Critical light-related gene expression varies in two different strains of the dinoflagellate Karlodinium veneficum in response to the light spectrum and light intensity

Accepted Manuscript Critical light-related gene expression varies in two different strains of the dinoflagellate Karlodinium veneficum in response to the light spectrum and light intensity

Ran Meng, Chengxu Zhou, Xiaojuan Zhu, Hailong Huang, Jilin Xu, Qijun Luo, Xiaojun Yan PII: DOI: Reference:

S1011-1344(18)31008-X https://doi.org/10.1016/j.jphotobiol.2019.03.009 JPB 11477

To appear in:

Journal of Photochemistry & Photobiology, B: Biology

Received date: Revised date: Accepted date:

5 September 2018 14 March 2019 15 March 2019

Please cite this article as: R. Meng, C. Zhou, X. Zhu, et al., Critical light-related gene expression varies in two different strains of the dinoflagellate Karlodinium veneficum in response to the light spectrum and light intensity, Journal of Photochemistry & Photobiology, B: Biology, https://doi.org/10.1016/j.jphotobiol.2019.03.009

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Critical light-related gene expression varies in two different strains of the dinoflagellate Karlodinium veneficum in response to the light spectrum and light intensity Ran Meng1,2,ǂ, Chengxu Zhou1,2, ǂ,* , Xiaojuan Zhu1,2 , Hailong Huang1,2 , Jilin Xu1 , Qijun Luo1 , Xiaojun Yan1,3, *

1

Key Laboratory of Marine Biotechnology of Zhejiang Province, Ningbo University, Ningbo,

Li Dak Sum Yip Yio Chin Kenneth Li Marine Biopharmaceutical Research Center, Ningbo

RI

2

PT

Zhejiang 315211, China.

ǂ

Authors contribute equally in this study. *

Co-corresponding authors.

ED

Authors:

Email: [email protected]

EP T

Ran Meng

NU

Zhejiang Ocean University, 316022, Zhoushan, Zhejiang, China.

MA

3

SC

University, Ningbo 315211, China.

Email: [email protected]

Xiaojuan Zhu

Email: [email protected]

Hailong Huang

Email: [email protected]

AC C

Chengxu Zhou

Jilin Xu

Email: [email protected]

Qijun Luo

Email: [email protected]

Xiaojun Yan

Email: [email protected]

Co-corresponding

authors:

[email protected]

Email:

[email protected];

Email:

ACCEPTED MANUSCRIPT Abstract: The toxic dinoflagellate Karlodinium veneficum is widely distributed in cosmopolitan estuaries and is responsible for massive fish mortality worldwide. Intraspecific biodiversity is important for the spread to various habitats, interspecific competition to dominate a population, and bloom formation and density maintenance. Strategies for light adaptation may help determine the

PT

ecological niches of different ecotypes. However, the mechanism of phenotypic biodiversity is still unclear. In this study, intraspecific differences in genetic regulatory mechanisms in response

RI

to varied light intens ities and qualities were comparatively researched on two different strains isolated from coastal areas of the East China Sea, namely, GM2 and GM3. In GM2, the expression

SC

of genes in the Calvin cycle, namely, rbcL and SBPase, and a light-related gene that correlated with cellular motility, rhodopsin, were significantly inhibited under high light intensities. Thus,

NU

this strain was adapted to low light. In contrast, the gene expression levels were promoted by high light conditions in GM3. These upregulated genes in the GM3 strain probably compensated for the

MA

negative effects on the maximum quantum yields of PSII (Fv/Fm) under high light stress, which inhibited both strains, enabling GM3 to maintain a constant growth rate. Thus, this strain was

ED

adapted to high light. Compared with white light, monochromatic blue light had negative effects on Fv/Fm and the relative electron transfer rate (ETR) in both strains. Under blue light, gene

EP T

expression levels of rbcL and SBPase in GM2 were inhibited; in contrast, the levels of these genes, especially rbcL, were promoted in GM3. rbcL was significantly upregulated in the blue light groups. Monochromatic red light promoted rhodopsin gene expression in the two strains in a

AC C

similar manner. These intraspecific diverse responses to light play important roles in the motor characteristics, diel vertical migration, interspecific relationships and photosynthetic or phagotrophic activities of K. veneficum and can determine the population distribution, population maintenance and bloom formation.

Key words: Karlodinium veneficum; Intraspecific difference; Photosynthetic gene expression; rhodopsin gene.

ACCEPTED MANUSCRIPT 1. Introduction The mixotrophic dinoflagellate Karlodinium veneficum is a toxic blooming species with a cosmopolitan distribution. This species produces a suit of unique karlotoxins [1]. The toxic blooms cause massive economic losses and high mortality in fisheries, both in natural waters and aquaculture farms worldwide [2-4]. Population growth of this species depends on both

PT

photoautotrophic and heterotrophic nutrition [5]. The latter includes phagotrophic feeding activity on a wide spectrum of aquatic protist taxa of various sizes [6]. While photosynthesis is a critical

RI

light-dependent process in autotrophic growth, the phagotrophic ability of K. veneficum was found to be light dependent as well [7]. During the light-dependent phagotrophy, K. veneficum was

SC

shown to adjust its swimming behavior to search, locate and predate on prey [8]. K. veneficum can actively migrate in the water column [9, 10] and continuously faces various light intens ities and

NU

qualities. Because of these characteristics, adjustment to changes in light is important in the distribution and population growth of this organism.

MA

The photosynthetic process, including both photochemical and carbon assimilatory processes, is critical for the population success of phototrophic organisms. The Calvin cycle, which occurs

ED

during photosynthesis, plays an important role in photosynthetic carbon fixation. The regeneration rate of ribulose-1,5-bisphosphate (RuBP) affects the efficiency of carbon assimilation. Rubisco

EP T

activity is the main factor affecting the photosynthetic rate. Another enzyme in the Calvin cycle, namely, sedoheptulose-1,7-bisphosphatase (SBPase), which is found in photosynthetic organisms only, plays a role in the regeneration of RuBP and in the control of carbon flux through the Calvin

