Cronobacter sakazakii CICC 21544 responds to the combination of carvacrol and citral by regulating proton motive force

LWT - Food Science and Technology 122 (2020) 109040

Contents lists available at ScienceDirect

LWT - Food Science and Technology journal homepage: www.elsevier.com/locate/lwt

Cronobacter sakazakii CICC 21544 responds to the combination of carvacrol and citral by regulating proton motive force

T

Yifang Caoa,1, Ailian Zhoua,1, Donggen Zhoub, Xinglong Xiaoa,∗, Yigang Yua, Xiaofeng Lic,∗∗ a

School of Food Science and Engineering, South China University of Technology, Guangzhou City, Guangdong Province, 510640, China Ningbo International Travel Healthcare Center. No.336 Liuting Street, Haishu District, Ningbo City, Zhejiang province, 315012, China c State Key Laboratory of Pulp and Paper Engineering, College of Light Industry and Food Sciences, South China University of Technology, 381Wusan Road, Tianhe District, Guangzhou City, 510640, Guangdong Province, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Cronobacter sakazakii Stress response mechanism Transcriptome sequencing Citral Carvacrol

Response mechanism of Cronobacter sakazakii under stress of combination of citral and carvacrol was investigated by transcriptome sequencing. Twenty-five significantly differentially expressed genes were identified to be closely related to the ability of C. sakazakii tolerating the stress after analysis, mainly involving glycerol metabolism; citrate metabolism; formate metabolism; ribosome function and transmembrane transport system. Combination of carvacrol and citral could cause dissipation of proton motive force (PMF) and the psp regulon is an important switch in the response of C. sakazakii to this condition. To maintain PMF, psp regulated cellular processes to reduce the consumption of cellular energy for cell membrane repair and proton consumption. In T1 group (low concentration group), C. sakazakii remained aerobic metabolism and expression of glycerol metabolism related genes were upregulated for cell membrane repair and proton consumption. In T2 group (high concentration group), bacteria convert from aerobic metabolism to anaerobic metabolism to reduce energy consumption and expression of genes in formate metabolism were upregulated to consume excessive intracellular protons; citrate lyase-related genes were upregulated to decompose citrate, the intermediate of the tricarboxylic acid cycle, to generate acetyl CoA for production of cell membrane phospholipids.

Chemical compounds cited in this article: Carvacrol PubChem CID: 10364 Citral PubChem CID: 638011 Ethanol PubChem CID: 702 SYBR GERRN Ⅰ PubChem CID: 56841760

1. Introduction Cronobacter sakazakii, a species of Cronobacter genus, is a bacterium that can cause a rare but often fatal infection of the bloodstream. The disease such as bacteremia, meningitis and necrotizing enterocolitis can cause a high case fatality rate (40–80%) (Du, Wang, Dong, Li, & Wang, 2018; Yi et al., 2018). The bacteria caused infection in all age groups, infants with weakened immune systems, and particularly premature infants with a higher risk (Fei et al., 2018). C. sakazakii has been isolated from a range of food and environmental sources, such as dry food, ready-to-eat food and so on. However, the major contamination source is in powdered infant formula (PIF) (Hu, Yu, & Xiao, 2018). Therefore, C. sakazakii posed a severe risk to susceptible consumers. In recent years, various natural compounds have attracted more attention to inhibit foodborne pathogens. Natural compounds are mainly extracted from diverse plants and the extracts are considered as

safe, nontoxic and strong antibacterial (Ju et al., 2018). Black chokeberry, thymoquinone, tea polyphenols, citral, carvacrol, trans-cinnamaldehyde, and p-cymene have been investigated for inactivating C. sakazakii (Denev, Ch, Ciz, Lojek, & Kratchanova, 2012; Frankova et al., 2014; Li et al., 2016). Among them, citral and carvacrol are two effective bacteriostatic agents commonly used to inactive pathogens (Frankova et al., 2014; Lee, Kim, & Lee, 2017; Shi et al., 2017). However, high concentrations of natural substances were required to achieve effective antimicrobial activities, thus generating inappropriate flavors and odors (Gutierrez, Rodriguez, Barry-Ryan, & Bourke, 2008). Kostaki found that combination of thyme oil and modified atmosphere packaging could improve the sensory quality of sea fillets (Kostaki, Giatrakou, Savvaidis, & Kontominas, 2009). Therefore, combination of different natural substances might help reduce the dosages for effective bactericidal activity and detrimental effect of these substances on sensatory properties of food products. Several researches have proposed

∗

Corresponding author. Corresponding author. E-mail addresses: [email protected] (X. Xiao), xfl[email protected] (X. Li). 1 These authors contributed equally to this article. ∗∗

https://doi.org/10.1016/j.lwt.2020.109040 Received 27 September 2019; Received in revised form 9 January 2020; Accepted 10 January 2020 Available online 11 January 2020 0023-6438/ © 2020 Elsevier Ltd. All rights reserved.

LWT - Food Science and Technology 122 (2020) 109040

Y. Cao, et al.

was purified using a Ribo-Zero Magnetic kit (EpiCentre) to remove rRNA. Construction of cDNA library was completed as Hu described (Hu, Yu, Zhou, et al., 2018).

that citral or carvacrol might perturb membrane potential and intracellular pH when interacting with bacteria (Custódio, Ribeiro, Silva, Machado, & Sousa, 2011; Gupta et al., 2017), but how bacteria respond to stress of citral and carvacrol remains unclear. Therefore, based on the data from transcriptomics, this study aims to investigate the bacterial responses to combination of citral and carvacrol, in order to explore the molecular mechanism and key pathways or genes involved in.

