Cross-reactive binding of cyclic peptides to an anti-TGFα antibody Fab fragment: an X-ray structural and thermodynamic analysis1

doi:10.1006/jmbi.2001.5135 available online at http://www.idealibrary.com on

J. Mol. Biol. (2001) 314, 293±309

Cross-reactive Binding of Cyclic Peptides to an Anti-TGFa a Antibody Fab Fragment: an X-ray Structural and Thermodynamic Analysis Michael Hahn1, Dirk Winkler2, Karin Welfle3, Rolf Misselwitz3 Heinz Welfle3, Helga Wessner1, Grit Zahn1, Christa Scholz1 Martina Seifert2, Rick Harkins4, Jens Schneider-Mergener2 and Wolfgang HoÈhne1* 1

Institut fuÈr Biochemie UniversitaÈtsklinikum Charite Humboldt-UniversitaÈt zu Berlin, Monbijoustr. 2 10117 Berlin, Germany 2 Institut fuÈr Medizinische Immunologie, UniversitaÈtsklinikum Charite Humboldt-UniversitaÈt zu Berlin, Schumannstr. 20/21 10098 Berlin, Germany 3

Max-DelbruÈck-Centrum fuÈr Molekulare Medizin, RobertRoÈssle-Str. 10, 13122 BerlinBuch, Germany

4

Dept. of Gene Therapy Research, Berlex Biosciences 15049 San Pablo Ave. Richmond, CA 94804, USA

The monoclonal antibody tAb2 binds the N-terminal sequence of transforming growth factor a, VVSHFND. With the help of combinatorial peptide libraries it is possible to ®nd homologous peptides that bind tAb2 with an af®nity similar to that of the epitope. The conformational ¯exibility of short peptides can be constrained by cyclization in order to improve their af®nity to the antibody and their stability towards proteolysis. Two cyclic peptides which are cross-reactive binders for tAb2 were selected earlier using combinatorial peptide libraries. One is cyclized by an amide bond between the N-alpha group and the side-chain of the last residue (cyclo-SHFNEYE), and the other by a disul®de bridge (cycloCSHFNDYC). The complex structures of tAb2 with the linear epitope peptide VVSHFND and with cyclo-SHFNEYE were determined by X-ray diffraction. Both peptides show a similar conformation and binding pattern in the complex. The linear peptide SHFNEYE does not bind tAb2, but cyclo-SHFNEYE is stabilized in a loop conformation suitable for binding. Hence the cyclization counteracts the exchange of aspartate in the epitope sequence to glutamate. Isothermal titration calorimetry was used to characterize the binding energetics of tAb2 with the two cyclic peptides and the epitope peptide. The binding reactions are enthalpically driven with an unfavorable entropic contribution under all measured conditions. The association reactions are characterized by negative
Cp changes and by the uptake of one proton per binding site. A putative candidate for proton uptake during binding is the histidine residue in each of the peptides. Hydrogen bonds and the putative formation of an electrostatic pair between the protonated histidine and a carboxy group may contribute markedly to the favorable enthalpy of complex formation. Implications to cyclization of peptides for stabilization are discussed. # 2001 Academic Press

*Corresponding author

Keywords: Transforming growth factor a; antibody cross-reactivity; peptide library; cyclic peptides; isothermal titration calorimetry

Introduction Present adresses: D. Winkler, Af®na Immuntechnik GmbH, Volmerstr.5, 12489 Berlin, Germany; G. Zahn, and J. Schneider-Mergener; Jerini AG, Rudower Chaussee 29, 12489 Berlin, Germany. Abbreviations used: TGFa, transforming growth factor a; CDR, complementarity determining region; ITC, isothermal titration calorimetry. E-mail address of the corresponding author: [email protected] 0022-2836/01/020293±17 $35.00/0

Human transforming growth factor a (TGFa) consists of 50 amino acid residues with three disul®de bridges. It belongs to the family of epidermal growth factor related peptides and binds to EGFreceptor. It is involved in cell proliferation in healthy cells1 and is found in various cancer cells.2 Transfection of ®broblasts with the TGFa gene induces tumor formation.3 The stretches from # 2001 Academic Press

294

Cross-reactive Peptide Binding to tAb2 Antibody

residue 1 to 9 and from 22 to 31 were identi®ed as immunodominant regions with residues 4 to 7 being the minimal binding epitope of tAb2, a murine monoclonal antibody selected after immunization with biologically active hemocyanin-coupled TGFa.4 The receptor binding surface is separate from the immunodominant region. We use the antibody tAb2 as a model system to study antibody interaction with linear and cyclic epitope-homologous peptides. Cyclization of short peptides can limit their conformational space, improve their af®nity and reduce their susceptibility against proteolytic attack.5 Moreover, cyclic peptides, if they bind with an af®nity comparable or higher than that of the corresponding linear epitope, should be of value to model loop conformations of the corresponding linear epitope peptide in an antibody binding site because of their largely restricted conformational space and a similar binding mode. So far, only the crystal structures of two cyclic peptides derived from the V3 loop of HIV-1 gp120 in complex with Fab fragment 58.2 and a Fab complex of the cyclic 11-mer peptide cyclosporin A (with mainly non-proteinogenic amino acids) have been reported.6,7 In the search for cyclic peptides with a high af®nity towards antibody tAb2 the following combinatorial peptide libraries were screened both in linear and cyclized condition.8,9 The sequence CXXB1B2XXC, cyclized by disul®de bond formation, and the sequence XXB1B2XXE, cyclized by amide bond formation between the N-terminal amino group and the side-chain carboxy group of the C-terminal glutamate residue (B, de®ned amino acids; C, cysteine; X, randomized positions). Positive results were obtained for B1 ˆ F and B2 ˆ N. Consequently, the libraries CXB1FNB2XC and XB1FNB2XE were used in the next round. For B1 ˆ H and B2 ˆ D high af®nities for both the linear and the cyclic peptides were found. For B2 ˆ E only the cyclic peptide was a binder. This led to the ®nal libraries B1HFNDB2E and B1HFNEB2E and from there to the identi®cation of peptide sequences SHFNDYE (homologous peptide 1; h-pep1) and cyclo-SHFNEYE (cyclic homologous peptide 2; hc-pep2) as optimized binders for tAb2. Among the disul®de-bridged peptides the

sequence CSHFNDYC (hcc-pep1) was found to have the highest af®nity. Interestingly, the aspartate in the original epitope peptide VVSHFND (e-pep) can be replaced by a glutamate only in cyclo-SHFNEYE with retention of af®nity, whereas with the linear variant SHFNEYE (h-pep2) no binding is observed (an overview of the peptides studied here is given in Table 1). This prompted us to investigate the crystal structures of the complexes of tAb2 with e-pep and hc-pep2. Here both complexes are described and a comparison of the binding pattern is provided. NMR structures are published for TGFa10,11 and thus the conformation of the linear epitope in complex with tAb2 can be compared with that of the corresponding region in the native structure. In addition, the binding thermodynamics of e-pep, hc-pep1, hc-pep2, and hcc-pep1 were determined by isothermal titration calorimetry.

