CRISPR Diagnosis and Therapeutics with Single Base Pair Precision

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

Review

CRISPR Diagnosis and Therapeutics with Single Base Pair Precision Seung Hwan Lee,1,* Young-Ho Park,2 Yeung Bae Jin,1 Sun-Uk Kim,2,3 and Junho K. Hur4,5,* Clustered regularly interspaced short palindromic repeats, or CRISPR, has been widely accepted as a versatile genome editing tool with significant potential for medical application. Reliable allele specificity is one of the most critical elements for successful application of this technology to develop high-precision therapeutics and diagnostics. CRISPR-based genome editing tools achieve high-fidelity distinction of single-base differences in target genomic loci by structural identification of CRISPR-associated (Cas) proteins and sequences of the guide RNAs. In this review, we describe the structural features of ribonucleoprotein complex formation by CRISPR proteins and guide RNAs that eventually recognize target DNA sequences. This structural understanding provides the basis for the recent applications of enhanced single-base precision genome editing technologies for effective distinction of specific alleles.

CRISPR-Cas System and Target Specificity Clustered regularly interspaced short palindromic repeats (CRISPR) systems function as immune defense systems in bacteria and archaea that cleave previously identified nucleic acids from foreign viruses using CRISPR-associated (Cas) effector proteins [1–3]. Recognition of the cleavage site is specified by protospacer (see Glossary) sequences present within the CRISPR systems of the bacterial genomes, which are derived from the DNA fragments obtained from viruses that have previously infected the prokaryotes. The protospacer sequence information is used to generate guide RNAs that detect and destroy the DNA from the same viruses during subsequent infections. Hence, these DNA sequences play a key role in the antiviral defense system in prokaryotes. The CRISPR systems harness ingenious means to distinguish between the invading viral DNA from the host genome. Two important self-discriminating features of the CRISPR-Cas system are base complementarity of the target DNA sequences with guide RNAs and short characteristic DNA sequences called protospacer adjacent motifs (PAM), present near the target DNA sequence [2]. Target DNA flexibility is primarily achieved by changing the guide RNA sequences. The facile reprogrammability of CRISPR systems has been widely utilized in biomedical applications for editing the loci of interest [4,5]. Medical applications of CRISPR include screening potential target sites for cancer therapeutics [6], understanding the regulatory network of immune cells [7], and developing gene therapy agents [8–10] (see Clinician’s Corner). These medical applications require both versatility and stringent precision for biological safety. Accordingly, studies have investigated the potential erroneous genome editing issues, called off-target effects of the CRISPR systems [11]. CRISPR genome editing precision is governed by effector guide RNA length (20–30 bp) and the number of genomic loci with DNA sequences that are identical or similar to the guide RNA sequences [12]. Considering the size of the human genome, both computational prediction and experimental validation indicate that CRISPR-based human genome editing is prone to several off-target DNA breaks, resulting in unexpected genomic mutations [13–15]. Hence, researchers have been aiming to improve the precision of the CRISPR system. Enhancing CRISPR specificity is closely linked to understanding the biochemical and structural characteristics that regulate target binding and DNA cleavage. In this review, we describe the structural features of CRISPR-Cas9 and CRISPR-Cas12a, the most widely used genome engineering molecular scissors to date. Next, we discuss how target specificity is determined by biochemical interactions between CRISPR proteins, guide RNAs, and target DNA. Furthermore, we explain how enhancement in CRISPR genome engineering enables discrimination of single-base level genomic variations.

Trends in Molecular Medicine, --, Vol. --, No. --

Highlights CRISPR-based genome editing at specific genomic locations is prone to mistargeting other genomic loci with similar DNA sequences. Hence, allele-specific targeting with single base pair precision has become one of the most critical issues of developing CRISPR-based diagnostics and therapeutics for disorders such as genetic diseases and cancer. Understanding the structures of CRISPR proteins in complex with the guide RNAs and the target DNAs facilitated the development of novel methods to distinguish single-base differences. CRISPR technologies are being further enhanced by guide RNA modifications, protein engineering, and the discovery of new CRISPR systems. The advancements in CRISPR enables precise therapeutic targeting of various pathogenic mutations, also high-fidelity diagnostics for detecting low-frequency mutations with single-base precision.

1National Primate Research Center (NPRC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), Cheongju 28116, Republic of Korea 2Futuristic Animal Resource & Research Center, Korea Research Institute of Bioscience and Biotechnology, Cheongju 28116, Republic of Korea 3Department of Functional Genomics, University of Science and Technology, Daejeon 34113, Republic of Korea 4Department of Pathology, College of Medicine, Kyung Hee University, Seoul 02447, Republic of Korea 5Department of Biomedical Science, Graduate School, Kyung Hee University, Seoul 02447, Republic of Korea

*Correspondence: [email protected], [email protected]

https://doi.org/10.1016/j.molmed.2019.09.008 ª 2019 Elsevier Ltd. All rights reserved.

1

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

Structure of the CRISPR-Cas9-Guide RNA Complex and Target DNA Specificity The CRISPR-Cas9 system has been extensively studied as a programmable genome engineering effector since the demonstration of its mechanism of action in 2012 [2]. CRISPR-Cas9 functions as a ribonucleoprotein complex with a guide RNA bound to a single CRISPR-Cas9 protein, consisting of the recognition (REC) and nuclease (NUC) lobes (Figure 1A) [16]. This bi-lobed protein recognizes a single-stranded guide RNA, forms a stable DNA:RNA heteroduplex (R-loop) with the target DNA by Watson–Crick base pairing, and induces site-specific double-stranded DNA cleavage [17–20] (Figure 1B). The negatively charged single-guide RNA heteroduplex and the target DNA strand are recognized by positively charged amino acids present between the two lobes of CRISPR-Cas9 protein [17]. The structure of the complete ternary CRISPR-Cas9 complex showed that the target sequence portion of the guide RNA 5ʹ region interacts with the protein via the phosphate backbone, regardless of the nucleotide sequence. The structure also demonstrated that the 3ʹ region of the guide RNA and the trans-activating CRISPR RNA (tracrRNA) region, including the repeat/anti-repeat duplex, form pseudoknot-type sequence-specific structures and bind to CRISPR-Cas9 protein. The structural analyses revealed the critical determinants of CRISPR-mediated DNA cleavage that can be harnessed to improve the precision of genome editing. The PAM sequence in the target DNA is one of the most discriminating factors for target DNA recognition [21–25]. The PAM region, which is generally guanine-rich and is NGG in case of Streptococcus pyogenes Cas9 (SpCas9), does not form a duplex with the guide RNA. Instead, CRISPRCas9 protein directly recognizes and binds to the DNA duplex of PAM sequence via interactions between the specific amino acids in the PAM-interacting (PI) domain [17]. In case of SpCas9, two arginine residues, R1333 and R1335, and a lysine residue, K1107, lock in the phosphate loop region of the PI domain and interact with the sugar-phosphate backbones of the guanine bases in the PAM (position –2 and –3, Figure 1B). In addition, a serine residue, S1109, in the phosphate lock loop and two nitrogen atoms in the backbone of phosphate lock loop interact with the phosphate at +1 position of PAM. The protein–DNA interaction induces a stable architecture and flips the first base of the target strand towards the guide RNA, initiating the hybridization of the target DNA and guide RNA. Within the guide RNA:target DNA duplex, CRISPR-Cas9 is particularly sensitive to base pair mismatches in the PAM-proximal segment, also referred to as the ‘seed region’. For widely utilized CRISPR-Cas9, SpCas9, the seed region includes 10 PAM-proximal bases (position 1–10, Figure 1B). The nucleotides in the seed region are recognized by Cas9 protein via the arginine residues in the bridge helix and the REC-1 domains within the REC lobe. This seed region serves as a sensitive element for precise recognition and cleavage of the 20-nucleotide DNA sequence within the target genomic locus [11,26]. Accordingly, base pairing mismatches within the seed region between the target DNA strands and guide RNAs could negatively impact the cleavage efficiency. However, the target DNA sequences within the distal region from PAM show relatively more tolerance to mismatches. Structurally, the distal region is in a more flexible base pairing state than the relatively rigid DNA:RNA duplex near the PAM [17].