AC C

cycle [11]. Previous studies have shown that both light intens ity and quality affect photosynthetic performance by regulating the expression of these related genes [12-14]. In addition to photosynthesis in phototrophic protists, other light-dependent processes have been identified, particularly those associated with nonphotosynthetic photoenergy utilization by means of rhodopsin in light sensing, chloride pumping and proton pumping [15-18]. In the freshwater mixotrophic dinoflagellate Esoptrodinium sp., sustained growth of isolates lacking obvious chloroplasts was photoobligatory, suggesting the existence of nonphotosynthetic photoenergy utilization [18]. After microalgal rhodopsin was first discovered in the green microalga Chlamydomonas reinhardtii [19], variants of rhodopsin were found in microalgae [20-24]. Rhodopsin is especially sensitive to light and is more efficient at capturing light energy

ACCEPTED MANUSCRIPT than the photosynthetic machinery. Different types of rhodopsin were shown to absorb light at different wavelengths [15, 24, 25]. In unicellular flagellates, rhodopsins function in light-gated ion channels, serving as light-phase-related photoreceptors that control the phototaxis of dinoflagellate cells [21, 22, 26-28]. Intraspecific variations were found to be widely present in K. veneficum. Toxin congeners and

PT

toxicities, pigment compositions, autotrophic and phagotrophic growth rates and DNA size [29] varied within geographic isolates of this species and even among members of the same population

RI

[30]. Different ecotypes vary in their ability to feed on prey [8, 31-33]. Intraspecific biodiversity of harmful microalgal species plays important roles in the species distribution, population growth,

SC

bloom formation, bloom duration and density maintenance [34-36]. Both photosynthesis and phagotrophy are light-dependent processes in K. veneficum. Different responses to light

NU

demonstrate different adaptation and growth strategies. While the photosynthetic process has been widely studied in photoautotrophic organisms, research on the mechanism by which light affects

MA

photosynthesis in mixotrophic dinoflagellates, especially research on the intraspecific differences in these mechanisms, is lacking. In addition, questions regarding whether and how rhodopsin is

ED

correlated with light-dependent phagotrophic behavior and activity in dinoflagellates and the extent to which intraspecific variations contribute to this difference require further research.

EP T

Primarily to address these questions, in this study, we comparatively analyzed the expression of two critical genes in the Calvin cycle that determine the rates of carbon assimilation or carbon flux, namely, rbcL and SBPase, and the expression of rhodopsin, which is proposed to be associated

AC C

with the effects of light intensity and light spectrum on cell motility [24], in two strains of K. veneficum isolated from the East China Sea (ECS), namely, GM2 and GM3. These two strains are taxonomically identical at the species level but have different intraspecific traits, such as differences in toxin composition and phagotrophic ability [31, 37]. The aim of this study was to determine whether and how differences in light influence the expression of these genes in K. veneficum and whether and to what extent the expression of these genes differs between these two ecotype strains with intraspecific variations.

2. Materials and Methods

ACCEPTED MANUSCRIPT 2.1. Microalgal cultures, experimental setting and light treatments Two strains of K. veneficum were maintained and provided by the Microalgae Collection Center at Ningbo University (Zhejiang, China), namely, GM2 and GM3. The accession numbers in NCBI for GM2 and GM3 are MK424127 and MK424128, respectively. Both strains were isolated from the ECS coastal areas; GM2 was from Yushan, Zhejiang Province, and GM3 was from Zhaoan, Fujian Province. Molecular, morphological and toxin analyses all showed that these two strains

PT

were K. veneficum. Both cultures were non-axenic unialgal cultures. The stock cultures were

RI

maintained in sterilized natural seawater enriched with f/2-Si culture medium with a salinity of 24 psu under conditions of 20 °C±1 °C and 50 µmol m-2 s -1 (L/D=14/10) of white LED irradiance

SC

(wavelength ranged 400–700 nm). For preparation of the experimental cultures, the algal cells were inoculated in freshly prepared sterilized medium and grew under the same conditions as

NU

above. To start the experiments, 400 ml of the cultures at the exponential phase were inoculated with 400 ml of freshly prepared media in 2000-ml glass flasks. In the light intensity experiments,

MA

the growing cultures were illuminated with 50, 100, and 200 μmol photons·m−2·s −1 of white LED 4

4

light. The initial cell densities of GM2 and GM3 were 2.5×10 and 1.8×10 cells/ml, respectively,

ED

which were determined by counting the cells under a microscope using a hemocytometer (Sigma-Aldrich, USA). In the light quality experiments, the cultures were grown under white, red

EP T

(peak at 650 nm) and blue (peak at 450 nm) LED lights. Areas of similar light intensity (40 μmol photons·m−2 ·s −1 ) were determined using a quantum separate sensor with a handheld meter (Apogee MQ-500, Apogee Instruments, USA) before the cultures were allowed to settle. The 4

4

AC C

initial cell densities of GM2 and GM3 were 2×10 and 2.5×10 cells/ml, respectively, in this experiment. For all the lights, the cultures were illuminated from above with a 14:10 h light: dark cycle. Both of the light treatments were performed in triplicate, and all the cultures were grown in a culture room at a constant temperature of 20±1 °C for four days. On the fourth day of growth, the cell number was checked again, and the photosynthetic activity of the cultures was measured by using chlorophyll fluorometers. In the light quality experiments, chlorophyll fluorescence parameters, maximum quantum yield of PSII (Fv/Fm), relative electron transport rate (ETR), nonphotochemical quenching (NPQ) and photochemical quenching (qP) were measured using the chlorophyll fluorometer WATER-PAM (WALZ, Germany) in conjunction with WinControl software. In the light intensity experiments, maximum quantum

ACCEPTED MANUSCRIPT yield of PSII (Fv/Fm) was detected by using the chlorophyll fluorometer APFP-100 (AquaPen, USA) (WATER-PAM was unavailable during this experiment). In both of the experiments, one milliliter of each culture was sampled and was incubated in the dark for 15 min for dark acclimation at the same temperature as that of the culture room before the chlorophyll fluorescence parameters were detected. After the dark acclimation, measurements were

PT

immediately performed according to the instrument manual. On the fourth day of the experiment, 50 ml of each culture was harvested by centrifugation at

RI

8000 rpm at 4 °C for 10 min. The samples were resuspended in 1 ml TRIzol Reagent (Invitrogen,

SC

USA) and stored at −80 °C until further analysis.