Results Substitutional analysis The key residues for binding in the sequences SHFNDYE, SHFNEYE, both for the linear and cyclic peptides, and in the cyclic peptide CSHFNDYC were investigated by substitutional analysis (Figure 1). A substitutional analysis, generated by spot synthesis on continuous cellulose membrane supports, allows a simple yet systematic evaluation of the binding speci®city of each residue. Single peptide positions are screened by replacement with all other 19 amino acids in order to identify key residues that are essential for binding. The numbering scheme of the peptide residues is derived from the original TGFa sequence (Val1, Val2, Ser3, His4, Phe5, Asn6, and Asp7) and is used for all the peptides described in the text. In the substitutional analysis of the linear peptide SHFNDYE Ser3, His4 and Phe5 can be replaced only by a small number of other amino acids with conservation of binding. Asn6 and Asp7 are speci®cally needed for proper binding and may not be replaced by any other residue without loss of af®nity. Tyr8 and Glu9 can be replaced by any other residue except cysteine, without loss of bind-

Table 1. tAb2-binding peptides used in the present study Peptide

Description

Short name

VVSHFND SHFNDYE

Epitope Epitope homologous Epitope homologous Epitope homologous Epitope homologous

e-pep h-pep1

Linear peptide Linear peptide

X-ray structure, ITC analysis Substitutional analysis

hc-pep1

Cyclized by amide bond

Substitutional analysis ITC analysis

h-pep2

Linear peptide

Substitutional analysis

hc-pep2

Cyclized by amide bond

Epitope homologous

hcc-pep1

Cyclized by disulfide bond

X-ray structure, substitutional analysis, ITC analysis Substitutional analysis, ITC analysis

cyclo-SHFNDYE SHFNEYE cyclo-SHFNEYE CSHFNDYC

Condition

Analysis

295

Cross-reactive Peptide Binding to tAb2 Antibody

Figure 1. A set of single substitution analogs of SHFNDYE and SHFNEYE were prepared on cellulose membranes. The original sequence is shown in the ®rst column, in the following rows each position is substituted with every other amino acid. Spot intensities between sheets are not comparable because of different exposure times. The software program CorelPhotopaint (Corel Corporation, Ottawa, Canada) was used to reduce the background between spots. (a) linear SHFNDYE (h-pep1), (b) cyclized SHFNDYE (hc-pep1), (c) linear SHFNEYE (h-pep2), (d) cyclized SHFNEYE (hc-pep2), (e) cyclized CSHFNDYC (hcc-pep1).

ing (Figure 1(a)). The residue Glu9 was added at the C terminus to allow a cyclization of the peptide by connecting the N-atom of Ser3 with the Cd-atom of Glu9 via an amide bond. The substitutional analysis for the cyclized version of the epitope peptide is shown in Figure 1(b). A comparison with the spot pattern of the linear peptide reveals that the aspartate at position 7 can be mutated to glutamate. This exchange of a key residue results in an even improved binding as judged from the spot intensity. The substitutional analysis of peptide SHFNEYE in the linear form (h-pep2) shows that it does not bind tAb2, unless Glu7 is mutated back to aspartate (Figure 1(c)). The cyclized version binds with a similar binding pattern as the epitope sequence (Figure 1(d)). This indicates similar contacts in the protein/peptide interface. Ser3 is an exception as it changed its speci®city due to the covalent linkage to Glu9. In the complex of tAb2 with the linear SHFNDYE (h-pep1) there seems to be more space, and a replacement of serine with voluminous residues like tryptophan and tyrosine is possible, whereas in the tAb2/hc-pep2 complex substitutions to small amino acids dominate. The binding pattern for the peptide cyclized by a disul®de bridge (hcc-pep1) is similar, with few exceptions, to that for the cyclic peptide hc-pep2 (Figure 1(e)). Also in this case it follows from the relative spot intensities that the af®nity seems to become higher if Asp in position 7 is substituted by Glu.

Sequences of the light and heavy chain variable regions In Figure 2 the sequences of the light and heavy chain variable regions of tAb2 are shown and the amino acids that probably changed during af®nity maturation are indicated. To obtain the af®nity maturated positions alignments were performed with all actually known germ line genes of mouse using the IMGT database.13 The germline genes with the highest homology to the corresponding tAb2 sequences were VH:J00534 (94.2 % identity) together with the J-gene JH2 for the heavy chain, and VL:AJ239197 (93.7 % identity) together with the J-gene Jk4 for the light chain. In comparison with the germline sequence, ten amino acid exchanges took place in the CDR regions out of 17 in total. Crystal structures Crystals obtained by cocrystallization of tAb2 Fab fragment with e-pep and hc-pep2 diffracted to Ê resolution. More information better than 2 A regarding the crystallographic parameters is presented in Table 2. Analysis of the data gave two complexes of Fab tAb2/e-pep in the asymmetric unit (called a and b) but one for Fab tAb2/hc-pep2. The structures of the two complexes were solved by the method of molecular replacement (see Materials and Methods). The superposition of the Ca-atoms of the three Fab fragment structures

296

Cross-reactive Peptide Binding to tAb2 Antibody

Figure 2. Nucleotide and amino acid sequence of the variable region of heavy and light chain of tAb2. The upper sequences represent alignments with likely germ line genes of the tAb2 V-genes. Dashes indicate identical nucleotide sequence, exchanged amino acids are shown on top at likely mutated positions. CDR regions (shaded sequences) and amino acid numbering as de®ned by Kabat.12 Sequence positions where insertions or deletions occur along with the Kabat numbering are indicated by italic numbers. Residues involved in hydrogen bonds with the peptide are boxed. EMBL accession numbers of assumed germ line V-genes: VH, J00534; VL, AJ239197; J-genes derived from the sequences of murine JH2 and Jk4.

297

Cross-reactive Peptide Binding to tAb2 Antibody Table 2. Diffraction data of the complexes between Fab tAb2/e-pep and Fab tAb2/hc-pep2 Space group Ê] Cell constants [A

Ê] Resolution [A Completeness [%] I/s Rmerge [%] Rcryst [%], (number of reflections) Rfree [%], (number of reflections) Molecules in asymmetric unit Solvent and non-protein molecules Ê] Rms-deviation in bond distances [A Rms-deviation in bond angles [ ]

tAb2/e-pep

tAb2/hc-pep2

C2 aˆ173.82 bˆ45.09 cˆ120.41 bˆ99.13 20.0-1.90 92.9 (82.8)a 29.7 (2.2) 3.8 (25.7) 24.6 (64601) 31.1 (3427) 2 407 0.013 2.95

P212121 aˆ49.22 bˆ94.35 c ˆ 121.79 38.0-1.96 94.6 (54.2) 19.5 (6.5) 8.1 (28.8) 20.4 (37884) 26.9 (1997) 1 409, 1 Ni2‡, 1 Clÿ 0.016 3.18

a Ê , for Fab The values for the highest resolution shells are given in brackets: highest resolution shell for Fab tAb2/e-pep: 1.97-1.9 A Ê. tAb2/hc-pep2: 1.98-1.96 A

yields only minor deviations between these molecules (not shown). Values for the separate superposition of the two V-domains and two C-domains Ê for Fab tAb2/e-pep(a) compared are 0.54/0.79 A Ê for tAb2/ewith Fab tAb2/e-pep(b); 0.44/0.74 A pep(a) compared with Fab tAb2/hc-pep2; and Ê for Fab tAb2/e-pep(b) compared with 0.70/0.48 A Fab tAb2/hc-pep2, respectively. In the Ramachandran diagram 87.1 %, 89.2 % and 89.7 % of amino acids are in the most favored region for the complexes Fab tAb2/e-pep(a), e-pep(b) and hc-pep2. A loop region of the heavy chain constant region from H128 to H135 is ill de®ned in both molecules of the Fab tAb2/e-pep complex with Thr-H133 in Fab tAb2/e-pep(b) being in the disallowed region of the Ramachandran diagram. Other outliers are Thr-L51 as seen in other antibodies as well,14 ± 16 and Ser-H180 in Fab tAb2/hc-pep2. Six cis-proline residues are found in the Fab fragment, in the light chain at positions 8, 95, and 141 and in the heavy chain at positions 149, 151, and 200. The elbow angles are very similar for the different Fab/peptide complexes, with 169  and 171  for Fab tAb2/ e-pep(a) and e-pep(b), respectively, and with 165  for the Fab tAb2/hc-pep2. In Fab tAb2/hc-pep2 a nickel and a chloride ion were assigned in the solvent sphere. The nickel ion is coordinated in an octahedral fashion with the N and the Od1 atom of Asp-L1 in a plane with two water molecules (water-18, water-239). From the top the nickel ion is coordinated by Asp-L1 Od1 and from the bottom by Ne2 of His-L189 of a symmetry-related molecule. All ligands are found at a Ê . The chloride ion is coordistance of around 2.5 A dinated by Nd2 of peptide asparagine and NZ2 of Ê disArg-H56 from the opposite direction (3.2 A d2 tance). N of Asn-H58 and water-209 contact the ion from a rectangular angle with distances of 3.3 Ê , respectively. The octahedral coordiand 3.0 A nation is therefore incomplete.

