Cross priming amplification with nucleic acid test strip analysis of mutton in meat mixtures

Accepted Manuscript Cross priming amplification with nucleic acid test strip analysis of mutton in meat mixtures Tao Feng, Sufang Li, Sunan Wang, Jiarong Pan PII: DOI: Reference:

S0308-8146(17)31443-7 http://dx.doi.org/10.1016/j.foodchem.2017.08.107 FOCH 21656

To appear in:

Food Chemistry

Received Date: Revised Date: Accepted Date:

20 November 2015 24 May 2017 30 August 2017

Please cite this article as: Feng, T., Li, S., Wang, S., Pan, J., Cross priming amplification with nucleic acid test strip analysis of mutton in meat mixtures, Food Chemistry (2017), doi: http://dx.doi.org/10.1016/j.foodchem. 2017.08.107

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Cross priming amplification with nucleic acid test strip analysis of mutton in meat mixtures

Tao Fenga, Sufang Lia*, Sunan Wangb, Jiarong Pana* a

College of Life Sciences, China Jiliang University, 258 Xueyuan Street, Xiasha High

Education Area, Hangzhou, 310018 P.R.China b

Canadian Food and Wine Institute, Niagara College, 135 Taylor Road,

Niagara-on-the-Lake, Ontario L0S 1J0, Canada

*1st corresponding author. Tel.: +86 571 87676249; fax: +86 571 86834449. E-mail address: [email protected]; 2nd corresponding author. Tel.: +86 571 86875627; fax:+86 571 86834449. E-mail address: [email protected]

1

Abstract A simple, sensitive, accurate and affordable rapid detection of meat species authentication is urgently needed in food industry. In this study, a cross priming amplification (CPA) combining nucleic acid test strip (CPA-Strip) assay for rapid detection of mutton from meat mixture were developed and its feasibility was investigated. In an isothermal CPA system, cytochrome b (cytb) gene as target was amplified at 63℃ for 60 min. The nucleic acid strip was able to show the corresponding test line in the presence of target gens in 5 min. Non-targeting gene interference was not evident. The CPA-Strip has been applied for the detection of 0.1-100% mutton in a thermal treated meat mixtures with a detection limit of a detect limit of 1%. CPA-Strip assay would be a promising simple, rapid and sensitive method for identification of target species in raw and processed meat mixtures. Keywords Mutton species detection; cross priming amplification; cytochrome b (cytb); nucleic acid detection strip

2

1. Introduction Authentication of meat species represents one of the major areas concerning the quality and safety of food commodities of animal origin (Tanabe, Hase, Sato, Fujimura, & Akiyama, 2008). Verification of the accuracy of label claims on meat and poultry products promotes food safety and qaulily assurance, consumer trust building, fair trade activities. Inspired by the ever-increasing transparency in food industry, methodology development for identifying processed and raw meat species have been intensively studied in recent years (Brodmann, 2003; Tanabe et al., 2008; Ali, Razzak, & Hamid, 2014). Protein-based [i.e., enzyme-linked immunosorbent assay (ELISA) and strips] and DNA-based [i.e., polymerase chain reaction (PCR)] analyses are among well-established qualitative and quantitative assessment of meat adulteration. In protein-based analysis, ELISA is simple and convenient, with a low sensitive to detect thermal-treated meat proteins. Relying on technical experts in operation and data analysis, feed microscopy is tissue-specific and sensitive to non-thermal and thermal treated meat samples (Hird, Chisholm, & Brown, 2005). In DNA-based analysis, the PCR techniques have been intensively applied (Meyer, Candrian, & Lüthy, 1994; Fajardo, Gonzalez, Martin, Rojas, Hernandez, Garcia, & Martin, 2008; 2009; Köppel, Daniels, Felderer, & Brünen-Nieweler, 2013; Safdar & Abasiyanik, 2013). Using species-specific primers (Meyer, Candrian, & Lüthy, 1994; Rodríguez, García, González, Hernández, & Martín, 2005; Fumière, 3