2.2. Gene expression analysis (qPCR)

NU

Total RNA was extracted with TRIzol Reagent. RNA quality and quantity were evaluated by 1.5% (wt/v) agarose gel electrophoresis and a NanoDrop spectrophotometer (NanoDrop 2000, Thermo

MA

Scientific, Waltham, MA, USA). The cDNA template was synthesized according to the manufacturer’s instructions for the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa,

ED

Japan). Reverse transcription reactions were performed in 20 μl containing 750 ng total RNA. Specific primers for each target gene were designed using Primer 5.0 based on the cDNA

EP T

sequences available in the GenBank database (Table 1). The specificity of primers was confirmed by melting curve analysis and sequencing. PCR amplicons of K. veneficum rbcL, SBPase and rhodopsin were obtained from plasmids containing the corresponding gene fragments to determine

AC C

the reaction efficiency. The amplicons were purified and quantified using NanoDrop, and then, a series of 10-fold dilutions was prepared by a gradient of 102 –107 gene copies per 2 μl. The standard series were analyzed using qPCR to evaluate reaction efficiencies for each assay. qPCR was performed using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa, Japan) on an ABI 7500 real-time PCR system (ABI, USA). Each reaction was carried out in a total volume of 20 μl containing 0.4 µM of each primer, 2 μl template, 10 µl SYBR Premix Ex Taq II (Tli RNaseH Plus) (2×) and 6.4 μl dH2 O. Briefly, after an initial denaturation step at 95 °C for 2 min, the amplification was carried out with 40 cycles at a melting temperature of 95 °C for 10 sec, an annealing temperature of 57 °C for 10 sec, and an extension temperature of 72 °C for 20 sec. Melting curve analysis (1.85 °C increments/min from 57 °C to 95 °C) was performed after the

ACCEPTED MANUSCRIPT amplification phase for confirmation. Each sample was run in triplicate. Amplification efficiency was analyzed according to the equation as follows: E=10 (−1/slope)−1. The melting curve for each amplicon is shown Supplemental Fig. 1. The amplification efficiencies for K. veneficum rbcL, SBPase, rhodopsin, calmodulin (calm) and glyceraldehyde 3-phosphate dehydrogenase (gapdh) were 0.95, 0.94, 0.98, 0.96 and 0.94, respectively (Supplemental Fig. 2).

PT

For the determination of target gene expression in the samples, the standard series and the K. veneficum cDNA samples were analyzed together by qPCR. qPCR assays were performed as

RI

described above. The data were analyzed using ABI 7500 software (ABI, USA). Expression stability was performed on calm and gapdh under different light intensit ies and qualities. Gene

NU

2.3. Data management and statistical analysis

SC

expression was normalized using calm expression. All sample analyses were repeated three times.

The specific growth rate (μ) was calculated according to the following equation.

MA

μ=(lnN1 -lnN0 )/(t1 -t0 ), where N1 is the cell density at time t1, and N0 is the initial cell density at time t0 .

ED

Each value is shown as the mean±SE with three replicates each. Differences among treatments were analyzed by one-way analysis of variance (ANOVA) using SPSS 16.0. Statistical analysis of

EP T

light intensity was performed by using Duncan’s multiple range test, while that of light quality was performed by using Dunnett’s test. P<0.05 was considered statistically significant.

AC C

3. Results

3.1. Variations in the growth rate and in the maximum quantum yield of PSII (Fv/Fm) Growth rates and the photochemical process of photosynthesis in these two strains of K. veneficum were affected by both light intensity and light quality. Intraspecific variations in the responses were also observed, as shown in Fig. 1. Under different light intens ities, the growth of the GM2 strain was significantly affected. The growth rate of GM2 decreased as the light intensity increased (Fig. 1, A1). High light stress on GM2 also led to maximal photochemical efficiency, as shown by the value of the chlorophyll fluorescence parameter Fv/Fm (Fig. 1, B1), decreased. A significant negative effect of light

ACCEPTED MANUSCRIPT intensity on Fv/Fm was observed in the GM3 strain, as shown in Fig. 1, B2. However, the growth rate of GM3 was not affected by increase in light intensity from 50 to 200 μmol photons·m−2 ·s −1, i.e., there was no significant difference in the growth rate (Fig. 1, A2). A comparison of the groups subjected to white light showed that the growth rate and Fv/Fm were influenced by light quality. Both strains were affected by blue light, exhibiting significantly

PT

decreased Fv/Fm values (Fig. 1, D1, D2). However, the growth rates of the two strains were not affected by blue light compared with white light (Fig. 1, C1, C2). Red light significantly promoted

RI

the growth of GM3 (Fig. 1, C2) but had no significant effect on the growth rate of GM2 (Fig. 1, C1). Compared with white light, red light had no effect on the Fv/Fm of GM3 (Fig. 1, D2) but

SC

enhanced the Fv/Fm of GM2 (Fig. 1, D1).

NU

3.2. Variations in gene expression of rbcL and SBPase

The expression levels of both of these critical photosynthesis-related genes were affected by

MA

differences in light intensity and quality to varying extents (Fig. 2). For the GM2 strain, SBPase expression was negatively affected by light intensity, while rbcL

ED

expression was not significantly affected (Fig. 2, A1, B1). The expression levels of both SBPase and rbcL were positively affected by light intensity in GM3 (Fig. 2, A2, B2). The expression of

EP T

rbcL gradually increased with increasing light intensity. SBPase expression increased significantly at the highest light intens ity compared with the expression in the groups with the lowest intensity, indicating that rbcL gene expression in GM3 was more sensitive to differences in light intensity

AC C

than SBPase gene expression.

When compared with those in the white light groups, the expression of these two genes in GM2 and rbcL expression in GM3 were affected by different light qualities (Fig. 2, C1, C2, D1). No significant differences were observed in SBPase expression in GM3 (Fig. 2, D2). Significant downregulation of the expression of both SBPase and rbcL was observed in the blue light groups in GM2 (Fig. 2, C1, D1). Red light significantly promoted SBPase expression (Fig. 2, D1) but had no significant effects on rbcL expression in GM2 (Fig. 2, C1). In GM3, the expression of rbcL and SBPase was enhanced by blue light (Fig. 2, C2, D2), but the difference in SBPase expression was not as significant as that of rbcL (Fig. 2, D2). Red light had no significant effect on rbcL and SBPase expression in GM3 (Fig. 2, C2, D2).

ACCEPTED MANUSCRIPT 3.3. Variations in rhodopsin expression Both light intens ity and light quality affected the expression of rhodopsin in both strains (Fig. 3). Interestingly, the expression in GM2 was negatively correlated with light intens ity (Fig. 3, A1), while that in GM3 was positively correlated with light intensity (Fig. 3, A2). GM2 downregulated

PT

rhodopsin gene expression under high light conditions (Fig. 3, A1), while GM3 upregulated the expression under high light conditions (Fig. 3, A2).