CRISPR-Cas12a: Structure of Cas12a/Cpf1 and Its Target DNA Specificity A distinct type of CRISPR genome editing molecule, CRISPR-Cas12a (Cpf1), was discovered in 2015 [27]. The target binding and cleavage mechanism of the CRISPR-Cas12a ribonucleoprotein complex has also been investigated (Figure 1C) [28–31]. Similar to Cas9, Cas12a is bi-lobed and the structure of the ternary complex that consists of guide RNA-target DNA-Cas12a protein showed different protein–nucleic acid interactions when compared with Cas9 (Figure 1D) [29]. The guide RNA contains a direct repeat sequence in the 5ʹ region that forms a 3D pseudoknot structure, wherein the specific RNA nucleotides interact with the corresponding amino acids within the wedge (WED) and RuvC nuclease domain of Cas12a. The DNA:RNA heteroduplex interacts with amino acids within the REC-WED domain in a sequence-independent manner. Despite the structural differences, the target recognition Cas12a is also determined by the PAM sequence and the base-paring between guide RNA and target DNA.

2

Trends in Molecular Medicine, --, Vol. --, No. --

Glossary Allele-specific: specifying one of the two alleles, within the bi-allelic human genome system, when the sequences of the paired alleles differ from each other, often caused by single nucleotide polymorphisms (SNPs). CRISPR effector: the protein– RNA complex involved in the interference process of CRISPR immunity. The complexes are generally composed of guide RNA and protein components and have nucleic acid cleavage activity. DNA genotyping: the process of determining the differences in the genetic make-ups (genotype) of individuals by examining their DNA sequences. The DNA sequences are compared between individuals or with respect to the reference sequences. Guide RNA: the RNA element in CRISPR ribonucleoprotein complex that specifies recognition and cleavage of invading foreign DNA and RNA via base matches via base complementarity. Off-target: the mistargeting of genomic loci with sequences different from the genuine targets of interest. This unwanted targeting events can occur when CRISPR effector molecules tolerate the base pair mismatches between the guide RNA and the target DNA. Protospacer: the part of the viral DNA sequence that is incorporated to the bacterial CRISPR locus for adaptive immunity. Based on the protospacer, complement guide RNA transcription is processed by bacterial CRISPR machinery. Protospacer adjacent motif (PAM): to recognize the sequences of target DNAs, CRISPR systems require the presence of a specific sequence, called the protospacer adjacent motif (PAM), next to the protospacer. The specific sequences of PAM vary depending on the bacterial species that contained the different CRISPR systems. For example, the PAM of CRISPRCas9 from Streptococcus pyogenes (SpCas9) is guanine-rich ‘NGG’ and CRISPR-Cas12a from Acidaminococcus recognizes thymine-rich motif ‘TTTN’ for PAM.

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

(A)

1

60

94

180

718

775

REC lobe

1099

1368

NUC lobe

Guide RNA: target DNA heteroduplex Non-target strand 5′

10 9

8

7

6

5

4

Repeat:anti-repeat RNA duplex 3

2

1

Anti-repeat

-1 -2 -3

3′

Target strand 3′

909

SpCas9 NUC lobe

(B)

308

PAM

20 19 18 17 16 15 14 13 12 11 10 9

8

7

6

5

4

3

2

1

20 19 18 17 16 15 14 13 12 11 10 9

8

7

6

5

4

3

2

1

N

G

G

N

C

C

-1

-2 -3

5′

Repeat

Tetraloop

Stem loop 1

S1109, K1107

Stem loop 2

5′ Guide RNA

Seed region

Stem loop 3

(C) AsCas12a NUC lobe

(D)

REC lobe

NUC lobe

Non-target strand 5′ PAM 3′

3′

T

T

T

A

A

A N

Repeat/anti-repeat duplex: part of the guide RNA strand that complements the direct repeat sequence of the bacterial CRISPR locus. RuvC: an endonuclease domain that cuts single-strand DNA and is named after an Escherichia coli RuvC protein involved in DNA repair. Seed region: subregion of target DNA where CRISPR systems are highly sensitive for base pair mismatches between the guide RNA and the target DNA, within the protospacer sequence. Sensitivity: the magnitude of how CRISPR systems tolerate base pair mismatches. High sensitivity for mismatch induces low off-target issues, while low sensitivity can result in many off-target events.

Guide RNA: target DNA heteroduplex

N

Target strand 5′

-4 -3 -2 -1 K548, K607

3′ Guide RNA 5′ K943, Y940, D966

Recognition 1 (REC1) domain Recognition 2 (REC2) domain

Wedge (WED) domain

Bridge helix (BH) domain

Repeat:anti-repeat RNA duplex Trends in Molecular Medicine

Figure 1. Schematics of the Interactions between Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Protein, Guide RNA, and Target DNA. (A) CRISPR-Streptococcus pyogenes CRISPR-associated 9 (SpCas9) protein is composed of a recognition (REC) lobe and nuclease (NUC) lobe. NUC contains protospacer adjacent motif (PAM) interaction (PI) domain and two nuclease domains, RuvC and HNH. (B) CRISPR-SpCas9 protein in complex with the heteroduplex formed by the single-guide RNA (blue) and target DNA (target strand, red; non-target strand, brown). The guanine-rich PAM region (yellow box) and the guide RNA stem-loop structures (green and orange) are located in the 3ʹ side of the single-guide RNA. Two arginine residues, 1333 and 1335, and a lysine residue, 1107, interact with the guaninerich PAM region. A serine residue, 1109, interacts with the phosphate at position 1 to facilitate hybridization of guide RNA and target DNA [17]. (C) CRISPR- Acidaminococcus Cas12a (AsCas12a) also consists of REC and NUC lobes but lacks the HNH nuclease domain. (D) CRISPR-AsCas12a protein in complex with guide RNA and target DNA heteroduplex. Unlike CRISPR-Cas9, the thymine-rich PAM and the guide RNA stem-loop structures are located at the 5ʹ side of the guide RNA. The PAM region is recognized by lysine residues 548 and 607. The base of position 1 of the target strand is rotated out from the canonical duplex position via interacting with a lysine residue 780 and a glycine residue 783 [29]. (Numbers of nucleic acids indicate their positions with respect to PAM, the inset shows the contact residues at the interface of protein–DNA/RNA interaction.)