2.5. Read alignment and normalization of gene expression levels Filtration of the original sequencing data (raw data) was performed as described by Li et al. (Y. R. Li et al., 2018). Short reads alignment tool Bowtie2 was used to map clean reads to reference genome of C. sakazakii ATCC BAA-894. FPKM (fragments per kilobase of exon model per million reads mapped) method was used to normalize estimation of gene expression based on RNA-seq data (Hu, Yu, Zhou, et al., 2018).

2. Material and methods 2.1. Bacteria strain and growth conditions C. sakazakii CICC 21544, was obtained from China Center of Industrial Culture Collection (CICC). Stock culture of C. sakazakii CICC 21544 was maintained in Tryptic Soy Broth (TSB) with 20% glycerol at −80 °C. Activation of C. sakazakii was achieved by streaking stock culture onto Tryptone Soy Agar (TSA) and incubated for 24 h at 37 °C, and then a single colony from TSA was grown in 100 mL TSB media to reach log phase on a shaker at 280 rpm at 37 °C. Finally, the cells were diluted with TSB media to get a final concentration of 6 log10 CFU/mL.

2.6. Differentially expressed genes (DEGs) and enrichments analysis Differentially expressed genes (DEGs) were calculated by edgeR software to reduce errors. The false discovery rate (FDR) method was used to obtain the adjusted p value of gene expression in multiple samples, two criteria were screened during this process: a threshold of the FDR < 0.05 and an absolute value of log2FC > =1. Gene Ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) databases were used for enrichment analysis of differentially expressed genes (Tian et al., 2018), an adjusted p-value ≤ 0.05 was considered as significant change in DEGs.

2.2. Subinhibitory concentrations of combination of citral and carvacrol Citral and carvacrol were purchased from Shanghai Macklin Biochemical Co., Ltd. and dissolved in 50% ethanol, and then sterilized through a 0.22 μm filter (JinTeng, Guangzhou, CN). Minimum inhibitory concentration (MIC) of carvacrol and citral against C. sakazakii was 0.1 and 0.8 mg/mL, respectively (determined in the preliminary experiment). Synergistic effect between citral and carvacrol against C. sakazakii has also been determined in the preliminary experiment. Fractional inhibitory concentration index (FICI) of citral and carvacrol was 0.5, under the condition that both compounds are at the concentration of their 1/4 MIC. Subinhibitory concentrations of combination of citral and carvacrol were evaluated using a microtiter broth dilution method (Mirzaei-Najafgholi, Tarighi, Golmohammadi, & Taheri, 2017). Different amount citral and carvacrol were added into suspension of C. sakazakii, which was prepared as described above, to get final concentrations (1/8 MIC + 1/8 MIC; 1/7 MIC + 1/7 MIC; 1/6 MIC + 1/6 MIC; 1/5 MIC + 1/5 MIC; 1/4 MIC + 1/4 MIC). Sample without natural substances was considered as control. And then samples were incubated at 37 °C for 24 h. The absorbance was measured at 600 nm.

2.7. Quantitative reverse transcriptional PCR (qRT-PCR) validations In order to validate results of RNA-seq, ten DEGs were randomly selected for qRT-PCR analysis. SYBR® Green (Thermo Fisher, Guangzhou, CN) based qPCR method was used in this study and primers were designed using PrimerSelect software and listed in Table 1. Total RNA of each sample was extracted using TRIzol reagent (Invitrogen, Shanghai, CN) according to the manufacturer's protocol, and the RNA was then subsequently reverse-transcripted into cDNA for PCR procedure. The atpD gene of C. sakazakii was used as the internal control (Baldwin et al., 2009). PCR procedure was operated as described by Li et al. (Y. R. Li et al., 2018). 2.8. Statistical analysis Each experiment was performed in triplicates. Independent Student's t-test was used for the analysis. Differences were considered Table 1 Primers used for qRT-PCR validations.

2.3. Sample preparation According to the determined subinhibitory concentrations, experiments consisted of three groups: CK, T1 and T2. CK represented control group without natural substances, T1 represented group with low subinhibitory centration of combination of citral and carvacrol (1/6 MIC + 1/6 MIC), T2 represented high subinhibitory centration of combination of citral and carvacrol (1/5 MIC + 1/5 MIC). Different amount citral and carvacrol were added into suspension of C. sakazakii to get final concentrations of T1 and T2, and incubated at 37 °C for 8 h. After that, the cells were centrifugated at 6000×g for 2 min to remove residual TSB, and then quenched using liquid nitrogen and stored at −80 °C before RNA extraction.

