–7. Papayiannis LC, Ioannou N, Boubourakas IN, Dovas CI, Katis NI, Falk BW. Incidence of viruses infecting cucurbits in Cyprus. J Phytopathol 2006;153:530–5. Papayiannis LC, Hunter SC, Iacovides T, Brown JK. Detection of Cucurbit yellow stunting disorder virus in cucurbit leaves using sap extracts and real-time TaqMan® reverse transcription (RT) polymerase chain reaction (PCR). J Phytopathol 2010;158:487–95. Papayiannis LC, Harkou IS, Markou YM, Demetriou CN, Katis ΝΙ. Rapid discrimination of Tomato chlorosis virus, Tomato infectious chlorosis virus and co-amplification of plant internal control using real-time RT-PCR. J Virol Methods 2011;176:53–9. Pappu HR, Csinos AS, McPherson RM, Jones DC, Stepherson MG. Effect of acibenzolar-S-methyl and imidacloprid on suppression of Tomato spotted wilt tospovirus in flue-cured tobacco. Crop Prot 2000;19:349–54. Peremyslov VV, Andreev IA, Prokhnevsky AI, Duncan GH, Taliansky ME, Dolja VV. Complex molecular architecture of Beet yellows virus particles. Proc Natl Acad Sci U S A 2004a;101:5030–5. Peremyslov VV, Pan YW, Dolja VV. Movement protein of a closterovirus is a type III integral transmembrane protein localized to the endoplasmic reticulum. J Virol 2004b;78:3704–9. Poudel B, Sabanadzovic S, Bujarski J, Tzanetakis IE. Population structure of Blackberry yellow vein associated virus, an emerging crinivirus. Virus Res 2012;169:272–5. Poudel  B, Wintermantel  WM, Cortez  AA, Ho  T, Khadgi  A, Tzanetakis  IE. Epidemiology of Blackberry yellow vein associated virus. Plant Dis 2013;97:1352–7. Qiao W, Falk BW. Efficient protein expression and virus-induced gene silencing in plants using a crinivirus-derived vector. Viruses 2018;10:216. https://doi.org/10.3390/v10050216. Qiao Q, Zhang Z-C, Qin Y-H, Zhang D-S, Tian Y-T, Wang Y-J. First report of Sweet potato chlorotic stunt virus infecting sweet potato in China. Plant Dis 2011;95:356. Qiao W, Zarzynska-Nowak A, Nerva L, Kuo Y-W, Falk BW. Accumulation of 24 nucleotide transgene-derived siRNAs is associated with crinivirus immunity in transgenic plants. Mol Plant Pathol 2018;19:2236–47. Roditakis E, Grispou M, Morou E, Kristoffersen JB, Roditakis N, Nauen R, Vontas J, Tsagkarakou A. Current status of insecticide resistance in Q biotype Bemisia tabaci populations from Crete. Pest Manag Sci 2009;65:313–22. Rodríguez-López  MJ, Garzo  E, Bonani  JP, Fereres  A, Fernández-Muñoz  R, Moriones  E. Whitefly resistance traits derived from the wild tomato Solanum pimpinellifolium affect the preference and feeding behavior of Bemisia tabaci and reduce the spread of Tomato yellow leaf curl virus. Phytopathology 2011;101:1191–201. Rubio  L, Soong  J, Kao  J, Falk  BW. Geographic distribution and molecular variation of isolates of three whiteflyborne closteroviruses of cucurbits: Lettuce infectious yellows virus, Cucurbit yellow stunting disorder virus and Beet ­pseudo-yellows virus. Phytopathology 1999;89:707–11. Rubio L, Abou-Jawdah Y, Lin H-X, Falk BW. Geographically distant isolates of the crinivirus Cucurbit yellow stunting disorder virus show very low genetic diversity in the coat protein gene. J Gen Virol 2001;82:929–33.