PAM sequence is also important for CRISPR-Cas12a to recognize and bind target DNA, but unlike for Cas9, the PAM sequence is present at the 5ʹ end of the target DNA [27,32]. Cas12a recognizes and binds PAM duplex by means of WED-REC1-PI domains via interactions with the base sequences

Trends in Molecular Medicine, --, Vol. --, No. --

3

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

and the PAM duplex. While the RNA–DNA hybridization is generally efficient, the first base of the target sequence immediately following the PAM duplex is kinked from the canonical duplex by interaction with specific amino acids in Cas12a [Lys780 and Gly783 in case of Cas12a from Acidaminococcus (AsCas12a)] [29]. Within the RNA:DNA heteroduplex, the PAM distal region is recognized by the REC1-REC2 domains and the PAM proximal region is recognized by the REC1-RuvC-WED domains (Figure 1C,D) [29,30]. CRISPR-Cas12a also has protein–nucleic acid interactions in the seed region within the DNA:RNA heteroduplex that are sensitive to base pair mismatches (Figure 1D) [28,29]. Notably, the last four bases of the guide RNA, towards the 3’ end of the 24-nucleotide target sequence, fail to form a heteroduplex with target DNA due to the separating action of a tryptophan residue, W382 in AsCas12a and W355 in Lachnospiraceae bacterium Cas12a (LbCas12a). It is known that this protein–nucleic acid interaction of CRISPR-Cas12a plays an important role in target DNA cleavage.

Off-Target Issues and Solutions Based on CRISPR Structure Several studies have reported the issues of nonspecific targeting in CRISPR applications for genome editing at the DNA or RNA level [11,33–36]. Particularly, significant unpredicted large deletions due to off-target cleavage have been reported [37,38]. Among the various factors that regulate off-target issues, one of the most important determinants is the degree of base mismatch between the target DNA sequences and the guide RNA in the CRISPR ribonucleoprotein complexes [11,34]. CRISPR genome engineering effectors preferably select the target DNA with base sequences that perfectly match the guide RNAs. However, in some cases, CRISPR mistakenly recognizes off-target DNAs that contain sequences that are similar, but with mismatches, compared with that of the target DNA. Off-target analyses of CRISPR-Cas9 reflect the structural basis of DNA target recognition by the CRISPR-Cas9 protein and guide RNA ribonucleoprotein complex [14,15,39]. Studies report that complete or partially complimentary DNA sequences result in a significant potential for off-target recognition by the guide RNAs, especially if the mismatched base pairs are in the 5’ PAM distal region of the guide RNA [11,40]. Enhanced sensitivity was found in the seed region, although the sensitive mismatch positions varied slightly depending on the target locus [11]. Higher specificity for discriminating base mismatches within the 3’ seed regions of the guide RNA was universally found in various Cas9 target DNA sequences. Off-target effects of the more recently discovered CRISPR-Cas12a have also been assessed, based on the observation that the target recognition mechanism of Cas12a is fundamentally similar to that of Cas9, with some distinct features [41,42]. The studies on off-target analyses have showed that, for Cas12a, the seed region is comprised of PAM-proximal nucleotides up to 19 bases (position 1–19, Figure 1D). Notably, the studies suggested that the off-target cleavage events by Cas12a are less frequent than that of Cas9, suggesting that Cas12a could be a utilized as a high-precision genome editing tool. Methods have been developed to reduce these off-target issues by modifying the guide RNAs and CRISPR proteins [43,44]. Modification of guide RNAs, by using a truncated guide RNA [45] or by attaching an extra guanine to the 5’ end [12] improved mismatch discrimination of CRISPR effectors. DNA–RNA chimeric guides, instead of the conventional guide RNAs, also increased the specificity of CRISPR to distinguish even single-base mismatches in the RNA:DNA duplex region [46]. Some studies demonstrate that, in addition to guide RNA modifications, engineering the CRISPR effector proteins could increase target specificity [47,48]. These studies also showed that high-specificity Cas9 proteins, e-Cas9 [47] and HF-Cas9 [48], could be generated via altering select amino acids within the DNA recognition domain and therefore modulating the protein–DNA interactions.

High-Precision CRISPR-Mediated Nucleic Acid Targeting Several CRISPR techniques have been utilized to distinguish single nucleotide differences. Particularly important is the CRISPR-based selective targeting of pathogenic alleles by distinguishing

4

Trends in Molecular Medicine, --, Vol. --, No. --

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

single-base mutations. Recent studies have demonstrated the application of CRISPR for developing diagnostics and therapeutics.

DNA Genotyping Utilizing CRISPR for allele-specific genotyping could provide enhanced precision compared with prior enzymatic methods used to detect DNA sequences or alleles of interest [40,49,50]. CRISPRCas9-based technique was utilized for an easy and precise DNA genotyping method with enhanced sensitivity and applicability over the conventional T7 endonuclease I (T7E1) technique (Figure 2) [51]. The DNA genotyping method could be applied to detect and analyze genetic mutations, generated by CRISPR-Cas9 editing in cell lines. While several mono-allelic and bi-allelic mutations are not distinguishable by the T7E1 method, CRISPR-Cas9-based target DNA cleavage by a wild type specific guide RNA allowed the detection of various mutations within the PAM (NGG) sequence of target DNA. Specifically, utilizing Cas9 with wild type-specific guide RNAs (Table 1, guide RNA1) enabled the genotyping of various indel mutation patterns, such as in C4BPB, by specific cleavage of wild type DNAs with high sensitivity. In addition to enhanced precision, CRISPR-Cas9 genotyping can also be applied to sequencing of genetically variable regions. For example, Human Leukocyte Antigen (HLA) genetic loci are known to have highly diverse sequences with numerous single nucleotide polymorphisms (SNPs). CRISPR genotyping overcomes the strong background ‘noise’ signal that hinders T7E1 genotyping to identify indel formation. Finally, the CRISPR-Cas9 guide RNAs can also be utilized to distinguish oncogenic alleles, produced by point mutations or indels, from wild type alleles. For example, designing guide RNAs to match the seed region to a mutation pattern of a 3bp deletion in CTNNB1 enabled sensitive detection of mutant alleles (Table 1, guide RNA2-1). Notably, introducing a deliberate mismatch sequence in the guide RNA corresponding to seed sequence of the RNA:DNA heteroduplex further increased the sensitivity of the system (Table 1,

CRISPR Wild type

T7E1 Mono-allelic mutation

Bi-allelic mutation (hetero)

Bi-allelic mutation (homo) T7E1 genotyping

CRISPR genotyping Trends in Molecular Medicine

Figure 2. Comparison of the DNA Genotyping Methods via T7E1 Endonuclease and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Effector. Left: the schematic view of the DNA cleavage patterns of T7E1 endonuclease. Both mono-allelic or bi-allelic hetero mutations are cleaved by T7E1 through recognizing the interstrand mismatches. Right: the schematic view of the DNA cleavage patterns of CRISPR effector. Only the double-strand DNA that contain wild type sequences are selectively cleaved by the CRISPR effector via specifically designed guide RNAs. Two different types of DNA mutations are shown in red and yellow. Green ovals indicate T7E1 endonuclease and yellow ovals with blue lines indicate CRISPR proteins in complex with guide RNAs.