In the antibody combining site a cleft with a deep central depression accomodates the peptides e-pep (Figure 3(a)) or hc-pep2 (Figure 3(b)) which both form a ``common'' type I b-turn including the residues His4, Phe5, Asn6, and Asp7, stabilized by a H-bond between His4 CO and Asp7 NH of e-pep or Glu7 NH of hc-pep2 and a second one between His4 NH and Asp7 Od2 or Glu7 Od2, respectively. Between His4 Nd1 and Asp7 Od2 of e-pep or Glu7 Oe2 of hc-pep2 a salt bridge is most likely formed, due to protonation of the histidine side-chain. The canonical structures of the CDRs17 were assigned as follows: class 1 for CDRs L2, L3 and H1, class 2 for CDRs L1 and H2. Two water molecules are conserved in the antibody combining site in contact with the peptides (Table 3). According to the numbering scheme of the tAb2/hc-pep2 complex these are water O-atom 9 and water O-atom 204. Water-9 is in contact with Glu50 of CDR H2 and could form an H-bond with either Asn6 Od1 or Glu7 Oe1 (Asp7 Od1 in e-pep) of the peptide. Water-204 bridges the serine O-atom of the peptide with Asn-34 of CDR L1 and Tyr-50 of CDR L2. These two water molecules are deeply buried in the binding groove and seem to be an integral part of the tAb2/peptide interface. The electron density for peptide hc-pep2 together with the conserved water molecules is shown in Figure 4. In all three cases there are crystal contacts between the peptides and symmetry-related Fab molecules. However the conformations of the original epitope peptides VVSHFND (e-pep) and the cyclic homolog SHFNEYE (hc-pep2) are effectively the same in different environments. We therefore conclude that crystal packing has no measurable in¯uence on their conformations. In the Fab fragment only small shifts of sidechains are observed. Figure 5 shows the superposition of peptides e-pep and hc-pep2 from the corresponding complexes. The epitope residues Ser3 to

298

Cross-reactive Peptide Binding to tAb2 Antibody

Figure 3. Stereo view of the tAb2 binding site accomodating the peptides (a) e-pep (in yellow) or (b) hc-pep2 (in orange). Two conserved water molecules (in red) are involved. The solvent accessible surface is shown for the antibody with the CDRs L1 in light green, L2 in medium green, L3 in dark green, H1 in light blue, H2 in medium blue, and H3 in dark blue. The Figure was created by WebLab ViewerPro 3.7 (Molecular Simulations Inc., San Diego, CA).

Asn6 superimpose well. Also, the side-chain carboxy group of Asp7 in e-pep and Glu7 in hc-pep2 are at similar positions. A clash with the Fab fragment, due to the longer side chain of Glu7 in hcpep2 is prevented, because the main chain of hcpep2 is shifted away from the Fab fragment as compared to e-pep. The contacts with the residues of the Fab fragment, H-bonds and hydrophobic interactions, are fully conserved in spite of this shift. H-bonds involving main-chain atoms of the

peptides are formed by Ser3, Phe5 and Asn6, Hbonds involving side-chain atoms are formed by Ser3, His4, Asn6 and Asp(Glu)7 (Table 3). The bond from Asp7 Od1 to Ser-H95 in the Fab tAb2/epep complex is replaced by the bond from Glu7 Oe1 to Ser-H95 in Fab tAb2/hc-pep2 complex. Other important contacts are hydrophobic interactions of His4 with Phe-L96, and of Phe5 with Leu-L94, Phe-L96 and Tyr-L32. The two valine residues in positions 1 and 2 of peptide e-pep form

299

Cross-reactive Peptide Binding to tAb2 Antibody

Table 3. Hydrogen bonding pattern of peptides e-pep and hc-pep2 and conserved water molecules in the binding groove of tAb2 Residue

Atom

Residue

Atom

Ser3 Ser3 His4 Phe5 Asn6 Asn6 Asp7 Glu7 His4 His4 His4 His4 Water

O Og Ne2 N O Nd2 Od1 Oe1 O O Nd1 Nd1 O-204

Water

O-9

Asn-L34 Asp-H101 Gln-L89 Gly-L91 Trp-H33 Glu-H50 Ser-H95 Ser-H95 Asp7 Glu7 Asp7 Glu7 Ser3 Asn-L34 Tyr-L50 Asn6 Asp7 Glu7 Glu-H50

Nd2 Od1 Oe1 O Ne1 Oe2 Og Og N N Od2 Oe2 O Od1 N Od1 Od1 Oe1 Oe1

a

Ê] Distance [A tAb2/e-pep 2.8; 2.5; 2.8; 2.9; 2.9; 2.9; 2.6;

3.0a 2.7 2.7 2.9 2.6 2.9 2.8

2.9; 3.0 2.8; 2.8 3.0; 2.8; 2.8; 2.7; 3.1;

2.9 3.1 3.2 2.7 2.8

2.6; 2.7

Ê] Distance [A tAb2/hc-pep2 3.1 2.6 2.7 2.9 3.1 2.8 2.5 3.5 2.8 2.9 2.7 2.9 2.7 3.2 2.6

numbers given for molecule a and b, respectively.

some additional hydrophobic interactions (Val1 with Tyr-L49 and Tyr-L50; Val2 with Pro-H96). The surface area buried in the antibody/peptide interface is large for CDRs L1, L3 and H3 and small for H2 (Table 4) which is involved in just one hydrogen bond (Table 3).

Isothermal titration calorimetry (ITC) The binding behavior of the linear peptide e-pep and the cyclic peptides hc-pep2 and hcc-pep1 to tAb2 and its Fab fragment was studied by ITC measurements in several buffers and at different temperatures. Figure 6 shows a typical example of

Figure 4. Stereo view of peptide hc-pep2 with its binding partners in the binding groove of Fab fragment tAb2. hcpep2 is drawn in red, light chain residues in light blue and heavy chain residues in dark blue. hc-pep2 and two conserved water molecules (no. 9, no. 204) are shown with their 2FoÿFc electron density, contoured at 1.5 s. Hydrogen bonds between hc-pep2 and tAb2 are indicated by dotted lines in purple. Figures 4 and 5 were drawn with SETOR.18

300

Cross-reactive Peptide Binding to tAb2 Antibody

Table 4. Buried solvent excluded surface areas of individual CDRs and peptides in the tAb2/peptide interface calculated with MS 19 tAB2/hc-pep2 L1 L2 L3 H1 H2 H3 CDR Fab peptide a

tAB2/e-pep(a)

tAB2/e-pep(b)

Ê 2] [A

[%]a

Ê 2] [A

[%]a

Ê 2] [A

[%]a

75.5 13.9 117.9 51.9 25.0 94.7 378.8 421.5 380.2

17.9 3.3 28.0 12.3 5.9 22.5 89.9 100.0

76.3 49.5 120.8 55.3 13.1 101.1 416.0 460.1 412.7

16.6 10.8 26.3 12.0 2.8 22.0 90.5 100.0

71.1 53.6 123.9 62.2 18.7 96.3 425.8 470.9 410.2

15.1 11.4 26.3 132.1 4.0 20.5 90.4 100.0

Percent of the buried surfaces with Fab buried surface area set to 100 percent

the ITC experiments obtained with the linear peptide e-pep. Binding of the three peptides is characterized by exothermal heat effects (Figure 6(a)). The heat of each peak was corrected for the heat of dilution, transformed into kcal/mole of injectant and plotted against the molar ratio of peptide to antibody (Figure 6(b)). For ®tting of the data a binding model with identical and independent binding sites was assumed. The thermodynamic parameters for the binding of e-pep, hc-pep2 and hcc-pep1 to tAb2 and its Fab fragment are summarized in Table 5. Data were obtained at 10, 25 and 35  C and in buffers of different ionization enthalpy. The excellent agreement of the experimental data for tAb2 and Fab fragment containing two and one binding site, respectively, corroborates the presence of two identical and independent binding sites in tAb2. Peptides e-pep and hc-pep2 have similar binding constants (KA about 4  107 Mÿ1 at 25  C in phosphate buffer) whereas the af®nity of the disul®de bridged cyclic peptide hcc-pep1 is reduced (KA ˆ 6.7  106 Mÿ1 at 25  C in phosphate buffer). Similar binding constants were estimated for tAb2/e-pep and tAb2/hcc-pep1 in Pipes and Mops buffers, whereas KA for tAb2/hc-pep2 in Mops is slightly increased. The binding af®nities of all three peptides decrease with increasing temperatures, approximately 30 times for e-pep and

hc-pep2 and 20 times for hcc-pep1 between 10 and 35  C. The buffer dependence of
Hexp given in Table 5 indicates proton uptake at complex formation. In cases of proton linkage
Hexp is composed of the binding enthalpy
HBinding and the ionization enthalpy
HIon according to    ˆ
HBinding ‡ NH‡ 
HIon
Hexp