Gene name

Primers (5′-3′)

Reference

atpD

F,CGACATGAAAGGCGACAT R,TTAAAGCCACGGATGGTG F,CCGATACCGATAGCGCCGTA R,GCGGACATCCATGACAGACA F,GGCGGGCGAGCTGGAGATAG R,CGGGCGCGGATAACACAAT F,ATTAAAGGCGTGGCGGTGGATG R,ACGCGTGCAGAGGAACAGGTGA F,GCCGGGCCGATATTGCTGTAA R,GTCGGTCTTCGGCGGTAAACTCA F,CGTCGCGGCGGGCTATC R,ACGGGCTGTGCTTCTTTCTCTTTG F,GGCGCGGTGATGGCAGAGA R,GTACGGCGCGATGGAAGTTGTG F,GCCGCCGTTGCCGTTCATAC R,GGCAATCGCAGCGTGTTCTTCTAA F,CCTGCAGGGTTGGGGCTACT R,GCGCTCGATAATCACGTCTTCTTT F,GCTGTGCCGGCTACCAAGAAAAAC R,GTAACAGAGCCCAGCGCATTGATT F,GCCGCGCACCTGGATGTC R,GTTCGTCGCGGGTTTTGTCG

Baldwin et al. (2009)

ompC citD citC glpD hycA hydN

2.4. RNA isolation and library construction

pal

The total bacterial RNA was extracted using TRIzol® Reagent (Invitrogen, Shanghai, CN) from three group samples. The concentration and purity of the isolated RNA were detected using Nanodrop2000. Integrity and quality of RNA were analyzed with agarose gel electrophoresis and Agilent2100 Bio-analyzer (Agilent Technologies, Guangzhou, CN). After receiving quality-qualified bacterial RNA, RNA

ppiB rplI potA

2

Kothary et al. (2017) This study This study This study This study This study This study This study This study This study

LWT - Food Science and Technology 122 (2020) 109040

Y. Cao, et al.

Fig. 1. Subinhibitory concentrations of synergistic combination of carvacrol and citral against C. sakazakii.

significant when p < 0.05. Figures presented in this paper were plotted using Microsoft Excel software. 3. Results

Fig. 2. Venn diagrams of DEGs. The venn diagram represent the unique and common changes in the expression level of DEGs in CK, T1 and T2 groups.

3.1. Determination of subinhibitory concentrations

metabolic process in the biological process category, DEGs in T2 group were mainly enriched in macromolecular complex and oxidoreductase complex in the cellular component category.

As shown in Fig. 1, compared with the control group, growth of C. sakazakii was inhibited when citral and carvacrol were at a concentration of their 1/5 MIC or 1/6 MIC; but when their concentrations dropped to 1/7 MIC or 1/8 MIC, the combination showed no growth inhibition of C. sakazakii. Therefore, 1/6 MIC +1/6 MIC and 1/5 MIC +1/5 MIC were considered as the sublethal concentrations of carvacrol and citral.

3.5. KEGG analysis Compared with CK, the DEGs in group T1 were matched to 5 different KEGG pathways, including plant-pathogen interaction, glycerolipid metabolism, glycerophospholipid metabolism, ribosome and two-component system, among which plant-pathogen interaction, glycerolipid metabolism and glycerophospholipid metabolism were significantly enriched. For the comparison of CK and T2, the DEGs were matched to 10 different KEGG pathways, mainly including citrate cycle, ribosome and two-component system. Based on the data obtained, 25 genes were considered as the most important genes associated with response to combination of citral and carvacrol (Table 2), mainly involved in pathways such as catalytic activity, oxidation-reduction process, glycerophospholipid metabolism and acyl-CoA metabolic process.

3.2. Data processing and analysis Using the Illumina sequencing platform, a total of 24,265,842, 16,075,284 and 14,607,668 raw reads were collected from CK, T1 and T2 group, respectively, after rigorous filtration, 23,985,086, 15,863,724 and 14,404,022 clean reads were collected accordingly. Of these, 20,596,830 (CK), 13,893,489 (T1) and 12,243,356 (T2) reads mapped to the reference genome. And mapped ratio of CK, T1 and T2 was 85.87%, 87.58% and 85.00%, respectively. Thus, these data were of high quality for further analysis. 3.3. Differentially expressed genes

3.6. qRT-PCR validation Compared to CK, 21 genes were differentially expressed in T1, among which 7 genes showed upregulations and 14 were downregulated. As for comparison of CK and T2, 28 DEGs were identified in T2, with 17 upregulated and 11 downregulated. Compared with T1, a total of 6 DEGs were found in T2, among which 5 were upregulated and 1 was repressed. The distribution of differentially expressed genes in each group was revealed in Venn diagrams (Fig. 2). Compared with CK, the expression of 7 DEGs were found significantly changed both in group T1 and T2. However, the other 14 DEGs identified in T1 group were completely different from the other 21 DEGs identified in T2 group, indicating that different response would C. sakazakii react when cells were treated with different concentrations of antimicrobials.