Trends in Molecular Medicine, --, Vol. --, No. --

5

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

Mutation

DNA sequence

Refs a

Wild-type C4BPB

AATGACCACTACATCCTCAAGGGCAGCAATC

-12 del

AATGACCACTACATC---------------------- AATC

-9 del

AATGACCACTACAT---------------- CAGCAATC

-8 del

AATGACCACTACATCC----- --------- AGCAATC

+1 ins

AATGACCACTACATCCTaCAAGGGCAGCAATC

+3 ins

AATGACCACTACATCCTcctCAAGGGCAGCAATC

+67 ins

AATGACCACTACATCCT//67bp//CAAGGGCAGCAATC

Guide RNA 1

AATGACCACTACATCCTCAAGGGb

Wild-type CTNNB1

ACCACAGCTCCTTCTCTGAGTGG

c.133-135 del

ACCACAGCTCCT-----CTGAGTGG

Guide RNA 2-1

ACCACAGCTCCTTCTCTGAGTGG

Wild-type KRAS

GTAGTTGGAGCTGGTGGCGTAGG

c.34G>A

GTAGTTGGAGCTaGTGGCGTAGG

Guide RNA 2-2

GTAGTTGGAGCTAGCGGCGTAGG

Wild-type KRAS

AAACTTGTGGTAGTTGGAGCTGG

c.35G>A

AAACTTGTGGTAGTTGGAGCTGa

c.35G>T

AAACTTGTGGTAGTTGGAGCTGt

c.34G>T

AAACTTGTGGTAGTTGGAGCTtG

c.35G>C

AAACTTGTGGTAGTTGGAGCTGc

c.34G>C

AAACTTGTGGTAGTTGGAGCTcG

Guide RNA 3

AAACTTGTGGTAGTTGGAGCTGG

Wild-type GNAQ

TGCAGAATGGTCGATGTAGGGGGCCAA

c.626A>T

TGCAGAATGGTCGATGTAGGGGGCCtA

Guide RNA 4

TGCAGAATGGTCGATGTAGGGGGCCAA

Wild-type TGFBI

TCAGCTGTACACGGACCGCACGGAGGAGCTGAGGCCTGAG

Guide RNA 5

TCAGCTGTACACGGACTGCACGG (R124C)

Guide RNA 6

TCAGCTGTACACGGACCACACGG (R124H)

Guide RNA 7

TCAGCTGTACACGGACCTCACGG (R124L)

Guide RNA 8 Wild-type TGFBI Guide RNA 9 Guide RNA 10

[51]

[51]

[52,53]

[53]

[79]

TCACGGAGAAGCTGAGGCCTGAG (R124L) CTTCCGAGCCCTGCCACCAAGAGAACGGAGCAGACTCTT

[79]

CCAAGAGAACAGAGCAGACTCTT (R555Q) CCAAGAGAATGGAGCAGACTCTT (R555W)

Guide RNA 11

CTTCCGAGCCCUGCCACCAAGAGAAT (R555W)

Wild-type JAK2

ATTATGGAGTATGTGTCTGTGG

V617P (G>T)

ATTATGGAGTATGTtTCTGTGG

Guide RNA 12

ATTATGGAGTATGTTTCTGTGG

Wild-type AAT

TGCTGACCATCGACGAGAAAGGGAC

Z mutation

TGCTGACCATCGACaAGAAAGGGAC

Guide RNA 13

TGCTGACCATCGACAAGAAAGGGAC

Wild-type Rho

TCACAGGCGTGGTGCGGAGCCCCTTCGAGCAGCCGCAGT

P23H (C>A)

TCACAGGCGTGGTGCGGAGCCaCTTCGAGCAGCCGCAGT

Guide RNA 14

[51]

[80]

[80-82]

[83]

GTGCGGAGCCACTTCGAGCAGCCGCAGT

Guide RNA 15

GGCGTGGTGCGGAGCCACTTCGA

Guide RNA 16

GTGGTGCGGAGCCACTTCGA

Table 1. Design of CRISPR guide RNAs for targeting DNA with single base-pair precision. (Continued on next page)

6

Trends in Molecular Medicine, --, Vol. --, No. --

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

Mutation

DNA sequence

Refs

Wild-type KRAS

CTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCC

[64,91]

G12V (c.35G>T)

CTTGTGGTAGTTGGAGCTGtTGGCGTAGGCAAGAGTGCC

G12D (c.35G>A)

CTTGTGGTAGTTGGAGCTGaTGGCGTAGGCAAGAGTGCC

G13D (c.38G>A)

CTTGTGGTAGTTGGAGCTGGTGaCGTAGGCAAGAGTGCC

Guide RNA 17

CTTGTGGTAGTTGGAGCTGTTGG

Guide RNA 18

GTGGTAGTTGGAGCTGTTGG

Guide RNA 19 Guide RNA 20

GGTAGTTGGAGCTGTTGGCGTAG AGTTGGAGCTGTTGGCGTAG

Guide RNA 21

GTAGTTGGAGCTGTTGGCGTAGG

Guide RNA 22

GTTGGAGCTGTTGGCGTAGG

Guide RNA 23

CTGTTGGCGTAGGCAAGAGTGCC

Guide RNA 24

CTGTTGGCGTAGGCAAGAGT

Guide RNA 25

CTTGTGGTAGTTGGAGCTGATGG

Guide RNA 26

GTGGTAGTTGGAGCTGATGG

Guide RNA 27 Guide RNA 28

GGTAGTTGGAGCTGATGGCGTAG AGTTGGAGCTGATGGCGTAG

Guide RNA 29

GTAGTTGGAGCTGATGGCGTAGG

Guide RNA 30

GTTGGAGCTGATGGCGTAGG

Guide RNA 31 Guide RNA 32 Guide RNA 33 Guide RNA 34

CTGATGGCGTAGGCAAGAGTGCC CTGATGGCGTAGGCAAGAGT GTAGTTGGAGCTGGTGACGTAGG GTTGGAGCTGGTGACGTAGG

Guide RNA 35

GGTAGTTGGAGCTGGTGACGTAG

Guide RNA 36

AGTTGGAGCTGGTGACGTAG

Guide RNA 37

CTGGTGACGTAGGCAAGAGTGCC

Guide RNA 38

CTGGTGACGTAGGCAAGAGT

Wild-type EGFR

CAAGATCACAGATTTTGGGCTG

L858R (c.2573T>G)

CAAGATCACAGATTTTGGGCgG

Guide RNA 39

CAAGATCACAGATTTTGGGCGG

[92]

Table 1. Continued a Substitutions and deletions are shown in lowercase letters and minus signs b DNA sequences targeted by guide RNAs; PAMs are underlined and mismatches to wild-type sequences are indicated by bold letters.

guide RNA2-2). This allowed specific discrimination and cleavage of the oncogenic single-base mutant KRAS allele.

Detecting Low-Frequency Mutations in Small Amounts of Nucleic Acids Some studies have utilized CRISPR-mediated allele-specific targeting for high sensitivity detection of mutations in small amounts of mixed nucleic acids [52,53]. Extremely low-frequency mutant DNA could be enriched and detected by selectively removing wild type DNA from mixed samples (Figure 3) [53]. Oncogenic point mutations in genes such as KRAS and GNAQ, which are present at lower frequencies, could be detected by this method (Table 1). For specific recognition of single-base mutations in KRAS, CRISPR-SpCas9 was designed such that the wild type allele contains the PAM sequence and the point mutation resulted in the loss of PAM sequence (Table 1, guide RNA3). The CRISPR-based method selectively cleaved wild type DNA within a genetic mixture and the remaining mutant alleles were amplified by PCR. The enrichment process can be applied reiteratively and each round of amplification induced a 30–70-fold increase in mutant KRAS DNA that was otherwise present at 1/1000th of the frequency of the normal allele. Utilizing CRISPR-FnCas12a, with a ‘TTN’ PAM sequence [27,28], 30-fold enrichment was demonstrated for mutant DNA (c.626A>T) in GNAQ, which is enriched in many cancers (Table 1, guide RNA4) [53]. The method was also shown to detect early