RI

Light quality had similar effects on rhodopsin gene expression in both strains. Red light promoted the expression of this gene (Fig. 3, B1, B2). No significant difference was found in the

SC

blue light groups compared with the white light groups, although the mean value of the blue light

NU

groups decreased.

3.4. Effect of light quality on chlorophyll fluorescence parameters in the two ECS strains

MA

As mentioned above, compared with white light, monochromatic blue light functioned as a stress factor for K. veneficum as blue light decreased the Fv/Fm value in both strains (Fig. 1, D1,

ED

D2). Blue light had similar effects on the ETR in both strains (Fig. 4, A1, A2). The ETR decreased significantly in the blue light groups (Fig. 4, A1, A2). Monochromatic red light did not

EP T

significantly affect the ETR in either strain (Fig. 4, A1, A2). Two additional chlorophyll fluorescence parameters, namely, NPQ and qP, were affected by light quality in GM2 (Fig. 4, B1, C1). Both NPQ and qP increased in the monochromatic light groups of GM2 compared with the

AC C

values in the white light groups (Fig. 4, B1, C1). NPQ was not influenced by light quality in GM3 (Fig. 4, B2). The qP value under red light decreased significantly in GM3 (Fig. 4, C2).

4. Discussion

Different geographical strains of mixotrophic K. veneficum have been shown to exhibit mixotrophy to different extents depending on the genetic background, toxin composition or ambient nutrient conditions [30, 38, 39]. These intraspecific differences play a role in the population distribution, the bloom formation and density maintenance in different estuaries and

ACCEPTED MANUSCRIPT coastal areas worldwide [34-36]. Light is one of the most important environmental factors. Light-dependent growth and phagotrophic ability have been found to be prevalent in mixotrophic dinoflagellates, such as Fragilidium subglobosum [40], Gyrodinium resplendens [41], K. veneficum [7] and K. amiger [42]. However, studies regarding the differences in the phototrophic, heterotrophic or phagotrophic responses to light at an intraspecific level remain lacking. In the

PT

present study, K. veneficum strains with intraspecific differences were found to respond differently to light conditions at the photochemical and critical light-related genetic levels during the process

RI

of photosynthesis and during nonphotosynthetic photoenergy utilization.

High light intensities inhibited the photosynthetic photochemical processes in both strains by

SC

decreasing the Fv/Fm. For GM2, the low-light-adapted strain, cell divis ion was also inhibited by high light intensity. However, for GM3, the high-light-adapted strain, although the photochemical

NU

process was inhibited as well, the decrease was not as large as that of GM2. In addition, high light intensity did not affect the growth rate of GM3. The compensation in GM3 cell division was

MA

probably a result of upregulation of the expression of genes in the Calvin cycle. In GM3, the gene expression of both rbcL and SBPase was positively correlated with light intens ity. Upregulation of

ED

these carbon assimilation and carbon flux genes was possibly associated with the cell division of GM3 under conditions of high light stress. In GM2, however, the gene expression of SBPase was

EP T

negatively affected by high light intens ity; as the light intensity increased, the gene expression decreased. This finding suggested that in GM2, high light conditions inhibited not only the photochemical process but also the carbon fixation process, and cell division might be affected as

AC C

well. This response to high light intensity was similar to that of the K. veneficum strain CCMP 2936, which was originally isolated from Delaware Inland Bay, USA. This strain exhibited downregulation of PSII in high light conditions, and the carbon assimilation by this strain decreased [9]. Intraspecific differences in responses to light intensity have also been found in diatom strains with cosmopolitan distributions, such as the widespread diatom species Ditylum brightwellii, in which different responses to low and high light intensit ies were observed among different clones [43]. Such intraspecific differences have also been observed in economically significant microalgae, such as different strains of Haematococcus pluvialis, which shows different intraspecific light responses among geographic strains [44, 45]. This intraspecific difference results in different culture protocol for growing different strains of H. pluvialis in

ACCEPTED MANUSCRIPT astaxanthin industry. Notably, in GM2, light intensity did not affect the gene expression of rbcL, but SBPase was downregulated in high light intensity. In GM3, both of these genes were upregulated in high light intens ity. The different gene expression patterns in the same strain of GM2 are probably correlated with regulatory factors other than light. The dinoflagellate K. veneficum can actively migrate vertically [9, 10]. During the migration,

PT

this organism not only experiences changes in light intensity but also experiences changes in light quality. How these algae adjust their gene expression during vertical movement requires further

RI

analyses at the molecular level to identify the mechanism underlying the intraspecific variations in response to varied light conditions. Compared with white light, monochromatic blue light acts as a

SC

stress factor for most autotrophic microalgae [46-49]. Blue light decreased the Fv/Fm and the ETR in both K. veneficum strains in this study. Although cell divis ion in both strains was not

NU

significantly affected by blue light, the gene expression of rbcL and SBPase was altered. In GM2, the expression of these genes was significantly downregulated, while in GM3, rbcL expression

MA

was significantly upregulated, and SBPase expression increased but not significantly. The effects of monochromatic light on the gene expression of rbcL have been observed in other microalgae,

ED

such as Chlorella vulgaris, in which the transcription of rbcL was upregulated under blue light and downregulated under red light [12]. The photosynthetic gene response to light in the dinoflagellate

EP T

K. veneficum may not be comparable to that of the green algae C. vulgaris because K. veneficum chloroplasts were derived from a haptophyte endosymbiont [50, 51]. However, the completely different regulation of these photosynthetic genes in the same species in response to light should

AC C

be assessed in further studies, such as analyses of endosymbiotic events, phylogenesis, and epigenetic mechanisms.

Compared with the effects of white light, the effects of monochromatic red light were not as significant as those of blue light on the regulation of the expression of the two critical genes in the Calvin cycle. However, gene expression of rhodopsin was significantly promoted by red light in both K. veneficum strains. This response to monochromatic light was different from that of Prorocentrum donghaiense. In P. donghaiense, the transcript levels of rhodopsin were higher in green light than in blue light, and the levels were the lowest in red light [24]. From the study of Shi et al. (2015), rhodopsin in P. donghaiense was speculated to be a green-light-absorbing type. K. veneficum rhodopsin was distantly separated from typical dinoflagellate rhodopsins in

ACCEPTED MANUSCRIPT phylogenetic analysis and was close to proteorhodopsins (PRs) [24]. PRs are the most abundant retinal based photoreceptors and display high diversity in geographically distinct patterns in the global marine environment [25, 52]. Their light absorption patterns, absorbing light in the blue or green regions of the visible light spectrum, were shown to be stratified with water depth [15]. Yellow-light absorbing PRs were recently found [53]. That K. veneficum rhodopsin is

PT

phylogeneticly near to PRs may be a reason that K. veneficum is globally distributed. The different gene expression patterns in response to light in K. veneficum and P. donghaiense indicate that

RI

these two dinoflagellate rhodopsins have different origins [21, 54].