References 287

Rubio L, Tian T, Yeh HH, Livieratos Y, Falk BW. De novo generation of Lettuce infectious yellows virus defective RNAs in protoplasts. Mol Plant Pathol 2002;3:321–7. Rubio L, Guerri J, Moreno P. Genetic variability and evolutionary dynamics of viruses of the family Closteroviridae. Front Microbiol 2013;4. https://doi.org/10.3389/fmicb.2013.00151. Ruiz ML, Simón A, García MC, Janssen D. First report of Lettuce chlorosis virus infecting bean in Spain. Plant Dis 2014;98:857. Ruiz L, Simon A, Garcia C, Velasco L, Janseen D. First natural crossover recombination between two distinct species of the family Closteroviridae leads to the emergence of a new disease. PLoS One 2018;13(9):e01982282018. Salazar LF, Muller G, Querci M, Zapata JL, Owens RA. Potato yellow vein virus: its host range, distribution in South America, and identification as a crinivirus transmitted by Trialeurodes vaporariorum. Ann Appl Biol 2000;137:7–19. Salem NM, Chen AYS, Tzanetakis IE, Mongkolsiriwattana C, Ng JCK. Further complexity of the genus Crinivirus revealed by the complete genome sequence of Lettuce chlorosis virus (LCV) and the similar temporal accumulation of LCV genomic RNAs 1 and 2. Virology 2009;390:45–55. Satyanarayana T, Gowda S, Ayllon MA, Dawson WO. Closterovirus bipolar virion: evidence for initiation of assembly by minor coat protein and its restriction to the genomic RNA 5′ region. Proc Natl Acad Sci U S A 2004;101:799–804. Schaefers GA, Terry ER. Insect transmission of sweet potato disease agents in Nigeria. Phytopathology 1976;66:642–5. Segundo  E, Martın  G, Cuadrado  IM, Janssen  D. A new yellowing disease in Phaseolus vulgaris associated with a whitefly-transmitted virus. Plant Pathol 2004;53:517. Segundo E, Carmona MP, Saez E, Velasco L, Martın G, Ruiz L, Janssen D, Cuadrado IM. Occurrence and incidence of viruses infecting green beans in south-eastern Spain. Eur J Plant Pathol 2008;122:579–91. Shakeel  MT, Al-Saleh  MA, Amer  MA, Al-Shahwan  IM, Umar  M, Abdalla  OA, Zakri  MA, Katis  NI. Transmission of Cucurbit chlorotic yellows virus (CCYV) by whitefly biotype B in Riyadh, Saudi Arabia. Int J Agric Biol Eng 2018;20:241–8. Shi Y, Shi Y, Gu Q, Yan F, Sun X, Li H, Chen L, Sun B, Wang Z. Infectious clones of the crinivirus Cucurbit chlorotic yellows virus are competent for plant systemic infection and vector transmission. J Gen Virol 2016;97:1458–61. Shi X, Tang X, Zhang X, Zhang D, Li F, Yan F, Zhang Y, Zhou X, Liu Y. Transmission efficiency, preference and behavior of Bemisia tabaci MEAM1 and MED under the influence of Tomato chlorosis virus. Front Plant Sci 2018;8:2271. https://doi.org/10.3389/fpls.2017.02271. Sim J, Valverde RA, Clark CA. Whitefly transmission of Sweet potato chlorotic stunt virus. Plant Dis 2000;84:1250. Simmons AM, Levi A. Sources of whitefly (Homoptera: Aleyrodidae) resistance in Citrullus for the improvement of cultivated watermelon. Hortic Sci 2002a;37:581–4. Simmons  AM, Levi  A. Evaluation of watermelon germplasm for resistance to Bemisia. In: Marynard  DN, editor. Cucurbitaceae. Alexandria, VA: American Society of Horticultural Science; 2002b. p. 282–6. Simmons  AM, Kousik  CS, Levi  A. Combining