The correlation between results of qRT-PCR and RNA-seq is shown in Fig. 3. The expression of 10 randomly selected genes were well correlated between qRT-PCR and RNA-seq (R2 = 0.8929). Thus, the results of RNA-seq were reliable. 4. Discussion Cronobacter sakazakii is a pathogenic bacterium associated with a rare cause of invasive infection for infants (Holy et al., 2014). Natural substances have been explored as alternative treatments for C. sakazakii recently (Goel & Mishra, 2018). In the present study, we aimed to investigate the responses of C. sakazakii to combination of citral and carvacrol by RNA-seq. Identified DEGs and functional analysis such as KEGG and GO annotation are shown in Fig. 4. Compared to CK group, 21 DEGs were identified in T1 group. Among them, 8 DEGs have been annotated in KEGG database. OmpC, glpF, glpK, pspB, glpD were related to cell envelope function; rplI was related to ribosomal function; potA and ppiB were related to other functions. Twenty-eight DEGs were identified in T2 group compared to CK group and 22 DEGs were annotated in KEGG database. OmpC, pal and glpD were related to cell

3.4. GO analysis of DEGs After significant analysis of GO function for differential genes, we found 16 DEGs annotated to biological process and cellular component, 4 DEGs annotated to molecular function (data not shown). In addition, DEGs in three groups were also enriched in specific GO terms of three GO categories. Compare to CK, DEGs in group T1 were significantly enriched in glycerol-3-phosphate process and alditol phosphate 3

LWT - Food Science and Technology 122 (2020) 109040

Y. Cao, et al.

Table 2 Significantly differentially expressed genes involved in citral & carvacrol stress tolerance. Gene ID

Gene name

Cell envelope ESA_00974 ompC ESA_02604 pal ESA_03834 glpF ESA_03835 glpK ESA_04316 glpA, glpD ESA_01599 pspB TCA cycle ESA_00320 citC ESA_00321 citD ESA_00322 citE ESA_00324 citF ESA_00318 citS Formate metabolism ESA_02072 hypC ESA_02059 hydN ESA_02068 hycB ESA_02069 hycA ESA_02058 fdoG, fdfH Ribosomal ESA_00203 rplI ESA_00020 rpsH ESA_02814 rpmE ESA_04403 tuf, tufM ABC transporters ESA_01088 mglB ESA_01932 potA Others ESA_01411 pphA ESA_02761 PPIB ESA_00319 mhpD

Fold change log2FC

P-value

FDR

Annotation

CK vs T1

CK vs T2

CK vs T1

CK vs T2

CK vs T1

CK vs T2

3.03 / 2.72 2.8 4.21 2.46

2.66 9 / / 3.55 /

1.15E-05 / 6.28E-05 4.05E-05 9.33E-09 2.73E-04

6.56E-05 3.00E-16 / / 4.07E-07 /

5.48E-03 / 1.49E-02 1.09E-02 1.77E-05 4.91E-02

1.24E-02 1.14E-12 / / 3.08E-04 /

outer membrane pore protein C Peptidoglycan-associated lipoprotein glycerol uptake facilitator protein Glycerol kinase Glycerol-3-phosphate dehydrogenase phage shock protein B

/ / / / /

2.58 3.17 2.64 2.78 2.42

/ / / / /

1.04E-04 6.91E-06 8.19E-05 5.14E-05 2.37E-04

/ / / / /

1.65E-02 2.70E-03 1.41E-02 1.15E-02 3.45E-02

[Citrate [pro-3S]-lyase] ligase citrate lyase subunit gamma (acyl carrier protein) Citrate (Pro-3S)-lyase subunit/citryl-CoA lyase citrate lyase subunit alpha/citrate CoA-transferase Citrate/malate transporter

/ / / / /

3.29 2.8 2.75 2.33 2.63

/ / / / /

8.56E-06 3.22E-05 4.34E-05 3.53E-04 7.74E-05

/ / / / /

2.70E-03 8.14E-03 1.03E-02 4.77E-02 1.40E-02

hydrogenase assembly chaperone formate dehydrogenase-H ferredoxin subunit, electron transport protein HydN formate hydrogenlyase subunit 2 formate hydrogenlyase regulatory protein HycA formate dehydrogenase/H/subunit alpha

11.86 / / /

10 −2.91 −3.45 3.257

3.07E-15 / / /

2.24E-10 8.99E-05 7.90E-06 3.08E-05

1.16E-11 / / /

4.25E-07 1.48E-02 2.70E-03 8.14E-03

50S ribosomal protein L9 30S ribosomal protein S8 50S ribosomal protein L31 type B Elongation factor Tu; Short = EF-Tu

/ −6.73

−2.96 −6.73

/ 1.17E-05

5.52E-05 7.72E-06

/ 5.48E-03

1.16E-02 2.70E-03

D-galactose-binding

/ 7.8 /

−2.76 7.98 3.23

/ 5.22E-08 /

1.80E-04 7.83E-09 2.91E-06

/ 6.58E-05 /

2.72E-02 9.89E-06 1.74E-03

serine/threonine protein phosphatase peptidyl-prolyl cis-trans isomerase B 2-keto-4-pentenoate hydratase

periplasmic protein putative spermidine/putrescine transport system

/, represents no significant expression of differential genes (p > 0.05).

4.1. Dissipation of PMF

envelope function; citC, citD, citE, citF and citS were related to TCA cycle process; hypC, hydN, hycA, hycB and fdfH were related to formate metabolism process; rplI, rpsH, rpmE and tufM were related to ribosomal function; mglB, potA, mhpD, pphA and ppiB were related to other functions. The following four aspects are considered as the mechanisms underlying the response of C. sakazakii to the citral & carvacrol stress (Fig. 5).