Trends in Molecular Medicine, --, Vol. --, No. --

7

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

1. Specific cleavage of wild type alleles

2. Enrichment of mutant allele by PCR

3. Indexing & next generation sequencing

CRISPR

Wild type allele (cleaved)

Wild type (missed) Mutant allele

Trends in Molecular Medicine

Figure 3. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Based Method for Detecting Low-Frequency Mutations via Selective Enrichment of Mutant Alleles. For enriching the rare mutant alleles that are present within the background of abundant wild type alleles, the wild type alleles are specifically cleaved by the CRISPR effectors. Next, the uncleaved mutant alleles are preferentially enriched over the wild type alleles by PCR amplification. Finally, the enriched mutant alleles, in the amplified mixed pools, were analyzed by next generation sequencing. Mutant alleles are shown in green. Yellow ovals with blue lines indicate CRISPR proteins in complex with guide RNA and grey boxes indicate ligated adaptors for next generation sequencing.

oncogenic KRAS point mutations in cell-free DNA from colon cancer patient cohorts. CRISPRSpCas9-based iterative amplification revealed significant mutant DNA enrichment in cancer patients with KRAS point mutations (c.35G>A, c.35G>T, c.35G>C, c.34G>C) compared with the control groups. The amplification of oncogenic alleles by CRISPR, in conjunction with previously reported methods [54–57], could enhance the precision of early cancer diagnosis.

Developing Gene Therapy with Single-Base Precision Genomic studies have shown that many diseases are linked to mutations at DNA level [58–62]. In cancer, gain-of-function mutations in only one of two alleles in the human genome is often sufficient to induce pathogenicity by disrupting normal allele function [63,64]. Furthermore, the driver mutations in proto-oncogenes may promote acquisition of additional mutations in other genes and pose serious threats of cancer progression. CRISPR-based gene editing can be applied for precisely correcting the pathogenic alleles. For effective and safe medical applications, CRISPR-based gene therapy methods should specifically correct the pathogenic mutant alleles without altering the normal alleles or causing unexpected off-target effects. Here, we describe the recent advancements in CRISPR techniques for genome editing of pathogenic alleles with single-base precision.

Targeted Gene Editing for Genetic Diseases Allele-specific gene correction could be applied to diseases associated with gain-of-function mutations for alleviating the symptoms and ultimately improving the disease pathology [65–76]. Recent advancements in CRISPR engineering techniques allow pathogenic alleles to be accurately recovered or eliminated by positioning the mutation within the PAM or seed region. The precision of CRISPR targeting could be further increased by utilizing engineered high-fidelity CRISPR proteins [47,48] and modified guide RNAs [12,45]. Also, recent application of the base modifying enzyme module

8

Trends in Molecular Medicine, --, Vol. --, No. --

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

in conjunction with CRISPR system demonstrated that single bases of the target genomic loci could be edited, without cleavage of target DNA [77,78]. Delicate CRISPR effector design could discriminate between the pathogenic mutation alleles that differ from normal genes by single-base changes. CRISPR correction could be applied to several mutations in TGFBI that caused corneal dystrophy (Table 1, guide RNA 5–11) [79]. To this end, SpCas9, AsCpf1, and SaCas9 CRISPR ribonucleoprotein complexes were designed to locate the mutations in the PAM or seed region. As for the mutations in TGFBI, positioning the pathogenic mutations in the PAM sequence showed excellent allele specificity, while including the mutations within the seed region resulted in relatively lower specificity. Conversely, other studies demonstrated successful application of CRISPR to human-derived induced pluripotent stem cells and mouse models for targeting a V617F (G>T) mutation in JAK2 and a Z mutation (G>A) in alpha-1 antitrypsin (AAT), which are both linked to myeloproliferative neoplasms, by positioning singlebase mutations in the seed regions of the guide RNAs (Table 1, guide RNA 12–13) [80–82]. Notably, these mutant alleles could be precisely targeted without PAM targeting and the technology was effectively applied for cell therapy using patient-derived cells. For targeted eye disease therapy, CRISPR technology was applied for allele-specific removal of mutated DNA from retinitis pigmentosa mice (Rho-P23H; Table 1, guide RNA 14–16) [83]. The study demonstrated targeting of pathogenic mutations via non-canonical PAM sequence (NGA) recognition. To achieve this, a modified version of CRISPR-Cas9 (VRQR) [48] and a truncated form of guide RNA [45] were utilized to increase the sensitivity to distinguish between single-base mismatches and to maximize ‘NGA’ PAM recognition (Table 1, guide RNA 16). In mouse models, expression levels of mutant genes were decreased by more than 50% and the degeneration of photoreceptor cell was significantly delayed. Together, these studies suggested the possibility of developing CRISPR-based precise in vivo gene therapy for human diseases. Naturally occurring SNPs in polymorphic genes could also provide ways for CRISPR targeting of pathogenic mutations. Two previous studies targeted natural mutations linked to Huntington’s disease (HD), caused by CAG repeat expansion in the Huntingtin gene [84,85]. The studies showed that the first exon of the pathogenic allele could be effectively deleted by PAM recognition of CRISPR effectors in fibroblasts derived from HD patients and humanized HD mice (BaCHD; Figure 4B). These studies suggest that CRISPR therapy may be applied to treat various diseases by effectively eliminating the pathogenic allele without altering the normal gene.

CRISPR-Based Precise Oncogene Targeting for Cancer Therapy Many carcinogenic DNA mutations show high correlation with pathogenicity due to their malignant functions [86,87]. Although numerous therapies have been developed for various cancers, there are still unmet needs for therapeutics that may alleviate high costs and patient suffering [88–90]. Recent studies applied CRISPR effector systems for selective removal of carcinogenic DNA mutations (Figure 4A). The studies demonstrated that delivering CRISPR systems to target oncogenic mutations specifically inhibited the growth of mutant cancer cells. CRISPR methods were also shown to be effective in inhibiting the growth of mutant cancer cells in xenograft mice. CRISPR-Cas9 could be utilized for both in vivo and in vitro targeting of highly frequent point mutations in KRAS proto-oncogene to inhibit cancer cell growth (Table 1) [64,91]. Two KRAS point mutations [G12V (G>T) and G12D (G>A)] were positioned in the CRISPR seed region (Table 1, guide RNAs 17 and 25) [91] for effective distinction of the missense mutations from normal sequences. The study demonstrated that the growth of cell lines with these mutations [SW480 and SW620 for G12V (c.35G>T), SNU407 and AsPC-1 for G12D (c.35G>A)] was selectively inhibited. Also, a reporter system was developed for screening guide RNAs that effectively targeted three KRAS point mutations [G12V (c.35G>T), G12D (c.35G>A), and G13D (c.38G>A)] [64]. These KRAS point mutations lacked guanine, therefore the ‘NGG’ PAM of SpCas9 was absent and the guide RNAs were selected to locate the point mutations within the seed region of target sequences (Table 1, guide RNAs 17–38).