High light intens ity also suppressed the expression of rhodopsin in P. donghaiense [24], which

SC

was similar to the response of GM2 but different from that of GM3. P. donghaiense is the main harmful blooming species in the ECS area [55]. K. veneficum was usually found accompanying

NU

the P. donghaiense bloom or bloomed after P. donghaiense faded [56]. In addition, the GM3 strain fed on P. donghaiense in laboratory studies while the GM2 strain showed characteristics of

MA

competition for nutrients with the latter [31]. Gene expression of rhodopsin was correlated with the motility of dinoflagellate cells [21]. The different rhodopsin genetic regulation in the two

ED

species probably reflected the varied light intensity and quality in different water depths affecting interspecific competitions. Thus, K. veneficum had higher intraspecific biodiversity than P.

EP T

donghaiense, which allows it to be flexible in competing with the latter at the species level. In our field research in a coastal area of the Xiangshan Bay in the ECS, K. veneficum was present in the samples from the surface water to that of 100 m depth. At least three genotypes of K. veneficum

AC C

based on ITS sequence were detected [57]. Whether the different strains in the present study existed at different water depths, or whether the occurrence of the light-adapted strains correlated with water depth will be of interest and will extend our knowledge of this species and its interspecific interaction with P. donghaiense. K. veneficum exhibited not only light-dependent predation activity but also diel vertical migration [9, 10]. Both of these activities are probably associated with energy requirement [10, 58]. The intraspecific different responses to light energy determine the motor ability for locating and chasing various preys and enable the organism to use different light energies at different water depths. These differences determine the distribution, range of vertical motion and differences in activities from surface waters to deeper waters or vice versa. While the high amount of

ACCEPTED MANUSCRIPT monochromatic red light in surface waters promotes the expression of rhodopsin equally in both strains, the high light intensity in surface waters plays different roles, leading to differences in the traits of the two strains. Further studies in cocultures with prey will demonstrate the role of the gene rhodopsin in the determination of the physiological traits of mixotrophic dinoflagellates. In GM2 grown under two monochromatic lights rather than white light, the NPQ and qP

PT

values were enhanced. Normally, NPQ is employed by microalgae to protect the organism from excess light energy stress [59]. In the light quality experiments, the same light intens ity was set as

RI

the same light quantum flux density. However, the light energy was different. The shorter wavelength has higher energy. The effect of light quality on NPQ in GM2 was probably because

SC

GM2 was more sensitive to high energy stress than GM3. Different responses to blue light were also found in gene expression of rbcL and SBPase. Both of the genes were significantly

NU

downregulated in GM2 in the blue light groups, while in GM3, the genes, especially rbcL, were significantly upregulated. In a study by Cui et al. (2017), NPQ in the K. veneficum strain

MA

CCMP2778, which was originally isolated in a coastal area of Florida, USA, was found to be significantly elevated under conditions of environmental P deprivation [60]. For GM3, NPQ was

ED

not significantly affected by differences in light conditions. Further comparative studies on light utilization coupled with critical environmental factors, such as nutrient availability, are necessary

EP T

for analysis of the different K. veneficum strains. The completely opposite gene patterns in response to light of different K. veneficum strains require further studies on protein abundance to demonstrate the molecular mechanisms. In addition, whether these differences in intraspecific

AC C

transcriptional regulation are also observed at the translational level requires further analyses. Nevertheless, the results of this study show ed that K. veneficum exhibited different intraspecific photoenergy utilization strategies. K. veneficum was shown to be an ideal model species for investigating many important biological questions after decades of studies [6]. The very different gene expression patterns in the K. veneficum strains will be valuable for further studies.

5. Conclusion The toxic dinoflagellate K. veneficum has high-light-adapted and low-light-adapted ecotypes. Photosynthesis-related gene and cellular motility-related gene expression in K. veneficum was

ACCEPTED MANUSCRIPT affected by both light intens ity and light quality. Upregulation or downregulation of these genes in response to varied light conditions showed intraspecific differences. The high light-adapted strain could probably upregulate the expression of carbon-fixation-associated genes to compensate for the photochemical loss under high light stress. When compared with white light, while monochromatic red light promoted gene expression of rhodopsin in K. veneficum, monochromatic

PT

blue light did not show different effects.

SC

RI

Acknowledgments

Funding: This work was supported by the National Key Research and Development Program

NU

of China (2018YFD0900702); the Earmarked Fund for Modern Agro-industry Technology

MA

Research System, China [CARS-49]; the Li Dak Sum Yip Yio Chin Kenneth Li Marine Biopharmaceutical Development Fund; the National 111 Project of China; and was partly

ED

supported by Laboratory of Marine Ecosystem and Biogeochemistry, Second Institute of

AC C

EP T

Oceanography, China [LMEB201705]; the K.C. Wang Magna Fund in Ningbo University.

ACCEPTED MANUSCRIPT Figure Legends Fig. 1 Effects of different light intensities and light qualities on the growth rates and Fv/Fm values of GM2 and GM3. All data are presented as the mean±SE (n=3). In the light intensity experiments (A1, A2, B1, B2), statistical significance was evaluated by one-way ANOVA, followed by Duncan’s multiple range test. Labeled means without a common letter differ (P<0.05). In the light

PT

quality experiments (C1, C2, D1, D2), statistical significance was evaluated by one-way ANOVA, followed by Dunnett's test. *P<0.05 compared with the white light group.

RI

Fig. 2 Expression levels of rbcL and SBPase in GM2 and GM3 under different light intens ities and light qualities. All data are presented as the mean±SE (n=3). In the light intensity experiments

SC

(A1, A2, B1, B2), statistical significance was evaluated by one-way ANOVA, followed by Duncan’s multiple range test. Labeled means without a common letter differ (P<0.05). In the light

NU

quality experiments (C1, C2, D1, D2), statistical significance was evaluated by one-way ANOVA, followed by Dunnett's test. *P<0.05 compared with the white light group.