According to our results, phage shock protein pspB was upregulated 2.46 log2(FC) in T1 group (Table 2). The phage shock protein (Psp) response is one of the gram-negative envelope stress responses (ESRs) to antimicrobial agents induced by dissipation of proton motive force (PMF) (Guest & Raivio, 2016). The psp regulon comprises seven genes (pspA-pspG). It was proposed that PspBC proteins were sensors of inner membrane (IM) destruction stress, which was related to proton motive force (PMF) dissipation, PspBC proteins senses the signal of PMF

Fig. 3. RT-qPCR validations. 4

LWT - Food Science and Technology 122 (2020) 109040

Y. Cao, et al.

Fig. 4. Transcript profiles of genes enhancing tolerance of citral & carvacrol stress in C. sakazakii.

Fig. 5. Model for the regulation of citral and carvacrol stress in C. sakazakii. Genes marked in red were significantly upregulated, genes marked in blue were significantly downregulated. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Bennik, & Moezelaar, 2002) investigated the possible mechanism of carvacrol against foodborne pathogen Bacillus cereus and hypothesized that carvacrol may act as a proton exchanger, dissipate proton motive force (PMF), thereby leading to cell death. Researches related to citral against pathogens found that citral would affect the membrane potential, intracellular pH and ATP synthesis of bacteria (Gupta et al., 2017; Shi et al., 2017), which indicated that citral might have the antibacterial mechanism of dissipating PMF, thereby inhibiting growth of bacteria. In our results, among psp regulon related genes, only pspB was significantly upregulated in T1 group. In T2 group, expression of pspB showed no significant change, but it was also upregulated 1.68 log2(FC). In addition, Upregulation of pspA, pspC and pspD were also

dissipation which will trigger releasing of PspA. PspA is a negative regulator; PspA and PspF coexist in the form of complexes under nonstressful growth conditions; once PspA is released, expression of PspF would be negatively regulated. Subsequently, Psp effectors PspA, PspD, and PspG will regulate cellular processes to maintain PMF (Joly et al., 2010). Both citral and carvacrol are essential oils with comparable hydrophobicity; many studies suggested that carvacrol-like phenolic compounds could interact with phospholipid-related acyl chains, thus perturbating the arrangement and stability of phospholipid bilayer, which would cause outer membrane (OM) disintegration and inner membrane (IM) damage (Ben Arfa, Combes, Preziosi-Belloy, Gontard, & Chalier, 2006; Marinelli, Stefano, & Cacciatore, 2018). Ultee et al. (Ultee, 5

LWT - Food Science and Technology 122 (2020) 109040

Y. Cao, et al.

membrane (Bhagavan & Ha, 2011; Yao & Rock, 2015). Therefore, it is proposed that in T2 group, PL of cell membrane was severely damaged by citral and carvacrol. In this case, citrate carrier (citS) and citrate lyase (citC, citD, citE and citF) were upregulated, thus promoting the formation of acetyl CoA and facilitating the production of PL to repair cell membranes.

observed in T1 and T2 group, pspF was downregulated in T1 and T2 groups (see Table A1). Therefore, we speculate that the combination of carvacrol and citral will lead to PMF dissipation, thus activating psp regulon. Subsequently, cellular processes would be regulated by psp regulon in the following three aspects to keep PMF maintenance. 4.2. Reduce energy consumption

4.4. Proton consuming It was reported that cell metabolism would be converted from aerobic metabolism to anaerobic metabolism when Psp response is activated, thereby reducing PMF-consuming processes (such as aerobic metabolism) to maintain PMF (Jovanovic, Lloyd, Stumpf, Mayhew, & Buck, 2006). Reducing unnecessary metabolism under stress conditions to maintain cellular energy is a strategy for bacterial resistance. In T2 group, the metabolism of C. sakazakii is converted to anaerobic metabolism (see 4.4 proton consuming) to reduce cellular energy consumption. In addition, Joly et al. (Joly et al., 2010) found that under external stress, PspA and PspD proteins would decrease expression of genes involved in the process of dissipating PMF (energy-consuming process), such as motility-related genes. In our results, energy-consuming protein associated genes mglB and potA were downregulated. Therefore, it can be proposed that C. sakazakii responded to stress of citral and carvacrol by reducing unnecessary energy consumption processes of cells to maintain necessary biological processes.

In our results, glpD was upregulated 4.21 and 3.55 log2(FC) in T1 and T2 group, respectively. In bacterial cells, the glpD-encoded glycerol3-phosphate dehydrogenase is localized to the inner-membrane and exhibits membrane-dependency for activity. The GlpD plays an important role in the respiratory electron transport chain, which catalyzes the oxidation of G3P to dihydroxyacetone phosphate (DHAP), with proton pumped out of cell through inner-membrane, and passes electrons on to ubiquinone (UQ) and ultimately to oxygen or nitrate (Yeh, Chinte, & Du, 2008). As G3P shuttle is of great importance in organisms, two isoforms of GlpD ensure that proton is pumped through respiratory electron transport chain while lipid biosynthesis is not disrupted (Yeh et al., 2008). It has been discussed earlier in this article that citral or carvacrol could decrease intracellular pH of cells. In this study, we supposed that citral and carvacrol caused decline of pHin, dehydrogenase gene glpD was regulated to pump proton out, thereby maintaining pHin homeostasis and PMF. In T2 group, genes associated with formate metabolism were upregulated, including hycA, hycB, hypC, hydN and fdfH. Among them, hycA encodes regulation protein of hyc operon, hycB encodes small subunit of FDH-H, fdfH encodes large subunit of FDH-H, hydN encodes electron transport protein and hypC contributes to maturation of hydrogenase (hyd) (Table 2). In our results, formate was converted into CO2 and H2 via formate hydrogen-lyase (FHL) complex and the formate dehydrogenase-H (FDH-H) plays the predominant role. It has been reported that genes (hydN, fdfH) associated with formate dehydrogenaseH would not be expressed unless cells physiological situations satisfy three conditions: anaerobic conditions, more acidic pH and absence of nitrate (Sinha, Roy, & Das, 2015). It was reported that upregulated expression of pspF could inhibit genes associated with formate dehydrogenase and formate metabolism (Jovanovic et al., 2006). In our results, upregulation of pspA and downregulation of pspF may promote expression of formate metabolism-related genes, thereby reducing intracellular pH. Therefore, in T2 group, cell metabolism is converted from aerobic metabolism to anaerobic metabolism under the regulation of psp regulon, in this case, the excess protons are converted into hydrogen, thereby maintaining pHin homeostasis and PMF.