Trends in Molecular Medicine, --, Vol. --, No. --

9

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

Wild type KRAS

(A)

Clinician’s Corner

Cell with wild type KRAS: survive

CTTGTGGTAGTTGGAGCTGGTGG Oncogene targeted CRISPR

Oncogene (c.35G>A KRAS)

CTTGTGGTAGTTGGAGCTGATGG

(B)

Cell with oncogenic KRAS: cell growth inhibition & death

Cleavage

SNP(C): No PAM HD promoter

5′UTR

(CAG)n

Exon1

Intron1

PAM

Wild type allele SNP(C): No PAM HD promoter

5′UTR

(CAG)n

Exon1

Intron1 Intronic indels

SNP(G): PAM generation HD promoter

5′UTR

Cleavage

(CAG)n Exon1

Intron1 PAM

Mutant allele

Cleavage

HD promo

Intron1

Exon1 deletion

Trends in Molecular Medicine

Figure 4. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Based Gene Therapy Strategies through Precise Targeting of Mutant Alleles. (A) CRISPR effectors are designed and delivered into cancer cells for precise induction of DNA double-strand breaks within the oncogenic mutant alleles. Oncogenic single base pair mutations can be targeted by positioning the mutations within the seed or protospacer adjacent motif (PAM) region of target DNA. The CRISPR-mediated specific cleavage of oncogenic DNA induces growth inhibition and death of the cancer cells. (B) Targeted cleavage of pathogenic Huntingtin (HTT) alleles by CRISPR-CRISPR-associated 9 (Cas9) system. Selective induction of large DNA deletions in the mutant HTT allele encompassing the exon1 region can inactivate the mutant allele. The precise genetic changes within the pathogenic mutant HTT allele can be induced by utilizing the single nucleotide polymorphism (SNP) in the promoter region to discriminate the mutant and normal HTT alleles. The promoter region of the pathogenic mutant allele may contain a patientspecific SNP that generates PAM sequence recognizable by CRISPR effector. Targeted induction of two CRISPR-mediated cleavage events in the mutant alleles result in large deletions, including exon1, and the pathogenic HTT alleles lose the functionality. However, the promoter sequences of wild type HTT allele contains no PAM sequence recognizable by CRISPR effector. Therefore, the wild type alleles experience only single DNA cleavage events in the first intron that result in only small intronic indels that generally have insignificant effects on the gene function. Abbreviations: HD, Huntington’s disease; UTR, untranslated region.

Other genes have also been targeted for treatment with mutant allele-specific CRISPR-Cas9. Controlling lung cancer was attempted via CRISPR effectors that specifically targeted the EGFR L858R mutant allele [92]. The study demonstrated that CRISPR system targeting the PAM sequence, generated by the L858R point mutation, efficiently and selectively cleaved and disrupted the mutant allele (Table 1, guide RNA 39). Adeno-associated virus (AAV)-mediated transduction resulted in CRISPRCas9 transfer to xenograft mouse cells and tissues, and effective and specific cleavage of oncogenic

10

Trends in Molecular Medicine, --, Vol. --, No. --

Advances in CRISPR technology enabled precision genome editing in various systems. Despite the effectiveness of CRISPR systems, recent studies showed that CRISPR genome editing of specific genomic loci are prone to mistargeting of other loci with similar sequences. The so-called ‘off-target’ issues have been serious issues to overcome for developing CRISPRbased diagnoses and therapeutics in the human system. Development of enhanced CRISPR molecules and methods enabled high-fidelity distinction with single base pair differences. The CRISPR methods could be applied as diagnostic tools for sensitive detection of pathogenic alleles that exist in low frequency within a small amount of patient DNA. As for therapeutic application, CRISPR could be applied to target pathogenic mutations, such as in inherited diseases and cancer, that are different from normal alleles by only a single base pair, without altering the normal allele or inducing ‘off-target’ effects. Currently, CRISPR gene-edited cell therapies are being investigated in clinical trials for diseases encompassing genetic diseases, such as beta thalassemia and sickle cell disease, and cancer, including multiple myeloma and sarcoma.

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

EGFR genes. Consequently, the CRISPR targeting caused a decrease in the expression levels of the mutant EGFR alleles and lowered the viability of cancer cells. In xenograft mouse experiments, this selective targeting led to a decrease in tumor size and an increase in mouse survival rates. This approach was also applied to mutations in several other genes, including BRAF, CEBPA, IDH1, PIK3CA, NPM1, and EGFR [93]. To this end, they developed an intracellular reporter assay to show that mutant alleles could be specifically targeted by CRISPR via positioning the mutations within the PAM or seed region.

Concluding Remarks While the recent advancements in CRISPR technology have provided novel methods for precise targeting of pathogenic mutations for biomedical applications, there are still several pressing issues that need to be addressed for developing diagnostics and therapeutics (see Outstanding Questions). Studies on cellular and in vivo allele targeting by CRISPR showed that the efficacy and specificity of CRISPR-Cas vary widely depending on the complex intracellular environments of the target genomic loci [94]. In addition to the target DNA sequence per se, epigenetic elements such as DNA methylation, chromosome accessibility, and DNA-binding proteins could also affect the function and variability of the delivered CRISPR molecules [94,95]. This uncertainty poses an important issue for CRISPR gene therapy. In order to facilitate the effective medical application of CRISPR genome editing, several groups are working on prediction algorithms for the efficacy and precision of gene editing based on validated experimental results [96–98].

Outstanding Questions How can we modify the CRISPR guide RNA for allele-specific targeting without off-target issues? How can we enhance the CRISPR delivery methods for the human system? How can we predict the variability of CRISPR off-target issues caused by the genetic differences between patients due to single nucleotide polymorphisms (SNPs)? For developing CRISPR-based gene therapy, how can we minimize the potential immune rejection problems while retaining the therapeutic efficacy and specificity for diseases, including genetic disorder and cancer? In addition to CRISPR, how can we find the other novel genome engineering tools for medical applications?

Another concern limiting the efficacy of CRISPR techniques is that certain pathogenic mutations are not targetable due to lack of PAM sequences. To this end, some studies have focused on developing modified and enhanced CRISPR genome editing molecules to alleviate PAM restrictions. Engineered CRISPR proteins, called xCas9 [23] and NG-SpCas9 [22] enable targeting of DNA sequences with nonconventional ‘NG’ PAM sequences, instead of the conventional ‘NGG’ PAM sequence. Furthermore, novel CRISPR effectors with different PAM sequences and combinatorial application of multiple CRISPRs are being explored to expand the repertoire of targetable sequences [21,27,32]. A subgroup of CRISPRs has been utilized for mRNA editing, rather than genomic DNA editing. CRISPR-Cas13 systems, which are reprogrammable RNA targeting tools, have been shown to target mRNAs more specifically than conventional siRNA-mediated RNA interference [99–101]. For medical applications, mRNA targeting CRISPR systems have been anticipated to provide the basis for developing safe and effective methods to precisely regulate pathogenic genes at mRNA level, fundamentally eliminating the potential danger from altering genomic DNA. In summary, the recent developments in CRISPR methods allow effective sensing of single-base indels or substitutions for biomedical applications. As for diagnostics, CRISPR methods could be applied for highly sensitive detection of single-base mutations that exist in low frequency in DNA. CRISPR-based diagnostic methods have the potential to extend the detection limits of pathogenic mutant alleles in samples, such as circulating tumor DNA. CRISPR technologies also widen the possibilities of developing novel therapeutics for inherited diseases that are currently incurable based on precise genome editing requirements of mutant alleles. Hence, we believe that CRISPR systems can also be harnessed for cancer therapeutics that can be customized to individual patients based on specific mutations.

Acknowledgments This research was supported by grants from the National Research Foundation (NRF) funded by the Korean Ministry of Education, Science and Technology (NRF-2019R1C1C1006603 and NRF2018M3A9H1023142 to S.H.L., and NRF-2017R1E1A1A01074529, NRF-2018M3A9H3021707 to J.K.H.). The study was also supported by the grants from the Korea Research Institute of Bioscience & Biotechnology (KRIBB; Research Initiative Program KGM4251824 and KGM5381911 to S.H.L.).