…1†

where NH‡ is the number of changed protons.20 Plotting
Hexp versus ionization enthalpy of the studied buffers (phosphate, Pipes, Mops, Tris: 1.2, 2.7, 5.2, 11.3 kcal molÿ1 , respectively) yields the number of released protons from the slope and
HBinding from the intercept with the ordinate (data not shown). 1.1 (0.1) protons were taken up per binding site and
HBinding values amount to ÿ24.4, ÿ26.7 and ÿ22.9 kcal molÿ1 for e-pep, hcpep2 and hcc-pep1, respectively (Table 5). The
HBinding values decrease with increasing temperature (Table 5). From the temperature dependence of
HBinding the heat capacity change
Cp was determined. The plots of
HBinding versus temperature (10, 25 and 35  C) are almost linear and result in negative
Cp values of ÿ0.298, ÿ0.341 and ÿ0.336 kcal molÿ1 Kÿ1 for the formation of the tAb2/e-pep, tAb2/hc-pep2 and tAb2/hcc-pep1 complexes, respectively.

Figure 5. Stereo view of the conformation of peptides e-pep (blue) and hc-pep2 (red) in the binding groove of tAb2. Internal hydrogen bonds are indicated by dotted lines. The least squares superposition was calculated on the basis of all Ca ± atoms in the VL and the VH domain.

301

Cross-reactive Peptide Binding to tAb2 Antibody

complexes at all tested conditions (data not shown). The experimentally determined total entropy change
Stot upon complex formation was dissected into three components according to
Stot ˆ
Ssol ‡
Sconf ‡
Srt

…2†

where
Ssol is the solvation entropy change upon binding;
Sconf is the conformational entropy change re¯ecting changes of the mobility of the amino acid side-chains of antibody and peptides and the increase of rigidity of the peptide backbone upon complex formation;
Srt re¯ects loss of translational and rotational degrees of freedom upon complex formation, and its debated size23 seems to be numerically close to the cratic entropy of 8 cal molÿ1 Kÿ1.21 The total entropy changes of the tAb2/e-pep, tAb2/hc-pep2 and tAb2/hcc-pep1 complexes are similar and in the range of ÿ46 to ÿ55 cal molÿ1 Kÿ1. Favorable solvent contributions
Ssol of 76, 87 and 86 cal molÿ1 Kÿ1 were calculated for the interaction of e-pep, hc-pep2 and hcc-pep1 with tAb2 at 25  C from the
Cp values of ÿ298, ÿ341 and ÿ336 cal molÿ1 Kÿ1 according to equation (3):
Ssol ˆ
Cp ln…T=Ts † Figure 6. (a) Isothermal titration pro®le of the binding process between antibody tAb2 and peptide e-pep at 35  C in 50 mM sodium phosphate (pH 7.2), 0.15 M NaCl. Each pulse corresponds to a 5-(l injection containing 0.19 mM of e-pep into the cell containing 4.1 (M of tAb2. (b) The area of each peak in (a) was integrated and corrected for saturation of titration. The corrected heat was divided by the moles of injectant and plotted as a function of the molar ratio of e-pep to tAb2. The data were analyzed with the software package Origin assuming identical and independent binding sites.


G and
S for the binding of the peptides e-pep, hc-pep2 and hcc-pep1 to tAb2 and its Fab fragment were calculated according to the standard equations. The results reveal that the binding reaction is enthalpically driven with favorable negative enthalpy and unfavorable negative entropy contributions (Table 5). The binding entropies of the three studied peptides are rather similar (T
S range between ÿ13.6 and ÿ16.4 kcal molÿ1 at 25  C). As the temperature is raised the binding reactions are characterized by more favorable enthalpy changes, while the entropy change becomes less favorable. Changes of the Gibbs free energies (
G ) with temperature are smaller than changes of
HBinding and T
S because of an entropy-enthalpy compensation as described for other antibody-antigen interactions.21,22 Plotting of ÿ
HBinding versus ÿT
S gives an almost linear correlation (slope 0.95; correlation coef®cient 0.97) for the three peptide-tAb2 and peptide-Fab tAb2

…3†

where
Cp is the heat capacity change, T the absolute temperature and Ts* the reference temperature of 385 K at which the apolar and polar contributions to the entropy are considered as zero.24 With ÿ8 cal molÿ1 Kÿ1 for
Srt24 unfavorable conformational entropy contributions result with
Sconf of ÿ116, ÿ134 and ÿ124 cal molÿ1 Kÿ1 for the binding of e-pep, hc-pep2 and hcc-pep1 to tAb2, respectively. In summary, the unfavorable total entropy change
Stot of complex formation is the sum of favorable solvation entropy changes
Ssol which are overcompensated by large unfavorable conformational entropy changes
Sconf and the contribution of
Srt.

Discussion The interaction of tAb2 with hc-pep2 is an example of cross-reactive binding of a cyclic peptide with a Fab fragment. Cyclic peptides are frequently more stable against proteolytic attack (see e.g.25,26), and, furthermore, cyclization of peptides imposes constraints on the conformational space, thus increasing the af®nity towards a target structure provided that the stabilized conformation is advantageous for binding (see e.g.27 ± 31). On the other hand, if the cyclization stabilizes unfavorable conformations, af®nity may decrease or even be lost. Thus, for proper cyclization either combinatorial peptide libraries should be used with different positions of cyclization (e.g. disul®de walk libraries5) or a cyclized peptide should be optimized for af®nity by substitutional analysis. For tAb2, two cyclized epitope homologous peptides

302

Cross-reactive Peptide Binding to tAb2 Antibody

Table 5. ITC results for binding of peptides e-pep, hc-pep1, hc-pep2 and hcc-pep1 to tAb2 and its Fab fragment Sample tAb2 ‡ e-pep (phosphate)

T ( C)


Hexp (kcal/mol)


HBinding (kcal/mol)

10

ÿ18.3

ÿ20.2

25

ÿ23.6

ÿ24.8

35

ÿ26.9

ÿ27.7

10

ÿ19.6

ÿ21.5

25

ÿ25.6

ÿ26.7

35

ÿ29.2

tAb2 ‡ hc-pep1 (phosphate)

25

tAb2 ‡ hcc-pep1 (phosphate)

KA (10ÿ6 (Mÿ1)

T
S (kcal/mol)

ÿ11.0

ÿ9.2

38.3

ÿ10.3

ÿ14.5

8.9

ÿ9.8

ÿ17.9

ÿ10.9

ÿ10.6

39.2

ÿ10.3

ÿ16.4

ÿ30.0

9.0

ÿ9.8

ÿ20.2

ÿ27.5

ÿ28.7

10.3

ÿ9.6

ÿ19.1

10

ÿ16.0

ÿ17.9

24.6

ÿ9.6

ÿ8.3

25

ÿ21.7

ÿ22.9

6.7

ÿ9.3

ÿ13.6

35

ÿ25.5

ÿ26.3

1.3

ÿ8.6

ÿ17.7

tAb2 ‡ e-pep (Pipes)

25

ÿ21.0

ÿ23.7

48.9

ÿ10.5

ÿ13.2

tAb2 ‡ hc-pep2 (Pipes)

25

ÿ23.0

ÿ25.7

47.0

ÿ10.5

ÿ15.2

tAb2 ‡ hcc-pep1 (Pipes)