4.3. Membrane repairing The cell envelope of Gram-negative bacteria consists of three elements: an asymmetrical outer-membrane composed of lipopolysaccharide (LPS) and phospholipid (PL), a periplasm and a symmetrical inner-membrane composed of phospholipid. The outer-membrane of cell envelope acts as a selective barrier to harsh environments. In this study, outer-membrane protein ompC gene was upregulated 3.03 and 2.66 log2(FC) in T1 and T2 group, respectively (Table 2). Several reports have proposed that increasing transcription level of ompC contributes to the tolerance of bacteria under organic solvent (Begic & Worobec, 2006; Kaeriyama et al., 2006). Inner membrane (IM) is the place for electron transport and oxidative phosphorylation, it's also a place for sensing external signals which were then transduced to the transcriptional regulation machinery within the cytoplasm, and thus IM functions are crucial for survival of the bacteria under stress. In T1 group, expression of glpF, glpK and glpD were upregulated, these genes are associated with glycerol metabolism. GlpF acts as the glycerol facilitator (Blotz & Stulke, 2017), once glycerol was imported into cells, the reductive and oxidative pathway are two forms of glycerol utilization in bacteria. In this study, glycerol kinase encoded by glpK involved in the glycerol metabolism in the oxidative pathway, was upregulated to enhance catalysis of glycerol to glycerol-3-phosphate (G3P). Xue et al. proposed that G3P is required for triacylglycerol biosynthesis, and then contributes to PL production (Xue, Chen, & Jiang, 2017). In T1 group, glpF and glpK were upregulated 2.72 log2(FC) and 2.8 log2(FC), respectively. It is possible that citral and carvacrol destroyed the PL of cell membrane, thus inducing overexpression of glpF and glpK to promote the production of new PL. While in T2 group, genes associated with citrate fermentation were all upregulated, including citC, citD, citE, citF and citS. Among them, citD, citE and citF encode for three subunits of citrate lyase, citC encodes for citrate lyase ligase and CitS acts as citrate carrier (Meyer, Dimroth, & Bott, 1997). In TCA cycle, citrate is synthesized from oxaloacetate and acetyl CoA. However, in the cytoplasm, citrate would also be metabolized to acetyl CoA in the presence of acetyl CoA carboxylase or citrate lyase (Phan et al., 2017). In addition, citrate shuttle is an important pathway to generate cytosolic acetyl-CoA under the catalysis of citrate lyase in eukaryotic cells (Bhagavan & Ha, 2011). It was reported that acetyl CoA is a crucial precursor for the synthesis of PL of cell

5. Conclusion In conclusion, the present study demonstrates the responses of C. sakazakii to combination of citral and carvacrol. Inner membrane would be impaired under the stress of citral and carvacrol, thus activating Psp response to maintain PMF. In T1 group (low concentration group), genes related to glycerol shift was upregulated to repair membrane and consume proton. In T2 group (high concentration group), cell metabolism was switched to anaerobic respiration to maintain energy and PMF. In addition, protons were converted to hydrogen through formate metabolism, acetyl-CoA was generated to produce phospholipids for membrane repairing. Therefore, in the presence of Psp response, energy maintenance, membrane repair and proton consuming are three important aspects to maintain PMF in C.sakazakii. CRediT authorship contribution statement Yifang Cao: Conceptualization, Data curation, Investigation, Writing - original draft. Ailian Zhou: Formal analysis, Investigation. Donggen Zhou: Formal analysis, Funding acquisition. Xinglong Xiao: 6

LWT - Food Science and Technology 122 (2020) 109040

Y. Cao, et al.

Conceptualization, Writing - review & editing, Supervision, Funding acquisition. Yigang Yu: Formal analysis, Funding acquisition. Xiaofeng Li: Writing - review & editing, Funding acquisition.