reflective mulch and host resistance for sweetpotato whitefly (Hemiptera: Aleyrodidae) management in watermelon. Crop Prot 2010;29:898–902. Simone GW, Hochmuth RC, Wisler GC, Duffus JE, Liu H-Y, Li RH. A new whitefly-vectored closterovirus of tomato in Florida. In: Vavrina CS, editor. Tomato Institute proceedings. Gainesville, FL: Hart Science Department, IFAS, University of Florida; 1996. p. 71–4. Sinclair  JW. Screening for resistance to Cucurbit yellow stunting disorder virus, gummy stem blight, and monosporascus root rot and detection of RAPD markers associated with QLT for soluble solids, sugars, and vitamin C in melon (Cucumis melo l.) [PhD diss.]. College Station, TX: Dept. Hort. Sci., Texas A&M Univ.; 2003. Smith-Becker  J, Keen  NT, Becker  JO. Acibenzolar-S-methyl induces resistance to Colletotrichum lagenarium and Cucumber mosaic virus in cantaloupe. Crop Prot 2003;22:769–74. Solórzano-Morales A, Barboza N, Hernández E, Mora-Umaña F, Ramírez P, Hammond RW. Newly discovered natural hosts of Tomato chlorosis virus in Costa Rica. Plant Dis 2011;95:497. Steel E, Barker I, Danks C, Coates D, Boonham N. A. tumefaciens-mediated transient expression as a tool for antigen production for Cucurbit yellow stunting disorder virus. J Virol Methods 2010;163:222–8. Stewart LR, Medina V, Tian T, Turina M, Falk BW, Ng JCK. A mutation in the Lettuce infectious yellows virus minor coat protein disrupts whitefly transmission but not in planta systemic movement. J Virol 2010;84:12165–73. Sun XH, Gao LL, Wang SL, Zhao J, Qiao N, Zhou XP. Natural occurrence of Tomato chlorosis virus in pumpkin in China. Plant Dis 2016;100:2543. Susaimuthu  J, Gergerich  RC, Bray  MM, Clay  KA, Clark  JR, Tzanetakis  IE, Martin  RR. Incidence and ecology of Blackberry yellow vein associated virus. Plant Dis 2007;91:809–13.

288

12.  Criniviruses infecting vegetable crops

Susaimuthu  J, Tzanetakis  IE, Gergerich  RC, Kim  KS, Martin  RR. Viral interactions lead to decline of blackberry plants. Plant Dis 2008;92:1288–92. Takeshita M, Okuda M, Okuda S, Hyodo A, Hamano K, Furuya N, Tsuchiya K. Induction of antiviral responses by acibenzolar-S-methyl against Cucurbit chlorotic yellows virus in melon. Phytopathology 2013;103:960–5. Tian T, Rubio L, Yeh HH, Crawford B, Falk BW. Lettuce infectious yellows virus: in vitro acquisition analysis using partially purified virions and the whitefly Bemisia tabaci. J Gen Virol 1999;80:1111–7. Tian X, Tian Y, Yu YQ, Wang XF, Li ZA, Li RH, Cao MJ, Zhou CY. Periwinkle: a new natural host of Lettuce chlorosis virus in China. Plant Dis 2018;102:462. Tomassoli  L, Lumia  V, Siddu  GF, Barba  M. Yellowing disease of melon in Sardinia (Italy) caused by Beet pseudo-­ yellows virus. J Plant Pathol 2003;85:59–61. Trenado HP, Fortes AM, Louro D, Navas-Castillo J. Physalis ixocarpa and P. peruviana, new natural hosts of Tomato chlorosis virus. Eur J Plant Pathol 2007a;118:193–6. Trenado HP, Lozano G, Valverde RA, Navas-Castillo J. First report of Sweet potato virus G and Sweet potato virus 2 infecting sweet potato in Spain. Plant Dis 2007b;91:1687. Tsai WS, Shih SL, Green SK, Hanson P. First report of the occurrence of Tomato infectious