Trends in Molecular Medicine, --, Vol. --, No. --

11

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

References 1. Barrangou, R. et al. (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315, 1709–1712 2. Jinek, M. et al. (2012) A programmable dual-RNA– guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821 3. Gasiunas, G. et al. (2012) Cas9–crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc. Natl. Acad. Sci. U. S. A. 109, 15539–15540 4. Hsu, P.D. et al. (2014) Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262–1278 5. Kim, H. and Kim, J.-S. (2014) A guide to genome engineering with programmable nucleases. Nat. Rev. Genet. 15, 321 6. Behan, F.M. et al. (2019) Prioritization of cancer therapeutic targets using CRISPR–Cas9 screens. Nature 568, 511–516 7. Parnas, O. et al. (2015) A genome-wide CRISPR screen in primary immune cells to dissect regulatory networks. Cell 162, 675–686 8. Santiago-Ferna´ndez, O. et al. (2019) Development of a CRISPR/Cas9-based therapy for Hutchinson– Gilford progeria syndrome. Nat. Med. 25, 423–426 9. Beyret, E. et al. (2019) Single-dose CRISPR– Cas9 therapy extends lifespan of mice with Hutchinson–Gilford progeria syndrome. Nat. Med. 25, 419–422 10. Park, C.-Y. et al. (2015) Functional correction of large factor VIII gene chromosomal inversions in hemophilia A patient-derived iPSCs using CRISPRCas9. Cell Stem Cell 17, 213–220 11. Hsu, P.D. et al. (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827 12. Cho, S.W. et al. (2014) Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome Res. 24, 132–141 13. Lin, J. and Wong, K.C. (2018) Off-target predictions in CRISPR-Cas9 gene editing using deep learning. Bioinformatics 34, i656–i663 14. Tsai, S.Q. et al. (2017) CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9 nuclease off-targets. Nat. Methods 14, 607–614 15. Tsai, S.Q. et al. (2015) GUIDE-seq enables genomewide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat. Biotechnol. 33, 187–197 16. Jiang, F. and Doudna, J.A. (2017) CRISPR–Cas9 structures and mechanisms. Ann. Rev. Biophys. 46, 505–529 17. Nishimasu, H. et al. (2014) Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 156, 935–949 18. Jiang, F. and Doudna, J.A. (2015) The structural biology of CRISPR-Cas systems. Curr. Opin. Struct. Biol. 30, 100–111 19. Jiang, F. et al. (2015) Structural biology. A Cas9guide RNA complex preorganized for target DNA recognition. Science 348, 1477–1481 20. Jiang, F. et al. (2016) Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage. Science 351, 867–871 21. Fonfara, I. et al. (2014) Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic Acids Res. 42, 2577–2590 22. Nishimasu, H. et al. (2018) Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361, 1259–1262 23. Hu, J.H. et al. (2018) Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature 556, 57–63

12

24. Kleinstiver, B.P. et al. (2015) Engineered CRISPRCas9 nucleases with altered PAM specificities. Nature 523, 481–485 25. Globyte, V. et al. (2019) CRISPR/Cas9 searches for a protospacer adjacent motif by lateral diffusion. EMBO J. 38, e99466 26. Sternberg, S.H. et al. (2014) DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507, 62–67 27. Zetsche, B. et al. (2015) Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759–771 28. Swarts, D.C. et al. (2017) Structural basis for guide RNA processing and seed-dependent DNA targeting by CRISPR-Cas12a. Mol. Cell 66, 221–233 29. Yamano, T. et al. (2016) Crystal structure of Cpf1 in complex with guide RNA and target DNA. Cell 165, 949–962 30. Stella, S. et al. (2017) Structure of the Cpf1 endonuclease R-loop complex after target DNA cleavage. Nature 546, 559–563 31. Swarts, D.C. and Jinek, M. (2019) Mechanistic insights into the cis- and trans-acting DNase activities of Cas12a. Mol. Cell 73, 589–600 32. Gao, L. et al. (2017) Engineered Cpf1 variants with altered PAM specificities. Nat. Biotechnol. 35, 789–792 33. Jin, S. et al. (2019) Cytosine, but not adenine, base editors induce genome-wide off-target mutations in rice. Science 364, 292–295 34. Pattanayak, V. et al. (2013) High-throughput profiling of off-target DNA cleavage reveals RNAprogrammed Cas9 nuclease specificity. Nat. Biotechnol. 31, 839–843 35. Fu, Y. et al. (2013) High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 31, 822–826 36. Zhang, X.H. et al. (2015) Off-target effects in CRISPR/Cas9-mediated genome engineering. Mol. Ther. Nucleic Acids 4, e264 37. Kosicki, M. et al. (2018) Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements. Nat. Biotechnol. 36, 765–771 38. Egli, D. et al. (2018) Inter-homologue repair in fertilized human eggs? Nature 560, E5–E7 39. Yan, W.X. et al. (2017) BLISS is a versatile and quantitative method for genome-wide profiling of DNA double-strand breaks. Nat. Commun. 8, 15058 40. Cong, L. et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823 41. Kim, D. et al. (2016) Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nat. Biotechnol. 34, 863–868 42. Kleinstiver, B.P. et al. (2016) Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat. Biotechnol. 34, 869–874 43. Kocak, D.D. et al. (2019) Increasing the specificity of CRISPR systems with engineered RNA secondary structures. Nat. Biotechnol. 37, 657–666 44. Tsai, S.Q. and Joung, J.K. (2016) Defining and improving the genome-wide specificities of CRISPR-Cas9 nucleases. Nat. Rev. Genet. 17, 300–312 45. Fu, Y. et al. (2014) Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 32, 279 46. Yin, H. et al. (2018) Partial DNA-guided Cas9 enables genome editing with reduced off-target activity. Nat. Chem. Biol. 14, 311