Epidemiology of cronobacter spp. isolates from patients admitted to the olomouc university hospital (Czech republic). Epidemiologie, Mikrobiologie, Imunologie, 63(1), 69–72. Hu, S. F., Yu, Y. G., & Xiao, X. L. (2018a). Stress resistance, detection and disinfection of cronobacter spp. in dairy products: A review. Food Control, 85, 400–415. Hu, S. F., Yu, Y. G., Zhou, D. G., Li, R., Xiao, X. L., & Wu, H. (2018b). Global transcriptomic acid tolerance response in Salmonella enteritidis. Lwt-Food Science and Technology, 92, 330–338. Joly, N., Engl, C., Jovanovic, G., Huvet, M., Toni, T., Sheng, X., ... Buck, M. (2010). Managing membrane stress: The phage shock protein (psp) response, from molecular mechanisms to physiology. FEMS Microbiology Reviews, 34(5), 797–827. Jovanovic, G., Lloyd, L. J., Stumpf, M. P. H., Mayhew, A. J., & Buck, M. (2006). Induction and function of the phage shock protein extracytoplasmic stress response in Escherichia coli. Journal of Biological Chemistry, 281(30), 21147–21161. https://doi. org/10.1074/jbc.M602323200. Ju, J., Xie, Y., Guo, Y., Cheng, Y., Qian, H., & Yao, W. (2018). The inhibitory effect of plant essential oils on foodborne pathogenic bacteria in food. Critical Reviews in Food Science and Nutrition, 1–55. https://doi.org/10.1080/10408398.2018.1488159. Kaeriyama, M., Machida, K., Kitakaze, A., Wang, H., Lao, Q., Fukamachi, T., ... Kobayashi, H. (2006). OmpC and OmpF are required for growth under hyperosmotic stress above pH 8 in Escherichia coli. Letters in Applied Microbiology, 42(3), 195–201. https://doi. org/10.1111/j.1472-765X.2006.01845.x. Kostaki, M., Giatrakou, V., Savvaidis, I. N., & Kontominas, M. G. (2009). Combined effect of MAP and thyme essential oil on the microbiological, chemical and sensory attributes of organically aquacultured sea bass (Dicentrarchus labrax) fillets. Food Microbiology, 26(5), 475–482. Kothary, M. H., Gopinath, G. R., Gangiredla, J., Rallabhandi, P. V., Harrison, L. M., Yan, Q. Q., ... Tall, B. D. (2017). Analysis and characterization of proteins associated with outer membrane vesicles secreted by cronobacter spp. Frontiers in Microbiology, 8, 134. https://doi.org/10.3389/fmicb.2017.00134. Lee, J. H., Kim, Y. G., & Lee, J. (2017). Carvacrol-rich oregano oil and thymol-rich thyme red oil inhibit biofilm formation and the virulence of uropathogenic Escherichia coli. Journal of Applied Microbiology, 123(6), 1420–1428. Li, R., Fei, P., Man, C. X., Lou, B. B., Niu, J. T., Feng, J., ... Jiang, Y. J. (2016). Tea polyphenols inactivate Cronobacter sakazakii isolated from powdered infant formula. Journal of Dairy Science, 99(2), 1019–1028. Li, Y. R., Zhou, D. G., Hu, S. F., Xiao, X. L., Yu, Y. G., & Li, X. F. (2018). Transcriptomic analysis by RNA-seq of Escherichia coli O157:H7 response to prolonged cold stress. Lwt-Food Science and Technology, 97, 17–24. Marinelli, L., Stefano, A. D., & Cacciatore, I. (2018). Carvacrol and its derivatives as antibacterial agents. Phytochemistry Reviews, (4), 1–19. Meyer, M., Dimroth, P., & Bott, M. (1997). In vitro binding of the response regulator CitB and of its carboxy-terminal domain to A + T-rich DNA target sequences in the control region of the divergent citC and citS operons of Klebsiella pneumoniae. Journal of Molecular Biology, 269(5), 719–731. https://doi.org/10.1006/jmbi.1997.1076. Mirzaei-Najafgholi, H., Tarighi, S., Golmohammadi, M., & Taheri, P. (2017). The effect of citrus essential oils and their constituents on growth of xanthomonas citri subsp citri. Molecules, 22(4). Phan, T. T., Li, J., Sun, B., Liu, J. Y., Zhao, W. H., Huang, C., ... Li, Y. R. (2017). ATPcitrate lyase gene (SoACLA-1), a novel ACLA gene in sugarcane, and its overexpression enhance drought tolerance of transgenic tobacco. Sugar Tech, 19(3), 258–269. Shi, C., Sun, Y., Liu, Z. Y., Guo, D., Sun, H. H., Sun, Z., ... Xia, X. D. (2017). Inhibition of cronobacter sakazakii virulence factors by citral. Scientific Reports, 7. Sinha, P., Roy, S., & Das, D. (2015). Role of formate hydrogen lyase complex in hydrogen production in facultative anaerobes. International Journal of Hydrogen Energy, 40(29), 8806–8815. Tian, X. J., Yu, Q. Q., Yao, D. H., Shao, L. L., Liang, Z. H., Jia, F., ... Dai, R. T. (2018). New insights into the response metabolome of Escherichia coli O157:H7 to ohmic heating. Frontiers in Microbiology, 9. Ultee, A., Bennik, M. H. J., & Moezelaar, R. (2002). The phenolic hydroxyl group of carvacrol is essential for action against the food-borne pathogen Bacillus cereus. Applied and Environmental Microbiology, 68(4), 1561–1568. Xue, L. L., Chen, H. H., & Jiang, J. G. (2017). Implications of glycerol metabolism for lipid production. Progress in Lipid Research, 68, 12–25. https://doi.org/10.1016/j.plipres. 2017.07.002. Yao, J. W., & Rock, C. O. (2015). How bacterial pathogens eat host lipids: Implications for the development of fatty acid synthesis therapeutics. Journal of Biological Chemistry, 290(10), 5940–5946. Yeh, J. I., Chinte, U., & Du, S. (2008). Structure of glycerol-3-phosphate dehydrogenase, an essential monotopic membrane enzyme involved in respiration and metabolism. Proceedings of the National Academy of Sciences of the United States of America, 105(9), 3280–3285. https://doi.org/10.1073/pnas.0712331105. Yi, L. H., Li, X., Luo, L. L., Lu, Y. Y., Yan, H., Qiao, Z., et al. (2018). A novel bacteriocin BMP11 and its antibacterial mechanism on cell envelope of Listeria monocytogenes and Cronobacter sakazakii. Food Control, 91, 160–169.