2006; Kesmen, Gulluce, Sahin, & Yetim, 2009;), and analysis of restriction fragment length polymorphism (Zha, Xing, & Yang, 2010), beef, mutton, goats, pork and chicken meat were identified from a wide ranges of food. In addition, isothermal amplification techniques has recently applied to inditify pork (Yang, Fu, Peng, Li, Song, & Li, 2014) and horse meat (Zahradnik, Martzy, Mach, Krska, Farnleitner, & Brunner, 2015). Among isothermal amplification, cross priming amplification (CPA) has been successfully established for detecting DNA or RNA (Fang et al., 2009; Xu et al., 2012). The CPA utilizes multiple primers and probes (4s, 5a, 2a1s, 3a, and 2a) to amply nucleotide sequence isothermally. By labeling primer 2a with Biotin, primer 3a with FAM, CPA amplified products could be visualized in nucleic acid test strip. Simple operation and rapid determination give the nucleic acid test strip an advantage over electrophoresis. In this study, a combination of CPA and nucleic acid detection strip (CPA-Strip) were developed to detect specific mutton specie from meat mixtures. The CPA-Strip assay would be a promising rapid user-friendly detection method for species authentication in meat products with desirable simplicity, sensitivity and detection limits. 2. Materials and methods 2.1. Sample collection and storage Authenticated muscle samples of species were obtained (three or seven individuals of each species) from local markets (Hangzhou, China). The samples were labeled and 4

stored at -20℃ prior to further analysis 2.2. DNA extraction DNA was extracted from 25 mg of representative homogenized and ground sample using animal tissue DNA extraction kit (Simgen, Hangzhou, China) according to manufacturer’s instructions. DNA concentration and purity were determined by a Biodropsis NanoDrop-2000 ultra-micro nucleic acid protein analyzer (Thermo, USA). 2.3. Primer design and DNA Sequencing Compared to the nuclear DNA, target DNA sequences for amplification have been based on mitochondrial DNA (Cai, Gu, Scanlan, Ramatlapeng, & Lively, 2012). DNA sequences of the cytochrome b (cytb) gene of mutton were downloaded from the National Center for Biotechnology Information (NCBI) in Table 1. Then, these were analyzed by DNAMAM 6.0 and we would get the most of the same fragment. Compared with mtDNA of other species, we found a series of broken pieces (called OvisCytb-1, 2, 3…) in Ovis cytb same fragment, which is specific with other species. The name and sequence of the primers are, OC-n F (n=1, 2, 3…, depends on the broken piece) and OC-n R (sequence in Table 2). Briefly, the PCR were carried out in a total volume of 50 μL, which was composed of the following components: 30-100ng of DNA template were added to a PCR mixture consisting of 5 μL 10x buffer (with 2mM MgCl2), 0.4 mM dNTPs mix, 5 units of Taq DNA polymerase, 0.4uM of each primer, and molecular biology grade water used to adjust to the final volume. 5

PCR were carried out in PCR Genemate series Touch T960 (Hangzhou Jingle Scientific Instrument Co., Ltd, China). The optimized reaction conditions include a preheating step of 10 min at 94⁰C, 35 cycles (30s at 94℃, 30s at 53℃, and 30s at 72℃) and a final extension step of 72℃ for 10 min. PCR products were loaded in agarose gels (Sangon, shanghai, China) at 2% in 1x TAE buffer and 1x 4s-red (Sangon, shanghai, China) allowing band detection. After sequencing, the sequence of products had been compared with the sequence which was downloaded from NCBI, and this validity would be used to add into T1-vector becoming the target plasmid. The mutton primers were designed using the target sequence which was approved. The two outer (4s and 5a), two inner (3a and 2a) and one crossing (2a1s) primers were designed manually (Figure 1) with help of Oligo7.0 and primer5 software. All primers in this study were synthesized by Sangon (shanghai, China) (Table 2). 2.4.CPA assays The CPA assay was performed using the available DNA thermostatic amplification reagents according to the CPA method (Fang et al., 2009; Xu et al., 2012). Reactions were performed in a 20 μL total volume containing 1× Thermo Pol Buffer (20 mmol/L Tris-HCl pH 8.8, 10 mmol/L KCl, 10 mmol/L (NH4)2SO4, 2 mmol/L MgSO4, 0.1%Triton X-100 pH 8.8), 0.45 mol/L Betaine, 3 mmol/L of dNTPs each, 0.1 μmmol/L of each outer primer (4s and 5a), 0.6 μmmol/L of cross primer of 2a1s, 0.3 μmmol/L of inner primer(3a and 2a), 8 units of Bst DNA polymerase (New 6