MA

Fig. 3 Expression of rhodopsin in GM2 and GM3 under different light intensities and light qualities. All data are presented as the mean±SE (n=3). In the light intensity experiment (A1, A2,

ED

B1, B2), statistical significance was evaluated by one-way ANOVA, followed by Duncan’s multiple range test. Labeled means without a common letter differ (P<0.05). In the light quality

EP T

experiments (C1, C2, D1, D2), statistical significance was evaluated by one-way ANOVA, followed by Dunnett's test. *P<0.05 compared with the white light group. Fig. 4 Changes in the chlorophyll fluorescence parameters of GM2 and GM3 in response to

AC C

different light qualities. Statistical significance was evaluated by one-way ANOVA, followed by Dunnett's test. *P<0.05 compared with the white light group.

References [1] J. W. Kempton, A. J. Lewitus, J. R. Deeds, J. M. Law, A. R. Place, Toxicity of Karlodinium micrum (Dinophyceae) associated with a fish kill in a South Carolina brackish retention pond , Harmful Algae, 1(2002) 233-241. [2] J. R. Deeds, D. E. Terlizzi, J. E. Adolf, D. K. Stoecker, A. R. Place, Toxic activity from cultures of Karlodinium micrum (= Gyrodinium galatheanum)(Dinophyceae)—a dinoflagellate associated with fish mortalities in an estuarine aquaculture facility, Harmful Algae, 1(2002), 169-189.

ACCEPTED MANUSCRIPT [3] D. K. Stoecker, J. E. Adolf, A. R. Place, P. M. Glibert, D. W. Meritt, Effects of the dinoflagellates Karlodinium veneficum and Prorocentrum minimum on early life history stages of the eastern oyster (Crassostrea virginica), Marine biology, 154(2008), 81-90. [4] G. M. Hallegraeff, Ocean climate change, phytoplankton community responses, and harmful algal blooms: a formidable predictive challenge1, Journal of phycology, 46(2010), 220-235. [5] A. Mitra, K. J. Flynn, U. Tillmann, J. A. Raven, D. Caron, D. K. Stoecker, F. Not, P. J. Hansen, G. Hallegraeff, R. Sanders, S. Wilken, G. McManus, M. Johnson, P. Pitta, S. Våge, T Berge, A. Calbet, F. Thingstad, H. J. Jeong, J. Burkholder, P. M. Glibert, E. Granéli, V. Lundgren, Defining planktonic protist functional groups on mechanisms for energy and nutrient acquisition: incorporation of diverse

PT

mixotrophic strategies, Protist, 167(2016), 106-120.

[6] A.R. Place, H.A. Bowers, T.R. Bachvaroff, J.E. Adolf, J.R. Deeds, J. Sheng, Karlodinium

RI

veneficum—The little dinoflagellate with a big bite, Harmful Algae, 14 (2012) 179-195. [7] A. Li, D.K. Stoecker, J.E. Adolf, Feeding, pigmentation, photosynthesis and growth of the

SC

mixotrophic dinoflagellate Gyrodinium galatheanum, Aquatic Microbial Ecology, 19 (1999) 163-176. [8] J. Sheng, E. Malkiel, J. Katz, J.E. Adolf, A.R. Place, A dinoflagellate exploits toxins to immobilize prey prior to ingestion, Proc Natl Acad Sci U S A, 107 (2010) 2082-2087.

NU

[9] C.L. Tilney, K.D. Hoadley, M.E. Warner, Comparing the diel vertical migration of Karlodinium veneficum (dinophyceae) and Chattonella subsalsa (Raphidophyceae): PSII photochemistry, circadian control, and carbon assimilation, Journal of Photochemistry and Photobiology B: Biology, 143 (2015)

MA

107-119.

[10] N.S. Hall, H.W. Paerl, Vertical migration patterns of phytoflagellates in relation to light and nutrient availability in a shallow microtidal estuary, Marine Ecology Progress Series, 425 (2011) 1 -19. [11] C.A. Raines, J.C. Lloyd, T.A. Dyer, New insights into the structure and function of

ED

sedoheptulose-1,7-bisphosphatase; an important but neglected Calvin cycle enzyme , Journal of Experimental Botany, 50 (1999) 1-8.

[12] D.G. Kim, C. Lee, S.M. Park, Y.E. Choi, Manipulation of light wavelength at appropriate growth

EP T

stage to enhance biomass productivi ty and fatty acid methyl ester yield using Chlorella vulgaris, Bioresource Technology, 159 (2014) 240-248. [13] M. Shapira, A. Lers, P.B. Heifetz, V. Irihimovitz, C. Barry Osmond, N.W. Gillham, J.E. Boynton, Differential regulation of chloroplast gene expression in Chlamydomonas reinhardtii during

AC C

photoacclimation: light stress transiently suppresses synthesis of the Rubisco LSU protein while enhancing synthesis of the PS II D1 protein, Plant Molecular Biology, 33 (1997) 1001 -1001. [14] T. Lawson, B. Bryant, S. Lefebvre, J.C. Lloyd, C.A. Raines, Decreased SBPase activity alters growth and development in transgenic tobacco plants, Plant Cell & Environment, 29 (2006) 48 -58. [15] O. Béjà, E.N. Spudich, J.L. Spudich, M. Leclerc, E.F. Delong, Proteorhodopsin phototrophy in the ocean, Nature, 411 (2001) 786-789. [16] J.A. Fuhrman, M.S. Schwalbach, U. Stingl, Proteorhodopsins: an array of physiological roles?, Nature Reviews Microbiology, 6 (2008) 488-494. [17] D.A. Bryant, N.U. Frigaard, Prokaryotic photosynthesis and phototrophy illuminated, Trends in Microbiology, 14 (2006) 488-496. [18] R.C. Fawcett, M.W. Parrow, Mixotrophy and loss of phototrophy among geographic isolates of freshwater Esoptrodinium/Bernardinium sp.(Dinophyceae), Journal of phycology, 50 (2014) 55-70. [19] K.W. Foster, J. Saranak, N. Patel, G. Zarilli, M. Okabe, T. Kline, K. Nakanishi, A rhodopsin is the functional photoreceptor for phototaxis in the unicellular eukaryote Chlamydomonas, Nature, 311

ACCEPTED MANUSCRIPT (1984) 756-759. [20] E.G. Govorunova, K.H. Jung, O.A. Sineshchekov, J.L. Spudich, Chlamydomonas sensory rhodopsins A and B: cellular content and role in photophobic responses, Biophysical Journal, 86 (2004) 2342-2349. [21] S. Lin, H. Zhang, Y. Zhuang, B. Tran, J. Gill, Spliced leader–based metatranscriptomic analyses lead to recognition of hidden genomic features in dinoflagellates, Proceedings of the National Academy of Sciences, 107 (2010) 20033-20038. [22] G. Nagel, D. Ollig, M. Fuhrmann, S. Kateriya, A.M. Musti, E. Bamberg, P. Hegemann, Channelrhodopsin-1: a light-gated proton channel in green algae, Science, 296 (2002) 2395 -2398. marine dinoflagellate Oxyrrhis marina, PloS one, 9 (2014) e114941.