25

ÿ19.2

ÿ21.9

7.8

ÿ9.4

ÿ12.5

tAb2 ‡ e-pep (Mops)

25

ÿ18.8

ÿ24.1

45.9

ÿ10.4

ÿ13.7

tAb2 ‡ hcpep2 (Mops)

25

ÿ20.8

ÿ26.0

98.3

ÿ10.9

ÿ15.1

tAb2 ‡ hcc-pep1 (Mops)

25

ÿ16.9

ÿ22.1

6.2

ÿ9.3

ÿ12.8

tAb2 ‡ e-pep (Tris)

25

ÿ12.7

ÿ24.0

58.2

ÿ10.6

ÿ13.4

Fab ‡ e-pep (phosphate)

25

ÿ23.4

ÿ24.6

38.4

ÿ10.3

ÿ14.3

Fab ‡ hc-pep2 (phosphate)

25

ÿ25.4

ÿ26.6

39.2

ÿ10.3

ÿ16.3

Fab ‡ hc-pep1 (phosphate)

25

ÿ27.1

28.3

9.7

ÿ9.5

ÿ18.8

Fab ‡ hcc-pep1 (phosphate)

25

ÿ22.1

ÿ23.3

5.6

ÿ9.2

ÿ14.1

tAb2 ‡ hc-pep2 (phosphate)

296


G (kcal/mol)

265


Hexp is the experimental value;
HBinding is corrected for the ionization enthalpies
HIon of the buffers at 25  C. T
S was calculated from
G and
HBinding. The buffer concentrations are 50 mM, 0.15 M NaCl at pH 7.2. The experimental errors of
Hexp were 41 % and of KA 4 10 %.

were selected by these methods8,9 with af®nities similar to that of the linear epitope peptide. One was cyclized by a disul®de bridge (hcc-pep1), the other by lactam formation between the N-terminal amino group of serine and the side-chain carboxy group of the C-terminal glutamic acid (hc-pep2).

Indeed, these cyclic peptides proved to be signi®cantly more stable against proteolytic attack (data not shown). The X-ray structures of the complexes of tAb2 with the linear peptide epitope e-pep and the cyclic epitope homologous peptide hc-pep2 as well as the microcalorimetric measurements allow

Cross-reactive Peptide Binding to tAb2 Antibody

a comparison of structural and thermodynamic parameters of the binding mode of these peptides. The structure of the Fab fragment, including the CDR regions, was found to be almost identical in the complexes with linear and cyclic peptide. The surfaces buried by complex formation are summerized in Table 4; the buried surfaces are at the lower limit but still similar to other antibody/peptide complexes.32 ± 34 The combining site of tAb2, in addition to the cleft usually observed with peptide binding antibodies,35 forms a deep depression in the center of the binding site accomodating two side-chains (Ser3 and His4) from the peptide. All six CDRs are in contact with the linear epitope peptide, except CDR 2L in the complex with the cyclic peptide hc-pep2. The main contribution to the interface comes from CDR 3L. The speci®city of epitope recognition is usually determined by the shape of the binding pocket and a pattern of hydrogen bonds and hydrophobic interactions. Both the backbone conformation and side-chain orientation together with the important contacts established with residues of the antibody binding site are very similar for the linear epitope peptide and its cyclic epitope homolog. The epitope peptide e-pep forms a turn (as many peptide epitopes do upon binding to antibody binding sites36) which is strictly conserved in the cyclic peptide hcpep2. The only difference is a small shift in the peptide backbone conformation of hc-pep2 allowing a better ®t of Glu7, which substitutes for Asp7 of the linear peptide e-pep. Interestingly, the substitutional analysis shows that a linear peptide epitope with a glutamic acid in that position does not bind at all. Generally, the pattern of key amino acid residues observed in the substitutional analyses (Figure 1) can be explained reasonably well by the X-ray structural data. All key amino acid residues, namely His4, Phe5, Asn6, Asp7 (or Glu7 in the cyclic peptide) form contacts with residues from the antibody binding site, thus probably contributing to the overall af®nity. The Ser3 position appears to be less speci®c and allows the accomodation of hydrophobic residues such as Phe, Leu, Val, Trp, Tyr with potential contact to Leu-L46 and/or TyrL49, which may substitute for the loss of the H-bond from Ser-3 to Asp-H101. In the case of His4 and Phe5 hydrophobic interactions play a major role. Both residues have a large surface area involved in the binding site and form contacts with hydrophobic residues. Calculated with XSAE, the surface area of His4 remaining solvent accessiÊ }2 for hc-pep2 (1.4 % of ble in the complex is 2.8 A the solvent accessible surface area of His in the pentapeptide GGHGG); the corresponding values Ê2 for the two Fab molecules with e-pep are 1.6 A }2 Ê (0.9 %) and 1.3 A (0.7 %). The solvent accessible Ê 2 (45 %) for areas of Phe5 in the complexes are 95 A Ê }2 (44 %) for e-pep(a) and hc-pep2, and 92 A e-pep(b). However, it should be mentioned that His4 is also involved in an H-bond to Gln-L89 Oe1 with its Ne2 atom functioning as a donor. This

303 could explain why His4 can be replaced by polar residues like asparagine and threonine (Figure 1(d)). Asn6 which is quite speci®c in this position in all peptides, forms two H-bonds, one with Glu-H50 of the antibody binding site, another with the buried water-9. Thus it becomes obvious from the X-ray structure why peptides Asn6 cannot be substituted with Asp nor by the larger Gln residue. Generally, the side-chain speci®city of the individual positions becomes less pronounced for the cyclic peptide hc-pep2 (Figure 1(d)) but more pronounced for the cyclic peptide with Asp7 instead of Glu (Figure 1(b)). In the latter case this is clearly due to the much lower af®nity of this peptide (data not shown) where weaker interactions are not detected at all. The substitution pattern for the disul®de-bridged peptide, hcc-pep1 (Figure 1(e)) is quite similar to that for the peptide hc-pep2 (Figure 1(d)). Thus hcc-pep1 probably has a similar binding pattern and backbone conformation in the complex with tAb2. The differences in the position Ser3 (e.g. that a substitution to lysine becomes acceptable) may be due to some in¯uence of the adjacent disul®de bridge on the side chain orientation of the serine. Some ambiguity is observed with the two N-terminal valine residues (Val1 and Val2) of the linear epitope peptide e-pep. These do not show up as key amino acid residues in a corresponding substitutional analysis37 which otherwise identi®es a speci®city pattern quite similar to those for hc-pep2 and hcc-pep1. Both Val residues can be exchanged by almost any other residue, but cannot be omitted without considerable loss of af®nity which is drastically reduced for the minimal epitope SHFND (data not shown). These residues apparently form hydrophobic contacts to the tAb2 binding site. On the other hand, another exchangeable position is that of Tyr8 in the cyclic peptides which in the X-ray structure indeed does not show any contact to the antibody or to any other residue within the peptide. 14 out of the 15 amino acid residues contacting the linear epitope are localized in the CDRs, and the remaining residue (Tyr-L49) is adjacent to CDR 2L. Only two residues, however, belong to the ten residues exchanged from the putative germline sequence within the CDR regions by af®nity maturation. This is in agreement with reports from the literature38,39 suggesting that an antibody selected from the existing germline gene repertoire already establishes the main binding pattern. The af®nity is subsequently improved or modulated by mutations which not necessarily modify sites of contact with the antigen, but stabilize the selected or induced CDR conformations. The structural similarity between the linear epitope peptide and its cyclized homolog demonstrates that cyclic peptides can be used as a tool to model the loop conformation of linear binders in the binding site if no crystal structure is available. On the other hand, conformations of peptides in complexes with antibodies do not necessarily re¯ect exactly the conformation of the correspond-