chlorosis virus in Taiwan. Plant Dis 2004;88:311. Tugume  AK, Mukasa  SB, Valkonen  JPT. Mixed infections of four viruses, the incidence and phylogenetic relationships of Sweet potato chlorotic fleck virus (Betaflexiviridae) isolates in wild species and sweetpotatoes in Uganda and evidence of distinct isolates in East Africa. PLoS One 2017; https://doi.org/10.1371/journal. pone.0167769. Tzanetakis IE, Martin RR. Complete nucleotide sequence of a strawberry isolate of Beet pseudo-yellows virus. Virus Genes 2004;28:239–46. Tzanetakis IE, Wintermantel WM, Martin RR. First report of Beet pseudo-yellows virus in strawberry in the United States: a second crinivirus able to cause pallidosis disease. Plant Dis 2003;87:1398. Tzanetakis IE, Wintermantel WM, Cortez AA, Barnes JE, Barrett SM, Bolda MP, Martin RR. Epidemiology of Strawberry pallidosis-associated virus and occurrence of pallidosis disease in North America. Plant Dis 2006;90:1343–6. Tzanetakis  IE, Wintermantel  WM, Poudel  B, Zhou  J. Diodia vein chlorosis virus is a group-1 crinivirus. Arch Virol 2011;156:2033–7. Tzanetakis IE, Martin RR, Wintermantel WM. Epidemiology of criniviruses: an emerging problem in world agriculture. Front Microbiol 2013;4:119. https://doi.org/10.3389/fmicb.2013.00119. Vaira AM, Accotto GP, Vecchiati M, Bragaloni M. Tomato infectious chlorosis virus causes leaf yellowing and reddening of tomato in Italy. Phytoparasitica 2002;30:290–4. van Dorst HJM, Huijberts N, Bos L. Yellows of glasshouse vegetables, transmitted by Trialeurodes vaporariorum. Neth J Plant Pathol 1983;89:171–84. Velasco  L, Simón  B, Janssen  D, Cenis  JL. Incidences and progression of Tomato chlorosis virus disease and Tomato yellow leaf curl virus disease in tomato under different greenhouse covers in southeast Spain. Ann Appl Biol 2008;153:335–44. Verhoeven JTJ, Willemen TM, Roenhorst JW, van der Vlugt RAA. First report of Tomato infectious chlorosis virus in tomato in Indonesia. Plant Dis 2003;87:872. Wang J, Turina M, Medina V, Falk BW. Synergistic interaction between the Potyvirus, Turnip mosaic virus and thecrinivirus, Lettuce infectious yellows virus in plants and protoplasts. Virus Res 2009a;144:163–70. Wang J, Turina M, Stewart LR, Lindbo JA, Falk BW. Agroinoculation of the crinivirus, Lettuce infectious yellows virus, for systemic plant infection. Virology 2009b;392:131–6. Wang Z, Gu Q, Sun H, Li H, Sun B, Liang X, Yuan Y, Liu R, Shi Y. One-step reverse transcription loop mediated isothermal amplification assay for sensitive and rapid detection of Cucurbit chlorotic yellows virus. J Virol Methods 2014;195:63–6. Wang XY, Feng J, Zang LY, Yan YL, Yang YY, Zhu XP. Natural occurrence of Tomato chlorosis virus in cowpea (Vigna unguiculata) in China. Plant Dis 2018;102:254. Webster CG, Kousik CS, Roberts PD, Rosskopf EN, Turechek WW, Adkins S. Cucurbit yellow stunting disorder virus detected in pigweed in Florida. Plant Dis 2011;95:360. Winter S, Purac A, Leggett F, Frison EA, Rossel HW, Hamilton RI. Partial characterization and molecular cloning of a closterovirus from sweet potato infected with sweet potato virus disease complex from Nigeria. Phytopathology 1992;82:869–75.