Declaration of competing interest The authors declare no conflict of interest. Acknowledgements This work was supported by the National Key Research and Development Program of China (No.2018YFC1602201, 2016YFF0203204), Science and Technology Program Foundation of Guangzhou, China (No.201904010077) and Natural Science Fund of Zhejiang (No.LY16H260004). We thank Guangzhou Gene Denovo Biotechnology Co., Ltd., China, for technical assistance. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.lwt.2020.109040. References Baldwin, A., Loughlin, M., Caubilla-Barron, J., Kucerova, E., Manning, G., Dowson, C., et al. (2009). Multilocus sequence typing of Cronobacter sakazakii and Cronobacter malonaticus reveals stable clonal structures with clinical significance which do not correlate with biotypes. BMC Microbiology, 9. Begic, S., & Worobec, E. A. (2006). Regulation of Serratia marcescens ompF and ompC porin genes in response to osmotic stress, salicylate, temperature and pH. Microbiology, 152(Pt 2), 485–491. https://doi.org/10.1099/mic.0.28428-0. Ben Arfa, A., Combes, S., Preziosi-Belloy, L., Gontard, N., & Chalier, P. (2006). Antimicrobial activity of carvacrol related to its chemical structure. Letters in Applied Microbiology, 43(2), 149–154. https://doi.org/10.1111/j.1472-765X.2006.01938.x. Bhagavan, N. V., & Ha, C.-E. (2011). Chapter 16 - lipids I: Fatty acids and eicosanoids. In N. V. Bhagavan, & C.-E. Ha (Eds.). Essentials of medical biochemistry (pp. 191–207). San Diego: Academic Press. Blotz, C., & Stulke, J. (2017). Glycerol metabolism and its implication in virulence in Mycoplasma. FEMS Microbiology Reviews, 41(5), 640–652. https://doi.org/10.1093/ femsre/fux033. Custódio, J. B., Ribeiro, M. V., Silva, F. S., Machado, M., & Sousa, M. C. (2011). The essential oils componentp-cymene induces proton leak through Fo-ATP synthase and uncoupling of mitochondrial respiration. Journal of Experimental Pharmacology, 3(default), 69–76. Denev, P. N., Ch, K., Ciz, M., Lojek, A., & Kratchanova, M. G. (2012). Bioavailability and antioxidant activity of black chokeberry (aronia melanocarpa) polyphenols: In vitro and in vivo evidences and possible mechanisms of action. A review. Comprehensive Reviews in Food Science and Food Safety, 11(5), 471–489. Du, X. J., Wang, X. Y., Dong, X., Li, P., & Wang, S. (2018). Characterization of the desiccation tolerance of cronobacter sakazakii strains. Frontiers in Microbiology, 9. Fei, P., Ali, M. A., Gong, S. Y., Sun, Q., Bi, X., Liu, S. F., et al. (2018). Antimicrobial activity and mechanism of action of olive oil polyphenols extract against Cronobacter sakazakii. Food Control, 94, 289–294. Frankova, A., Marounek, M., Mozrova, V., Weber, J., Kloucek, P., & Lukesova, D. (2014). Antibacterial activities of plant-derived compounds and essential oils toward cronobacter sakazakii and cronobacter malonaticus. Foodborne Pathogens and Disease, 11(10), 795–797. Goel, S., & Mishra, P. (2018). Thymoquinone inhibits biofilm formation and has selective antibacterial activity due to ROS generation. Applied Microbiology and Biotechnology, 102(4), 1955–1967. Guest, R. L., & Raivio, T. L. (2016). Role of the gram-negative envelope stress response in the presence of antimicrobial agents. Trends in Microbiology, 24(5), 377–390. Gupta, P., Patel, D. K., Gupta, V. K., Pal, A., Tandon, S., & Darokar, M. P. (2017). Citral, a monoterpenoid aldehyde interacts synergistically with norfloxacin against methicillin resistant Staphylococcus aureus. Phytomedicine, 34, 85–96. Gutierrez, J., Rodriguez, G., Barry-Ryan, C., & Bourke, P. (2008). Efficacy of plant essential oils against foodborne pathogens and spoilage bacteria associated with readyto-eat vegetables: Antimicrobial and sensory screening. Journal of Food Protection, 71(9), 1846–1854. Holy, O., Petrzelova, J., Hanulik, V., Chroma, M., Matouskova, I., & Forsythe, S. J. (2014).

7