PT

[23] Z. Guo, H. Zhang, S. Lin, Light-promoted rhodopsin expression and starvation survival in the

RI

[24] X. Shi, L. Li, C. Guo, X. Lin, M. Li, S. Lin, Rhodopsin gene expression regulated by the light dark cycle, light spectrum and light intensity in the dinoflagellate Prorocentrum, Frontiers in Microbiology, 6

NU

SC

(2015). [25] D. Man, W. Wang, G. Sabehi, L. Aravind, A. F. Post, R. Massana, E. N. Spudich, J. L. Spudich, O. Béjà, Diversification and spectral tuning in marine proteorhodopsins , The EMBO journal, 22(2003), 1725-1731. [26] A. Li, D.K. Stoecker, D.W. Coats, Mixotrophy in gyrodinium galatheanum (DINOPHYCEAE): grazing responses to light intensity and inorganic nutrients*, Journal of Phycology, 36 (2000) 33 –45. [27] O.K. Okamoto, J.W. Hastings, Novel dinoflagellate clock-related genes identified through

MA

microarray analysis, Journal of Phycology, 39 (2003) 519–526.

[28] O.A. Sineshchekov, K.H. Jung, J.L. Spudich, Two rhodopsins mediate phototaxis to low- and high-intensity light in Chlamydomonas reinhardtii, Proceedings of the National Academy of Sciences of the United States of America, 99 (2002) 8689-8694.

ED

[29] T.R. Bachvaroff, J.E. Adolf, A.R. Place, Strain Variation in Karlodinium Veneficum (Dinophyceae): Toxin Profiles, Pigments, and Growth Characteristics, J Phycol, 45 (2009) 137 -153. [30] A. Calbet, M. Bertos, C. Fuentes -Grünewald, E. Alacid, R. Figueroa, B. Renom, E. Garcés,

EP T

Intraspecific variability in Karlodinium veneficum : Growth rates, mixotrophy, and lipid composition, Harmful Algae, 10 (2011) 654-667.

[31] C. Zhou, A.R. Place, X. Yan, J. Xu, Q. Luo, E. William, Y. Jiang, Interactions between Karlodinium veneficum and Prorocentrum donghaiense from the East China Sea, Harmful Algae, 49 (2015) 50-57.

AC C

[32] J.E. Adolf, D. Krupatkina, T. Bachvaroff, A.R. Place, Karlotoxin mediates grazing by Oxyrrhis marina on strains of Karlodinium veneficum, Harmful Algae, 6 (2007) 400-412. [33] J. Adolf, T. Bachvaroff, A. Place, Manger atrois: toxic vs. non-toxic Karlodinium veneficum strains with a predator, Oxyrrhis marina, and prey, Storeatula major, in Proceedings of the 12th International Conference on Harmful Algae, Copenhagen, Denmark, 2008, pp. 107-110. [34] A. Godhe, T. Rynearson, The role of intraspecific variation in the ecological and evolutionary success of diatoms in changing environments , Philosophical Transactions of the Royal Society B: Biological Sciences, 372(2017), 20160399. [35] M. Venuleo, J. A. Raven, M. Giordano, Intraspecific chemical communication in microalgae， New Phytologist, 215(2017), 516-530. [36] D. L. Erdner, M. Richlen, L. A. McCauley, D. M. Anderson, Diversity and dynamics of a widespread bloom of the toxic dinoflagellate Alexandrium fundyense, PloS one, 6(2011), e22965. [37] P. Cai, S. He, C. Zhou, A.R. Place, S. Haq, L. Ding, H. Chen, Y. Jiang, C. Guo, Y. Xu, J. Zhang, X. Yan, Two new karlotoxins found in Karlodinium veneficum (strain GM2) from the East China Sea, Harmful

ACCEPTED MANUSCRIPT algae, 58 (2016) 66-73. [38] J.E. Adolf, T. Bachvaroff, A.R. Place, Can cryptophyte abundance trigger toxic Karlodinium veneficum blooms in eutrophic estuaries?, Harmful Algae, 8 (2008) 119-128. [39] A. Li, D.K. Stoecker, D.W. Coats, Spatial and temporal aspects of Gyrodinium galatheanum in Chesapeake Bay: distribution and mixotrophy, Journal of Plankton Research, 22 (2000) 2105 -2124. [40] A. Skovgaard, Mixotrophy in Fragilidium subglobosum (Dinophyceae): growth and grazing responses as functions of light intensity, Marine Ecology Progress Series, (1996) 247 -253. [41] A. Skovgaard, A phagotrophically derivable growth factor in the plastidic dinoflagella te Gyrodinium resplendens (Dinophyceae), Journal of Phycology, 36 (2000) 1069-1078.

PT

[42] T. Berge, P.J. Hansen, Ø. Moestrup, Feeding mechanism, prey specificity and growth in light and dark of the plastidic dinoflagellate Karlodinium armiger, Aquatic Microbial Ecology, 50 (2008) 279-288.

RI

[43] T.A. Rynearson, E. Virginia Armbrust, Genetic differentiation among populations of the planktonic marine diatom Ditylum brightwellii (Bacillariophyceae), Journal of Phycology, 40 (2004) 34-43.

SC

[44] Y.-C. Jeon, C.-W. Cho, Y.-S. Yun, Combined effects of light intensity and acetate concentration on the growth of unicellular microalga Haematococcus pluvialis, Enzyme and Microbial Technology, 39 (2006) 490-495.

NU

[45] M.C. García-Malea, C. Brindley, E.D. Río, F.G. Acién, J.M. Fernández, E. Molina, Modelling of growth and accumulation of carotenoids in Haematococcus pluvialis as a function of irradiance and nutrients supply, Biochemical Engineering Journal, 26 (2005) 107-114.