Trends in Molecular Medicine, --, Vol. --, No. --

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

47. Slaymaker, I.M. et al. (2016) Rationally engineered Cas9 nucleases with improved specificity. Science 351, 84–88 48. Kleinstiver, B.P. et al. (2016) High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature 529, 490–495 49. Hadden, J.M. et al. (2001) Crystal structure of the Holliday junction resolving enzyme T7 endonuclease I. Nat. Struct. Biol. 8, 62–67 50. Cho, S.W. et al. (2013) Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat. Biotechnol. 31, 230–232 51. Kim, J.M. et al. (2014) Genotyping with CRISPR-Casderived RNA-guided endonucleases. Nat. Commun. 5, 3157 52. Gu, W. et al. (2016) Depletion of abundant sequences by hybridization (DASH): using Cas9 to remove unwanted high-abundance species in sequencing libraries and molecular counting applications. Genome Biol. 17, 41 53. Lee, S.H. et al. (2017) CUT-PCR: CRISPR-mediated, ultrasensitive detection of target DNA using PCR. Oncogene 36, 6823–6829 54. Forshew, T. et al. (2012) Noninvasive identification and monitoring of cancer mutations by targeted deep sequencing of plasma DNA. Sci. Transl. Med. 4, 136ra68 55. Newman, A.M. et al. (2014) An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage. Nat. Med. 20, 548–554 56. Li, M. et al. (2006) BEAMing up for detection and quantification of rare sequence variants. Nat. Methods 3, 95–97 57. Kinde, I. et al. (2011) Detection and quantification of rare mutations with massively parallel sequencing. Proc. Natl. Acad. Sci. U. S. A. 108, 9530–9535 58. Nik-Zainal, S. et al. (2016) Landscape of somatic mutations in 560 breast cancer whole-genome sequences. Nature 534, 47–54 59. Jaiswal, S. et al. (2014) Age-related clonal hematopoiesis associated with adverse outcomes. N. Engl. J. Med. 371, 2488–2498 60. Bertucci, F. et al. (2019) Genomic characterization of metastatic breast cancers. Nature 569, 560–564 61. D’Gama, A.M. and Walsh, C.A. (2018) Somatic mosaicism and neurodevelopmental disease. Nat. Neurosci. 21, 1504–1514 62. Taylor, R.W. and Turnbull, D.M. (2005) Mitochondrial DNA mutations in human disease. Nat. Rev. Genet. 6, 389–402 63. Li, Y. et al. (2019) Gain-of-function mutations: an emerging advantage for cancer biology. Trends Biochem. Sci. 44, 659–674 64. Kim, W. et al. (2018) Targeting mutant KRAS with CRISPR-Cas9 controls tumor growth. Genome Res. 28, 374–382 65. Crino, P.B. et al. (2006) The tuberous sclerosis complex. N. Engl. J. Med. 355, 1345–1356 66. Arnaout, M.A. (2001) Molecular genetics and pathogenesis of autosomal dominant polycystic kidney disease. Annu. Rev. Med. 52, 93–123 67. Najam, O. and Ray, K.K. (2015) Familial hypercholesterolemia: a review of the natural history, diagnosis, and management. Cardiol. Ther. 4, 25–38 68. McDonald, J. et al. (2011) Hereditary hemorrhagic telangiectasia: an overview of diagnosis, management, and pathogenesis. Genet. Med. 13, 607–616

69. Mizuguchi, T. and Matsumoto, N. (2007) Recent progress in genetics of Marfan syndrome and Marfan-associated disorders. J. Hum. Genet. 52, 1–12 70. Hirbe, A.C. and Gutmann, D.H. (2014) Neurofibromatosis type 1: a multidisciplinary approach to care. Lancet Neurol. 13, 834–843 71. Caron, N.S. et al. (2018) Therapeutic approaches to Huntington disease: from the bench to the clinic. Nat. Rev. Drug Discov. 17, 729–750 72. Chen, B. and Altman, R.B. (2017) Opportunities for developing therapies for rare genetic diseases: focus on gain-of-function and allostery. Orphanet. J. Rare Dis. 12, 61 73. Christensen, R.D. et al. (2015) A pediatrician’s practical guide to diagnosing and treating hereditary spherocytosis in neonates. Pediatrics 135, 1107–1114 74. Zhou, R. et al. (2017) Dominant negative effect of the loss-of-function g-secretase mutants on the wild-type enzyme through heterooligomerization. Proc. Natl. Acad. Sci. U. S. A. 114, 12731–12736 75. Chao-Shern, C. et al. (2019) Evaluation of TGFBI corneal dystrophy and molecular diagnostic testing. Eye (Lond.) 33, 874–881 76. Barbui, T. et al. (2018) The 2016 WHO classification and diagnostic criteria for myeloproliferative neoplasms: document summary and in-depth discussion. Blood Cancer J. 8, 15 77. Komor, A.C. et al. (2016) Programmable editing of a target base in genomic DNA without doublestranded DNA cleavage. Nature 533, 420–424 78. Gaudelli, N.M. et al. (2017) Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature 551, 464–471 79. Christie, K.A. et al. (2017) Towards personalised allele-specific CRISPR gene editing to treat autosomal dominant disorders. Sci. Rep. 7, 16174 80. Smith, C. et al. (2015) Efficient and allele-specific genome editing of disease loci in human iPSCs. Mol. Ther. 23, 570–577 81. Shen, S. et al. (2018) Amelioration of alpha-1 antitrypsin deficiency diseases with genome editing in transgenic mice. Hum. Gene Ther. 29, 861–873 82. Song, C.Q. et al. (2018) In vivo genome editing partially restores alpha1-antitrypsin in a murine model of AAT deficiency. Hum. Gene Ther. 29, 853–860 83. Li, P. et al. (2018) Allele-specific CRISPR-Cas9 genome editing of the single-base P23H mutation for rhodopsin-associated dominant retinitis pigmentosa. CRISPR J. 1, 55–64 84. Shin, J.W. et al. (2016) Permanent inactivation of Huntington’s disease mutation by personalized allele-specific CRISPR/Cas9. Hum. Mol. Genet. 25, 4566–4576 85. Monteys, A.M. et al. (2017) CRISPR/Cas9 editing of the mutant Huntingtin allele in vitro and in vivo. Mol. Ther. 25, 12–23 86. Park, J.T. et al. (2015) Differential in vivo tumorigenicity of diverse KRAS mutations in vertebrate pancreas: a comprehensive survey. Oncogene 34, 2801–2806 87. Vogelstein, B. et al. (2013) Cancer genome landscapes. Science 339, 1546–1558 88. Cox, A.D. et al. (2014) Drugging the undruggable RAS: mission possible? Nat. Rev. Drug Discov. 13, 828–851 89. Lazo, J.S. and Sharlow, E.R. (2016) Drugging undruggable molecular cancer targets. Annu. Rev. Pharmacol. Toxicol. 56, 23–40 90. McCormick, F. (2015) KRAS as a therapeutic target. Clin. Cancer Res. 21, 1797–1801

Trends in Molecular Medicine, --, Vol. --, No. --

13

Please cite this article in press as: Lee et al., CRISPR Diagnosis and Therapeutics with Single Base Pair Precision, Trends in Molecular Medicine (2019), https://doi.org/10.1016/j.molmed.2019.09.008

Trends in Molecular Medicine

91. Lee, W. et al. (2018) Selective targeting of KRAS oncogenic alleles by CRISPR/Cas9 inhibits proliferation of cancer cells. Sci. Rep. 8, 11879 92. Koo, T. et al. (2017) Selective disruption of an oncogenic mutant allele by CRISPR/Cas9 induces efficient tumor regression. Nucleic Acids Res. 45, 7897–7908 93. Gebler, C. et al. (2017) Inactivation of cancer mutations utilizing CRISPR/Cas9. J. Natl. Cancer Inst. 109, 1 94. Isaac, R.S. et al. (2016) Nucleosome breathing and remodeling constrain CRISPR-Cas9 function. Elife, e13450 95. Kim, S. et al. (2014) Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012–1019

14

96. Shen, M.W. et al. (2018) Predictable and precise template-free CRISPR editing of pathogenic variants. Nature 563, 646–651 97. Kim, H.K. et al. (2018) Deep learning improves prediction of CRISPR-Cpf1 guide RNA activity. Nat. Biotechnol. 36, 239–241 98. Bae, S. et al. (2014) Microhomology-based choice of Cas9 nuclease target sites. Nat. Methods 11, 705–706 99. Smargon, A.A. et al. (2017) Cas13b is a type VI-B CRISPR-associated RNA-guided RNase differentially regulated by accessory proteins Csx27 and Csx28. Mol. Cell 65, 618–630 100. Abudayyeh, O.O. et al. (2017) RNA targeting with CRISPR-Cas13. Nature 550, 280–284 101. Cox, D.B.T. et al. (2017) RNA editing with CRISPRCas13. Science 358, 1019–1027

Trends in Molecular Medicine, --, Vol. --, No. --