References 289

Wintermantel WM. Emergence of greenhouse whitefly (Trialeurodes vaporariorum) transmitted criniviruses as threats to vegetable and fruit production in North America. APSnet Plant Pathology; 2004, http://www.apsnet.org/ online/feature/whitefly/. Wintermantel WM. Semi-persistent whitefly-transmitted viruses: crinivirus. In: Brown JK, editor. Vector-mediated transmission of plant pathogens. St. Paul, MN: APS Press; 2016. p. 111–9. Wintermantel  WM, Hladky  LL. Methods for detection and differentiation of existing and new crinivirus species through multiplex and degenerate primer RT-PCR. J Virol Methods 2010;170:106–14. Wintermantel WM, Wisler GC. Vector specificity, host range and genetic diversity of Tomato chlorosis virus. Plant Dis 2006;90:814–9. Wintermantel  WM, Cortez  AC, Anchieta  AG, Gulati-Sakhuja  A, Hladky  LL. Co-infection by two criniviruses alters accumulation of each virus in a host-specific manner and influences efficiency of virus transmission. Phytopathology 2008;98:1340–5. Wintermantel WM, Hladky LL, Gulati-Sakhuja A, Li R, Liu H-Y, Tzanetakis IE. The complete nucleotide sequence and genome organization of Tomato infectious chlorosis virus: a distinct crinivirus most closely related to Lettuce infectious yellows virus. Arch Virol 2009a;154:1335–41. Wintermantel WM, Hladky LL, Cortez AA, Natwick ET. A new expanded host range of Cucurbit yellow stunting disorder virus includes three agricultural crops. Plant Dis 2009b;93:685–90. Wintermantel  WM, Gilbertson  RL, McCreight  JD, Natwick  ET. Host-specific relationship between virus titer and whitefly transmission of Cucurbit yellow stunting disorder virus. Plant Dis 2016;100:92–8. Wintermantel WM, Gilbertson RL, Natwick ET, McCreight JD. Emergence and epidemiology of Cucurbit yellow stunting disorder virus in the American Desert Southwest, and development of host plant resistance in melon. Virus Res 2017;241:213–9. Wintermantel WM, Jenkins Hladky LL, Fashing P, Ando K, McCreight JD. First report of cucurbit chlorotic Yellows Virus infecting melon in the new world. Plant Dis 2019;103:778. Wisler GC, Duffus JE. Transmission properties of whitefly-borne criniviruses and their impact on virus epidemiology. In: Harris KF, Smith OP, Duffus JE, editors. Virus-insect-plant interactions. San Diego, CA: Academic Press; 2001. p. 293–308. Wisler GC, Duffus JE, Liu H-Y, Li RH, Simone GW, Hochmuth RC. A new whitefly transmitted virus infecting tomato from Florida [Abstr.]. Phytopathology 1996;86:S71–2. Wisler GC, Duffus JE, Liu HY, Li RH. Ecology and epidemiology of whitefly-transmitted closteroviruses. Plant Dis 1998a;82:270–80. Wisler GC, Li RH, Liu HY, Lowry DS, Duffus JE. Tomato chlorosis virus: a new whitefly-transmitted, phloem-limited, bipartite closterovirus of tomato. Phytopathology 1998b;88:402–9. Zeng R, Dai FM, Chen WJ, Lu JP. First report of Cucurbit chlorotic yellows virus infecting melon in China. Plant Dis 2011;95:354. Zhang LM, Wang QM, Ma DF, Wang Y. Major viruses and effect of major virus diseases and virus-eliminating meristem culture on sweet potato yield and quality in China. Acta Botan Boreali-Occiden Sin 2005;25:316–20. Zhang SB, Zhang DY, Liu Y, Luo XW, Liu MY, Du J, Wang MC. First report of Lettuce chlorosis virus infecting tomato in China. Plant Dis 2017;101:846. Zhao RN, Wang R, Wang N, Fan ZF, Zhou T, Shi YC, Chai M. First report of Tomato chlorosis virus in China. Plant Dis 2013;97:1123. Zhao LM, Li G, Gao Y, Zhu YR, Liu J, Zhu XP. Reverse transcription loop-mediated isothermal amplification assay for detecting Tomato chlorosis virus. J Virol Methods 2015;213:93–7. Zhao X, Zhu M, Wu Q, Zhang J, Xu Y, Tao X. Complete genome sequence of a Lettuce chlorosis virus isolate from China and genome recombination/rearrangement analysis. Arch Virol 2018;163:751–4. Zhou Y, Yan JY, Qiao GH, Liu M, Zhang W, Li XH. First report of Tomato chlorosis virus infecting eggplant (Solanum melongena) in China. Plant Dis 2015;99:1657.