MA

[46] C.-Y. Wang, C.-C. Fu, Y.-C. Liu, Effects of using light-emitting diodes on the cultivation of Spirulina platensis, Biochemical Engineering Journal, 37 (2007) 21-25. [47] W. Fu, G. Ólafur, P. Giuseppe, H. Gísli, Ó.S. Andrésson, B.Ø. Palsson, B. Sigurður, Enhancement of carotenoid biosynthesis in the green microalga Dunaliella salinawith light-emitting diodes and

ED

adaptive laboratory evolution, Applied microbiology and biotechnology, 97 (2013) 2395 -2403. [48] P.H. Ravelonandro, D.H. Ratianarivo, C. Joannis -Cassan, A. Isambert, M. Raherimandimby, Influence of light quality and intensity in the cultivation of Spirulina platensis from Toliara

EP T

(Madagascar) in a closed system, Journal of Chemical Technology & Biotechnology, 83 (2008) 842 -848. [49] D.G. Kim, C. Lee, S.-M. Park, Y.-E. Choi, Manipulation of light wavelength at appropriate growth stage to enhance biomass productivity and fatty acid methyl ester yield using Chlorella vulgaris,

AC C

Bioresource Technology, 159 (2014) 240-248. [50] P. J. Keeling, The endosymbiotic origin, diversification and fate of plastids , Philosophical Transactions of the Royal Society of London B: Biological Sciences, 365(2010), 729-748. [51] T. Tengs, O. J. Dahlberg, K. Shalchian-Tabrizi, D. Klaveness, K. Rudi, C. F. Delwiche, K. S. Jakobsen, Phylogenetic analyses indicate that the 19′ hexanoyloxy-fucoxanthin-containing dinoflagellates have tertiary plastids of haptophyte origin, Molecular Biology and Evolution, 17(2000), 718-729. [52] O. M. Finkel, O. Béja, S. Belkin, Global abundance of microbial rhodopsins , The ISME journal, 7(2013), 448. [53] A. Pushkarev, G. Hevroni, S. Roitman, J. G. Shim, A. Choi, K. H. Jung, O. Béjà, The Use of a Chimeric Rhodopsin Vector for the Detection of New Proteorhodopsins Based on Color ， Frontiers in microbiology, 9(2018), 439. [54] C. H. Slamovits, N. Okamoto, L. Burri, E. R. James, P. J. Keeling, A bacterial proteorhodopsin proton pump in marine eukaryotes , Nature communications, 2(2011), 183. [55] D. Lu, J. Goebel, Y. Qi, J. Zou, X. Han, Y. Gao, Y. Li, Proro centrum donghaiense – a high biomass bloom-forming species in the East China Sea, IOC Newsl. Toxic Algae Algal Bloom. 23 (2002) 1–5. [56] X.F. Dai, D.D. Lu, W.B. Guan, H.X. Wang, P.X. He, P. Xia, H.J. Yang. Newly recorded Karlodinium veneficum dinoflagellate blooms in stratified water of the East China Sea, Deep Sea Research Part II:

ACCEPTED MANUSCRIPT Topical Studies in Oceanography, 101 (2014) 237-243. [57]H. L. Huang, Q. W. Shao, X. J. Zhu, J. Luo, R. Meng, C. X. Zhou, P. Zhu, Y. F. Zhu, X. J. Yan, Distribution of Karlodinium veneficum in the coastal region of Xiangshan Bay in the East China Sea, as detected by a real-time quantitative PCR assay of ribosomal ITS sequence, Harmful algae, 81(2019), 65-76. [58] T. Matsubara, S. Nagasoe, Y. Yamasaki, T. Shikata, Y. Shimasaki, Y. Oshima, T. Honjo, Effects of temperature, salinity, and irradiance on the growth of the dinoflagellate Akashiwo sanguinea. Journal of Experimental Marine Biology and Ecology, 342(2007), 226-230. [59] E. Janik, W. Grudziński, W.I. Gruszecki, Z. Krupa, The xanthophyll cycle pigments in Secale cereale leaves under combined Cd and high light stress conditions, Journal of Photochemistry & Photobiology

PT

B Biology, 90 (2008) 47-52.

[60] Y. Cui, H. Zhang, S.J. Lin, Enhancement of non-photochemical quenching as an adaptive stra tegy

RI

under phosphorus deprivation in the dinoflagellate Karlodinium veneficu m, Frontiers in Microbiology,

AC C

EP T

ED

MA

NU

SC

8 (2017).

ACCEPTED MANUSCRIPT

Table 1 Real-time PCR primers used in this study Accession

Forward (5′-3′)

Reverse (5′-3′)

rbcL

AF463410.2

CGGGAAAGGTTTTTATTCTCTATG

GCTTCCATTGTTGCTCCAGT

SBPase

MK360905

TGGTGACAGTTGCGGACGAT

TTCACGAACTTCTGGCTCCTCTT

rhodopsin

MK360904

TCCTTGAACTTGGCGTATGACTTG

TCCTTCTCTGCGGTGGTCTTC

calm

KM275627.1

GAAGTTGATGCCGACGGTAAT

GCTTCTCGCCTAAGTTTGTCAT

gapdh

DQ867061.1

GATGCTGTGCCAATCTATGTG

PT

Gene

AC C

EP T

ED

MA

NU

SC

RI

GTCGTCATCAAGCCCTCCT

ACCEPTED MANUSCRIPT Fig. 1

T P

I R

C S

U N

D E

T P

C A

E C

A M

ACCEPTED MANUSCRIPT

Fig. 2

T P

I R

C S

U N

D E

T P

C A

E C

A M

ACCEPTED MANUSCRIPT

Fig. 3

T P

I R

C S

U N

D E

T P

C A

E C

A M

ACCEPTED MANUSCRIPT

AC C

EP T

ED

MA

NU

SC

RI

PT

Fig. 4

ACCEPTED MANUSCRIPT

Highlights: 1. Different intraspecific responses to light were observed in the ecotype strains. 2. Light-related gene regulation can show completely opposite intraspecific patterns. 3. Upregulation of photosynthetic genes may compensate for photochemical loss.

PT

4. Red light promoted gene expression of rhodopsin in K. veneficum.

AC C

EP T

ED

MA

NU

SC

RI

5. K. veneficum has high-light and low-light ecotypes.