304 ing sequence range in the protein structure where these epitopes are derived from, even if the antibody cross-reacts with the native protein. This has been shown for antibodies binding linear epitopes of myohemerythrin,40 poliovirus,41 p24 (HIV-1),42 and gp120 (HIV-1)6. In the latter case, the same peptide is bound in different conformations by two different antibodies which both cross-react with the native gp120 structure. This is explained by some local ¯exibility of the corresponding sequence regions within the protein structure. tAb2 was raised against biologically active TGFa. NMR structures are available for the 50 amino acid residue polypeptide TGFa. A superposition of the e-pep conformation with the corresponding part of an energy minimized average NMR structure of this protein43 (PDB code 2TGF) shows large differences in the backbone conformations. Whereas in both structures a b-turn is formed and stabilized by a hydrogen bond, in TGFa this includes the residues Val1 to His4 but in e-pep the residues His4 to Asp7. Nevertheless, inspection of the set of 16 NMR models given by Moy et al.11 (PDB code 1YUF) clearly shows this part of the TGFa structure to be highly ¯exible (Val1 to His4) and instable (loss of the b-sheet contact for residues Phe5 and Asn6 at higher temperatures11) thus explaining the reactivity of the antibody with the native protein. The binding reactions of the linear e-pep and the cyclic peptides hc-pep2 and hcc-pep1 are enthalpically driven and entropically unfavorable as found for most of the antibody-antigen interactions studied up to now.21,22,44,45. With increasing temperatures the enthalpic contributions become more favorable and are compensated by an increase of the unfavorable entropy term resulting in only small changes of Gibbs free energy (Table 5) as described also for other antigen-antibody complexes (e.g.46,22). This common thermodynamic behavior is related to the role of solvent water molecules in the binding process47,48 and indicates, as well as the negative
Cp values, the involvement of hydrophobic interactions in the binding reactions.49 Water release from the interfaces of antibody and peptide by the burial of hydrophobic residues results in an increase of the solvent entropy favoring the complex formation. The favorable entropy gain can be partly compensated by a loss of enthalpy caused by weaker hydrogen bonds in bulk water. Ordering of water molecules in the binding region or its close neighborhood contributes unfavorably to entropy changes and favorably to enthalpy changes.50 This can be expected for the two deeply buried water molecules in the binding groove of tAb2/peptide complexes where they are in contact with antibody and peptide residues. Further large unfavorable entropy contributions originate from the loss of main-chain and sidechain ¯exibility upon complex formation. The binding of the linear peptide e-pep and the cyclic peptides hc-pep2 and hcc-pep1 to tAb2 is accompanied by the uptake of a proton per bind-

Cross-reactive Peptide Binding to tAb2 Antibody

ing site. A similar proton linkage but with proton release was observed for the binding of angiotensin II to the antibody Ab 131.44 The most likely candidate for a proton uptake in the tAb2 peptide complexes is His4 of the peptides. In the crystal structures of the tAb2/e-pep and tAb2/hc-pep2 complexes a hydrogen bond is formed between the His4 Ne2-atom and the Oe1 of Gln-L89. The disÊ for e-pep(a), e-pep(b) tances are 2.8, 2.7 and 2.7 A and hc-pep2, respectively. A second bond exists between the His4 Nd1-atom and the Od2 of Asp-7 in Ê distance) the tAb2/e-pep complex (2.9 and 2.7 A or the Oe2 of Glu-7 in the tAb2/hc-pep2 complex Ê distance). Interactions especially between (2.8 A the carboxylate groups of glutamate and aspartate and the imidazole groups of histidine were described earlier, e.g. in the case of ribonuclease T1.51,52 The intrinsic pKa values of the ionizable groups of aspartate, glutamate and histidine found in proteins are approximately 4.0, 4.4 and 6.5, respectively.53 Changes in the microenvironment upon complex formation can induce pKa shifts. In ribonuclease T1, electrostatic shielding of the basic histidine group in a hydrophobic surrounding increases the pKa value to 7.9.51,54 Similarly, in the tAb2/e-pep and tAb2/hc-pep2 complexes the histidine residues of e-pep and hc-pep2 become completely buried upon complex formation with the tAb2 Fab fragment (see Figure 3) in the close neighborhood of the carboxyl groups of Asp7 and Glu7, respectively, which most probably increases their pKa values and causes protonation. Energetically favorable, the positively charged His4 may form an ion pair with Asp7 or Glu7 or share the proton with these groups, stabilize in this way the proper peptide conformation and increase the binding af®nity. On the other hand, an aspartic Ê (e-pep) or 3.3 A Ê acid side-chain (AspH98) 3.2 A (hc-pep2) in distance from the peptides His-4 may add to af®nity by ionic interaction. Cyclization can have an advantageous effect on the binding af®nity of peptides because it restrains the number of possible peptide conformations in solution and reduces the entropic costs of complex formation. Thus, cyclization is expected to increase effectively the binding af®nity provided that all enthalpic contributions of an otherwise identical linear peptide are preserved. However, cyclization may have no or even a negative effect on the binding af®nity when the conformational restraints caused by the cyclization have disadvantageous enthalpic effects. The search for cyclic tAB2 binding peptides resulted in hc-pep2 (KA  4  107 Mÿ1), hc-pep1 (KA 1  107 Mÿ1) and in the cyclic peptide hcc-pep1 (KA 6  10}6 Mÿ1). The binding af®nity of hc-pep2 is comparable to that of the linear e-pep and about four times higher than that of hc-pep1, and the binding af®nity of the cyclic peptide hcc-pep1 is still high but signi®cantly reduced in comparison to that of the linear e-pep. For the cyclic peptides the favorable entropic contribution of cyclization to the total energy balance is not big enough to increase the binding af®nity in compari-

305

Cross-reactive Peptide Binding to tAb2 Antibody

son to the linear e-pep. This is corroborated by the dissection of the total binding entropy into
Ssolv,
Srt and
Sconf, which did not reveal signi®cant differences in the conformational entropy contributions to the binding of the three peptides. The analysis showed that enthalpic contributions dominate the binding reaction but cannot specify the contributions of individual amino acids. The contributions of the two N-terminal valines and the C-terminal aspartic acid of the linear e-pep may be larger than the contributions of the three C-terminal amino acids Glu, Tyr and Glu of hcpep2, thus compensating for the favorable effect of cyclization. This may explain why cyclization of the peptides did not promote the formation of binders with higher af®nity than that of the linear epitope. The substitutional analysis revealed that a marked increase in af®nity could be obtained by changing Asp7 in hc-pep1 to Glu7 in the cyclic peptide hc-pep2. This is obvious in Figure 1(b), where the spot intensity is higher for the glutamate in position 7 than for the aspartate, and from a comparison of the binding constants of hc-pep1 and hc-pep2 (Table 3). This shows that the af®nity of cyclic peptides can be improved by exchanges in key positions. In peptide hc-pep2, conformational constraints were introduced that help to ®x Glu7 in the orientation needed for binding. Its side-chain is pulled back and part of the backbone is shifted in the binding site so that the Glu7 side-chain moves to the same position as Asp7 in the tAb2/e-pep complex. In the case of hc-pep2, the decisive importance of cyclization is evident. Here the linear peptide h-pep2 does not at all bind to the antibody. Obviously, the sequence modi®cations cause serious disadvantages for the enthalpic contributions to the reaction despite of the preservation of the decisive amino acids at the same positions as in e-pep. The linear peptide cannot assume the conformation necessary for strong binding. In cyclic hc-pep2, however, the conformation is restrained such that optimal enthalpic contributions comparable to that of e-pep are possible rendering non-binding linear peptide h-pep2 by cyclization to the strong binder hc-pep2. In conclusion, cyclization of peptides aimed to improve biological stability and/or af®nity against high-molecular targets requires both proper choice of the number and position of the residues to be bridged as well as a substitutional analysis to optimize the interaction of the cyclic peptide with the target structure.