EnflangBiolabs Ipswich, MA) and 4 μL of template DNA. The reaction was carried out at 63℃ for 60min (3090min). The products were detected by 2% agarose gel electrophoresis in 1X TAE with 4s-red staining and the nucleic acid strip test, when CPA amplification was completed. 3. Results and discussion 3.1. Optimization of the CPA assay Species-specific PCR methods generally target the high-copy mtDNA (Lahiff, 2001; Köppel, Ruf, Zimmerli, & Breitenmoser, 2008; Köppel, Ruf, & Rentsch, 2011; Santos, Melo, Amaral, Estevinho, Oliveira, & Mafra, 2012; Köppel, Daniels, Felderer, & Brünen-Nieweler, 2013), which evolves much faster than genomic DNA, thus providing sufficient sequence variation for the design of species-specific PCR primers. Heat induced mtDNA resisted fragmentation better than genomic DNA. In addition, the cytb gene has been used in species detection (Mendoza-Romero & Verkaar, 2004; Penedo, Kanthaswamy, Wictum, & Evans, 2007). CPA primers were designed in this study using the mutton mitochondrial cytb gene. The Blast alignment had been done for some Ovis aries, Capra and one Pseudoisnayaur. The result showed that the CPA primers could be used for most of the mutton breeds. The CPA reaction is detected by electrophoresis as shown in Figure 2a. The CPA products give a ladder-like pattern on the agarose gel, due to their characteristic structure. And we found that there are two lines special near 100bp, which determined by the location of sequence 1s-2a and 1s-3a (Figure 2a). The reactions for mutton cytb 7

CPA were performed under isothermal conditions at 63℃ using 100 copies of target sequence, for 30 to 90 min. No amplification was detected for the negative sample until after at least 45 min of incubation (Figure 3). Thus, subsequent CPA reactions were conducted at 63℃ for 60min in order to get enough products. The result of the nucleic acid strip showed in Figure 2b. The negative result showed one red line (C-line) on the strip, whereas positive result found two lines (C-line and T-line). And the result would be got less than 5 min. 3.2. Specificity of the CPA assay To evaluate the specificity of the developed CPA assays, cattle, pork, duck and chicken meat had been used. In the specificity test, 20ng total DNA was used as the template in each assay. As expected, the typical amplification curve was obtained in the test using mutton DNA samples and positive control as template. No amplification was observed for other species or the negative control (Figure 4). The results showed that the CPA assays have high specificity, suggesting that it was suitable for the identification the mutton DNA from cattle, duck, pork and chicken meat. 3.3. Sensitivity and linearity of CPA-strip assay In order to obtain the detection limit of CPA-Strip assays, serial 10-fold dilutions of the plasmid starting with 106 copies were performed. The result showed that the limit of detection of CPA was 100 copies (Figure 5), which was 10-fold more sensitive than PCR (1000 copies).

8

3.4. CPA analysis of mutton in meat mixtures CPA method was used to analysis heat-treated meat mixtures containing mutton a various concentration of 0.1, 1, 10, 20, and 50% and found that the detection limits was 1% (Table 3).The detection rate, corresponding to the DNA concentration of the target species, showed high linearity over a wide range of template concentrations, which enables consistent and precise determination of target DNA in most of the tested meat mixtures (the radio above 1%). The presence of undeclared species below 1% in meat products is generally considered to result from the contamination. From economic point of view a high concentration of mutton used in meat adulteration is impractical, while the standards of each country are different. To be sure, the rate of mutton in meat products could not be low. Therefore, the detection limit obtained from the CPA-Strip assay is sufficient to qualitatively detect mutton in products. 4. Conclusions CPA-Stripe assay we designed in this study was capable of specific and qualitative detection of mutton (at a rate of 1-50%) in meat mixtures. Mutton specie-specific CPA primers were designed to target the mitochondrial cytb gene. The detection limit of CPA-Strip assay was 1% in mutton-positive meat samples. Future study is expected to prove the feasibility of CRA-Strip assays in the identification of adulterated components of animal origin other than mutton species in diverse raw and processed meat products.

9

Reference Ali, M. E., Razzak, M. A., & Hamid, S. B. A. (2014). Multiplex PCR in species authentication: probability and prospects  A Review. Food Analytical Methods, 7(10), 1933-1949. Brodmann, P. D., & Moor, D. (2003). Sensitive and semi-quantitative TaqMan64 real-time polymerase chain reaction systems for the detection of beef ( Bos taurus) and the detection of the family Mammalia in food and feed. Meat Science, 65(1), 599-607. Cai, H., Gu, X., Scanlan, M. S., Ramatlapeng, D. H., & Lively, C. R. (2012). Real-time PCR assays for detection and quantitation of porcine and bovine DNA in gelatin mixtures and gelatin capsules. Journal of Food Composition & Analysis, 25(1), 83-87. Fajardo, V., González, I., Martín, I., Rojas, M., Hernandez, P. E., García, T., & Martín, R. (2009). A LightCycler TaqMan PCR assay for quantitative detection of chamois (Rupicapra rupicapra) and pyrenean ibex (Capra pyrenaica) in experimental meat mixtures. International Journal of Food Science & Technology, 44(10), 1997-2004. Fajardo, V., Gonzalez, I., Martin, I., Rojas, M., Hernandez, P. E., Garcia, T., & Martin, R. (2008). Differentiation of European wild boar (Sus scrofa scrofa) and domestic swine (Sus scrofa domestica) meats by PCR analysis targeting the mitochondrial D-loop and the nuclear melanocortin receptor 1 (MC1R) genes. 10