Material and Methods Sequencing Messenger-RNA was isolated from 1  107 hybridoma cells of the hybridom tAb24 using the FastTrackTMmRNA Isolation Kit (Invitrogen, Groningen, The Netherlands). First strand cDNA was synthesized from 400 ng poly(A)mRNA with oligo-(dT) priming (StrataScript RT-PCR-Kit, Stratagene, Europe, Amster-

dam, The Netherlands). The resulting single strand DNA was used for primary ampli®cation of the VH and VL sequences using PCR. The PCR primers used for the ampli®cation were chosen according to Jones and Bendig55 or were complementary to the conserved sequences at the 50 -end of CH1 (ASAYMCAGGGGCCAGTGGATAGAC) and Ck (CTGCTCACTGGATGGTGGGAAGATG) of the heavy and light chain, respectively. The sequencing reaction after TA cloning (Invitrogen, Groningen, The Netherlands) was done with T7 sequencing kit (Amersham Pharmacia Biotech Europe GmbH, Freiburg, Germany). For both VH and VL two separate clones were sequenced with two to three independent sequencing reactions in both directions. Sequence analyses were performed using DNA-plot.13 Amino acid numbering is according to Kabat.12 The sequences are deposited at the EMBL sequence database with the accession numbers AJ293333 for VH and AJ293334 for VL. Fab fragment preparation The murine anti-TGFa antibody tAb2 is of the IgG2a/ k type. The antibody was puri®ed from the tAb2 hybridoma cell line supernatant by af®nity chromatography with Protein G Sepharose (Amersham Pharmacia Biotech Europe GmbH, Freiburg, Germany). The Fab fragment was then prepared by proteolytic cleavage of tAb2 with 1 % (w/w) papain for two hours at 42  C, 0.1 M phosphate buffer (pH 7.0). The resulting Fab fragment was separated from Fc and uncleaved antibody by chromatography with Protein A Sepharose (Amersham Pharmacia Biotech Europe GmbH, Freiburg, Germany). Peptide synthesis and spot analysis The peptides were synthesized on a û-Ala-û-Ala matrix bound to cellulose sheets as distinct spots according to Frank and Overwin.56 Each amino acid position within the peptides was substituted by all other 19 amino acids. The cyclization protocols have been described before.57 The membrane-bound libraries were blocked overnight with blocking buffer, i.e. blocking reagent (CRB, Northwich, UK) in T-TBS (Tris buffered saline/0.05 % (v/v) Tween20) containing 5 % (w/v) sucrose. After washing with T-TBS, 1 mg/ml tAb2 in blocking buffer was added and incubated for three hours at room temperature. After washing three times with T-TBS, a peroxidase-labeled anti-mouse antibody (Sigma, Munich, Germany; both Abs 1 mg/ml in blocking buffer) was applied for two hours at room temperature. For detection, a chemiluminescence system (Boehringer Mannheim GmbH, Mannheim, Germany) was applied using standard X-ray ®lms. The relative spot intensities correlate with the binding af®nities.58 Soluble linear and cyclized peptides were synthesized according to standard Fmoc machine protocols using a multiple peptide synthesizer (Abimed, Langenfeld, Germany). Cyclization by disul®de bridge formation was performed by gently shaking a 2 mM aqueous solution of the peptide at pH 7.5 in the presence of 10 % (v/v) dimethyl sulfoxide overnight at room temperature. The cyclized peptide did not contain free SH groups as judged by the reaction with 5,50 -dithiobis(2-nitrobenzoic acid). For amide cyclization, the corresponding peptides in 2 mM N,N-dimethylformamide were treated with 2.2 mM benzotriazol-1-yloxytris(pyrrolidino)phospho-

306 nium hexa¯uorophosphate (PyBOP) and 4 mM 4-methylmorpholine overnight at room temperature. Crystallization and data collection The complexes of tAb2 Fab fragments with peptides epep and hc-pep2 were crystallized in hanging drop setups at room temperature with a 1.1-fold molar excess of peptide over Fab . The precipitant solutions were mixed with the protein solution (Fab tAb2/e-pep: 6-10 mg/ml; Fab tAb2/hc-pep2: 11-14 mg/ml in 20 mM Tris-HCl, pH 8.5) in a ratio of 1:3. For the Fab tAb2/e-pep setups the precipitant solution was 12 % PEG 8000 in 20 mM sodium acetate. For the Fab tAb2/hc-pep2 setups the precipitant solution was 12 % PEG MME 2000 and 5 mM NiCl2 in 0.1 M Tris-HCl buffer at pH 8.5. Data were collected on beamline X11 at the Outstation of the EMBL and on beamline BW6 of the MPG both at the Deutsches Elektronen Synchrotron (DESY) in Hamburg. Fab tAb2/e-pep crystals were cryoprotected with 15 % ethyleneglycol, Fab tAb2/hc-pep2 crystals with 15 % glycerol. Data collection was done at 100 K with nitrogen cooling. The data sets are more than 90 % comÊ (Table 2). The plete with a resolution better than 2.0 A VM-value for Fab tAb2/e-pep with two molecules in the asymmetric unit (called a and b) is 2.5 and for Fab tAb2/hc-pep2 with one molecule in the asymmetric unit is 3.0. Structure determination The structures were solved by Molecular Replacement using AmoRe.59 As a search model for the structure solution of Fab tAb2/hc-pep2 the Fab fragment F9.13.7 was used60 (PDB code 1FBI), because of its sequence similarity. The amino acids were changed to alanine and the coordinates were modi®ed with X-PLOR61 to create a set of models with elbow angles differing by steps of 10  . With these coordinate sets, molecular replacement was calculated giving a prominent peak in the case of the model Fab fragment with an elbow angle lowered by 10  as compared to F9.13.7. The inital R-factor after Ê ) and was lowmolecular replacement was 53.0 % (4-12 A ered to 45.2 % by rigid body re®nement in the same resolution range. Re®nement was done with refmac with maximum-likelihood and individual B-factor re®nement.62 Visual inspection and model building was done with O.63 409 water molecules, a nickel and a chloride ion were assigned using arpp.64 The re®nement converged with an Rfree of 26.9 % (Table 2). The Fab tAb2/hc-pep2 complex was used in molecular replacement to solve the structure of Fab tAb2/e-pep. Ê data it gave an initial R-factor of 46.6 % With 4.0-12.0 A that dropped to 42.6 % after rigid body re®nement. Further re®nement was done using NCS restraints for all residues from 5 to 207 of light and heavy chains. During the re®nement the NCS restraints were changed from ``tight'' to ``loose''. The C terminus of the heavy chain of Fab tAb2/e-pep(b) ends with Ile213, the heavy chain of Fab tAb2/e-pep(a) ends with Pro212 due to some disorder. The re®nement led to an Rfree of 31.1 % with 407 water molecules added to the coordinate set. The higher Rfree as compared to the case of hc-pep2 might be caused by the lower data quality in the high resolution range. The I/s is 2.2 for the highest resolution range of tAB2/e-pep as compared to a I/s of 6.5 in the highest resolution range in tAB2/hc-pep2. Also the high resolution range contains the data most important for

Cross-reactive Peptide Binding to tAb2 Antibody detecting the solvent sphere. This would explain why the number of waters per molecule is lower in the tAB2/ e-pep model than in the tAB2/hc-pep2 model. The surfaces buried by complex formation were calculated with MS.19 The solvent accessibilities of the peptides His and Phe residues were calculated with XSAE, Version 1.5 (C. Broger, personal communication) and NACCESS, V2.1.1 (http://sjh.bi.umist.ac.uk/download.html; S. Hubbard and J. Thornton, personal communication). All water molecules including the two in the binding pocket as well as the nickel and chloride ions were omitted from the atom coordinates prior to surface calculation.