Meat Science, 78(3), 314-322. Fang, R., Li, X., Hu, L., You, Q., Li, J., Wu, J., Xu, P., Zhong, H., Luo, Y., Mei, J., & Gao, Q. (2009). Cross-priming amplification for rapid detection of Mycobacterium tuberculosis in sputum specimens. Journal of Clinical Microbiology, 47(3), 845-847. Fumière, O. (2006). Effective PCR detection of animal species in highly processed animal byproducts and compound feeds. Analytical and Bioanalytical Chemistry, 385(6), 1045-1054. Hird, H., Chisholm, J., & Brown, J. (2005). The detection of commercial duck species in food using a single probe-multiple species-specific primer real-time PCR assay. European Food Research & Technology, 221(3-4), 559-563. Köppel, R., Daniels, M., Felderer, N., & Brünen-Nieweler, C. (2013). Multiplex real-time PCR for the detection and quantification of DNA from duck, goose, chicken, turkey and pork. European Food Research & Technology, 236(6), 1093-1098. Köppel, R., Ruf, J., & Rentsch, J. (2011). Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, horse and sheep. European Food Research & Technology, 232(1), 151-155. Köppel, R., Ruf, J., Zimmerli, F., & Breitenmoser, A. (2008). Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, chicken and turkey. European Food Research and Technology, 227(4), 1199-1203. 11

Kesmen, Z., Gulluce, A., Sahin, F., & Yetim, H. (2009). Identification of meat species by TaqMan-based real-time PCR assay. Meat Science, 82(4), 444-449. Lahiff, S., Glennon, M., O'Brien, L., Lyng, J., Smith, T., & Maher, M., et al. (2001). Species-specific PCR for the identification of ovine, porcine and chicken species in meat and bone meal (MBM). Molecular and Cellular Probes, volume 15(1), 27-35. Mendoza-Romero, L., & Verkaar, E. L. C. (2004). Real-time PCR detection of ruminant DNA. Journal of Food Protection, 67(3), 550-554. Meyer, R., Candrian, U., & Lüthy, J. (1994). Detection of pork in heated meat products by the polymerase chain reaction. Journal of AOAC International, 77(3), 617-622. Penedo, M. C. T., Kanthaswamy, S., Wictum, E. J., & Evans, J. J. (2007). Real-time polymerase chain reaction quantification of canine DNA.Journal of Forensic Sciences, 52(1), 93-96. Rodríguez, M. A., García, T., González, I., Hernández, P. E., & Martín, R. (2005). TaqMan real-time PCR for the detection and quantitation of pork in meat mixtures. Meat Science, 70(1), 113-120. Safdar, M., & Abasiyanik, M. F. (2013). Simultaneous identification of pork and poultry origins in pet foods by aquick multiplex real-time PCR assay using EvaGreen florescence dye.Applied Biochemistry and Biotechnology, 171(7), 1855-1864. 12

Santos, C. G., Melo, V. S., Amaral, J. S., Estevinho, L., Oliveira, M. B., & Mafra, I. (2012). Identification of hare meat by a species-specific marker of mitochondrial origin. Meat Science, 90(3), 836-841. Tanabe, S., Hase, M. Y., T., Sato, M., Fujimura, T., & Akiyama, H. (2007). A real-time quantitative PCR detection method for pork, chicken, beef, mutton, and horseflesh in foods. Bioscience Biotechnology & Biochemistry, 71(12), 3131-3135. Xu, G., Hu, L., Zhong, H., Wang, H., Yusa, S., Weiss, T. C., Romaniuk, P. J., Pickerill, S., & You, Q. (2012). Cross priming amplification: mechanism and optimization for isothermal DNA amplification. Scientific Reports, 2, 246. DOI: 10.1038/srep00246 Yang, L., Fu, S., Peng, X., Li, L., Song, T., & Li, L. (2014). Identification of pork in meat products using real-time loop-mediated isothermal amplification. Biotechnology & Biotechnological Equipment, 28(5), 882-888. Zahradnik, C., Martzy, R., Mach, R. L., Krska, R., Farnleitner, A. H., & Brunner, K. (2015). Loop-mediated isothermal amplification (LAMP) for the detection of horse meat in meat and processed meat products. Food Analytical Methods, 8(6), 1576-1581. Zha, D. M., Xing, X. M., & Yang, F. (2010). A multiplex PCR assay for fraud identification of deer products. Food Control, 21(10), 1402-1407.

13

Figure 1.

Primer design for CPA. (a) Nucleotide sequence alignment of the target

regions of city gene. Arrows indicate the primers used for CPA assays. (b) Schematic diagram showing the positions of the CPA primers.

14

Figure 2a. Analysis of mutton cytb by CPA with agarose gel electrophoresis. Lane M, 1Kb DNA marker; lane N, negative control; lane P, positive control;

Figure 2b. Analysis of mutton cytb by CPA with nucleic acid test strip. Lane N, negative control; Lane P, positive control; line T, CPA products of mutton DNA.

15

Figure 3.

Analysis of mutton cytb by CPA by nucleic acid test strip with different reaction time. Lane 1, negative

control for 30 min; lane 2, postive template for 30 min; lane 3, negative control for 45 min; lane 4, postive template for 45 min; Lane 5, negative control for 60 min; lane 6, postive template for 60 min; Lane 7, negative control for 90 min; lane 8, postive template for 90 min;

16

Figure 4a.

Analysis of mutton cytb by CPA with agarose gel electrophoresis. Lane M, 1Kb DNA marker; lane N,

negative control; lane P, positive control; lane 1, mutton sample; lane 2, pork sample; lane 3, cattle sample; lane 4, duck sample ;lane 5, chicken sample.

Figure 4b. Analysis of mutton cytb by CPA with nucleic acid test strip. lane N, negative control; lane P, positive control; lane 1, mutton sample; lane 2, pork sample; lane 3, cattle sample; lane 4, duck sample ;lane 5, chicken sample.

17

Figure 5.

Nucleic acid strip test of CPA products targeting the plasmid in different copies. Lane N, negative

control; lane 1, 106 copies of template; lane 2, 105 copies of template; lane 3, 104 copies of template; Lane 4, 103 copies of template; lane 5, 102 copies of template; Lane 6, 101 copies of template; Lane 7, 100 copies of template.

18

Table 1 CYTB gene of species included in the present work genus

Instructions

length

genbank

Ovis aries

from Turkey

1024

KF677303

Tibetan sheep in Qinghai region

1140

JX567831

Chinese sheep

1140

DQ903227

Near Eastern sheep

1140

DQ097417

snow sheep

1140

AJ867261

Indian sheep

967

FJ218145

Dell sheep

1140

ODU17860

bighorn sheep

1071

OCU17859

Chinese domestic goat

1140

EU130780

Pakistani breeds of goat

1140

JX286548

Korean native goat

1140

JX010745

Pseudois nayaur

Pseudois nayaur

1140

AF500197

Bos taurus

Leiqiong cattle

1140

EF061244

Bos grunniens mutus

1140

AY955226

Bos taurus indicus

1140

JN117615

the Laiwu pig and Yimeng Black pig

1140

KR049170

Iberian pigs and other domestic and wild pig

1140

AY237534

Mongolian Wild boar

1140

KM215177

cinnamon teal

1045

EU914155

mallard

1143

KJ739616

pekin duck

1143

NC009684

Chiloe wigeon

1045

EU914149

Capra capra

Sus scrofa

populations

Anas platyrhynchos

19

Table 2 Nucleotide sequences of the primers (5-3) Primer

Sequence

OC F

CTATTTATGCATGTAGGACGA

OC R

GAAAATAAAGTGAAAGGCGAA

OC 4s

CTATTTATGCATGTAGGACGA

OC 5a

GAAAATAAAGTGAAAGGCGAA

OC 2a1s

GCCAATATATGGAATTGCTGAAAGAGTAATCCTCCTATTTGCGA

OC 3a

AAACATAGCCTATGAATGCTGTG

OC 2a

GCCAATATATGGAATTGCTGAAAG

20

Table 3. Target species

Results of CPA measurement of heat-treated meat mixtures. (n=6) The ratio of target species in the mixtures (%)

Detection rate (%)

mutton

21

50

100

20

100

10

100

1

83.3

0.1

0

Highlights  A detection of isothermal amplification based on cross priming amplification combined with nucleic acid detection strip (CPA-Strip)  The CPA-Strip is capable of detecting mutton in meat species authentication  The CPA-strip assay shows promising in meat authentication for desirable simplicity

22