Isothermal titration experiments For the titration experiments aliquots of antibody tAb2 and Fab tAb2 were dialyzed against the following buffers, each containing 0.15 M NaCl: 50 mM sodium phosphate (pH 7.2); 50 mM Pipes (pH 7.2); 50 mM Mops (pH 7.2) or 50 mM Tris-HCl (pH 7.2). Protein concentrations were determined spectrophotometrically at 280 nm using absorption coef®cients of A1 %,1 cm ˆ 14.1 for tAb2 and A1 %,1 cm ˆ 15.5 for Fab tAb2 and molar masses of 145,300 g molÿ1 and 46,500 g molÿ1, respectively. The concentrations of the cyclic peptides hc-pep2 and hcc-pep1 were estimated spectrophotometrically at 276 nm using absorption coef®cients of A1 %,1 cm ˆ 15.7 and A1 %,1 cm ˆ 16.1, respectively, which were calculated from the amino acid composition65 (http://www.expasy.ch/tools/protparam.html). The concentration of the linear peptide e-pep was estimated by weighing out the lyophilized sample. Isothermal titrations were performed at 10, 25 and 35  C using a MicroCal MCS system (MicroCal Inc., Northampton, MA). In a typical titration experiment, 5 ml volumes of peptide solution (about 200 mM) were injected into 1.4 ml antibody solution (around 5 mM). Prior to data analysis, heats of dilution of peptide solutions were subtracted from the experimental raw data as obtained from injections of peptide solutions into buffer or from the last injections of a titration experiment after complete saturation of the antibody. The resulting titration curves were analyzed using the software package ORIGIN (Microcal Software Inc., Northampton, MA.) and the data were ®tted to a model of identical and independent binding sites. The ®tting parameters are the number of binding sites, N, the binding enthalpy,
H exp, and the binding constant, KA. The experimental errors of N were in the most cases less than 10 % of the expected values of 2 and 1 for tAb2 and its Fab fragment, respectively, and only in few experiments values were obtained deviating up to 20 %. To determine whether proton linkage is a factor, ITC titrations were performed at 25  C in buffers of different ionization enthalpies
HIon (phosphate, 1.2 kcal molÿ1; Pipes, 2.7 kcal molÿ1; Mops, 5.2 kcal molÿ1; Tris, 11.3 kcal molÿ1.66,67 The ionization enthalpies of phospate buffer at 10  C (1.9 kcal molÿ1) and 35  C (0.8 kcal molÿ1) were calculated using its
Cp ˆ 0.045 kcal molÿ1 Kÿ1.67 Enthalpy changes,
HBinding, of the complex formation were determined by correction of experimentally obtained enthalpy changes,
Hexp, for
HIon of the respective buffer. The heat capacity change,
Cp, upon binding was determined from the slope of the plot of
HBinding versus temperature.

307

Cross-reactive Peptide Binding to tAb2 Antibody

Changes of the Gibbs free energy,
G , and of the entropy,
S , upon binding were calculated according to the standard equations. Atomic coordinates The coordinates have been deposited in the Protein Data Bank (accession codes 1E4X for the Fab tAb2/e-pep and 1E4W for the Fab tAb2/hc-pep2, respectively).

10.

11.

Acknowledgments We thank Victor Lamzin and the staff of the EMBL Outstation as well as Hans Bartunik and the staff of the MPG at DESY, Hamburg, for beamtime allocation and continuous support in the project (project number PX99309 at X11, P-99-37 at BW6). Also we thank Dina Reinhardt and Heinz Tanzmann for the help in antibody production and puri®cation. The work was supported by the Deutsche Forschungsgemeinschaft, grants no. SCHN 317/6-1 and GRK 80/2.

References 1. Kobrin, M. S., Samsoondar, J. & Kudlow, J. E. (1986). Alpha-transforming growth factor secreted by untransformed bovine anterior pituitary cells in culture. II. Identi®cation using a sequence-speci®c monoclonal antibody. J. Biol. Chem. 261, 1441414419. 2. Derynck, R., Goeddel, D. V., Ullrich, A., Gutterman, J. U., Williams, R. D., Bringman, T. S. & Berger, W. H. (1987). Synthesis of messenger RNAs for transforming growth factors alpha and beta and the epidermal growth factor receptor by human tumors. Cancer Res. 47, 707-712. 3. Rosenthal, A., Lindquist, P. B., Bringman, T. S., Goeddel, D. V. & Derynck, R. (1986). Expression in rat ®broblasts of a human transforming growth factor-cDNA results in transformation. Cell, 46, 301-309. 4. Hoeprich, P. D., Langton, B. C., Zhang, J. & Tam, J. P. (1989). Identi®cation of immunodominant regions of transforming growth factor alpha. J. Biol. Chem. 264, 19086-19091. 5. Reineke, U., Sabat, R., Misselwitz, R., Wel¯e, H., Volk, H.-D. & Schneider-Mergener, J. (1999). A synthetic mimic of a discontinuous binding site on interleukin-10. Nature Biotechnol. 17, 271-275. 6. Stan®eld, R., Cabezas, E., Satterthwait, A., Stura, E., Profy, A. & Wilson, I. (1999). Dual conformations for the HIV-1 gp120 V3 loop in complexes with different neutralizing fabs. Struct. Fold. Des. 7, 131142. 7. Altschuh, D., Vix, O., Rees, B. & Thierry, J. C. (1992). A conformation of cyclosporin A in aqueous environment revealed by the X-ray structure of a cyclosporin-Fab complex. Science, 256, 92-94. 8. Winkler, D., Schuster, A., Hoffmann, B. & Schneider-Mergener, J. (1995). Synthesis of cyclic peptide libraries bound to continuous cellulose membrane supports. In Peptides 1994, Proceedings 23rd European Peptide Symposium (Maia, H. L. S., ed.), pp. 485-486, ESCOM, Leiden. 9. Winkler, D., Stigler, R.-D., Hoffmann, B., Zahn, G., HoÈhne, W., Rappsilber, J. et al. (1998). Elucidation of the interaction of an anti-TGFa antibody with its

12.

13.

14.

15.

16.

17.

18. 19. 20.

21.

22.

23.

peptide epitope using combinatorial cyclic peptide libraries, binding studies, NMR, computer modelling and ¯exible docking techniques. In Peptides 1996, Proceedings 24th European Peptide Symposium (Ramage, R. & Epton, R., eds), pp. 913-914, May¯ower Scienti®c Ltd., Kingswinford. Schlunegger, M. P. & Grutter, M. G. (1992). An unusual feature revealed by the crystal structure at Ê resolution of human transforming growth 2. 2 A factor-beta 2. Nature, 358, 430-434. Moy, F. J., Li, Y. C., Rauenbuehler, P., Winkler, M. E., Scheraga, H. A. & Montelione, G. T. (1993). Solution structure of human type-alpha transforming growth factor determined by heteronuclear NMR spectroscopy and re®ned by energy minimization with restraints. Biochemistry, 32, 7334-7353. Kabat, E. A., Wu, T. T., Perry, H. M., Gottesmann, K. S. & Foeller, C. (1991). Sequences of Proteins of Immunological Interest, 5th edit., US Department of Health and Human Services and NIH, Bethesda, MD. Ruiz, M., Giudicelli, V., Ginestoux, C., Stoehr, P., Robinson, J., Bodmer, J. et al. (2000). IMGT, the international ImMunoGeneTics database. Nucl. Acid Res. 28, 219-221. Chacko, S., Silverton, E. W., Smith-Gill, S. J., Davies, D. R., Shick, K. A., Xavier, K. A. et al. (1996). Re®ned structures of bobwhite quail lysozyme uncomplexed and complexed with the HyHEL-5 Fab fragment. Proteins: Struct. Funct. Genet. 26, 5565. Muller, Y. A., Chen, Y., Christinger, H. W., Li, B., Cunningham, B. C., Lowman, H. B. & deVos, A. M. (1998). VEGF and the Fab fragment of a humanized neutralizing antibody: crystal structure of the comÊ resolution and mutational analysis of plex at 2. 4 A the interface. Structure, 6, 1153-1167. AyÈ, J., Keitel, T., KuÈttner, G., Wessner, H., Scholz, C., Hahn, M. & HoÈhne, W. (2000). Crystal structure of a phage library-derived single-chain Fv fragment complexed with turkey egg-white lysozyme at Ê resolution. J. Mol. Biol. 301, 239-246. 2.0 A BarreÂ, S., Greenberg, A. S., Flajnik, M. F. & Chothia, C. (1994). Structural conservation of hypervariable regions in immunoglobulins evolution. Struct. Biol. 1, 915-920. Evans, S. V. (1993). SETOR: hard-ware-lighted threedimensional solid model representations of macromolecules. J. Mol. Graphics, 11, 134-138. Connolly, M. L. (1983). Analytical molecular surface calculation. J. Appl. Crystallog. 16, 548-558. Baker, B. M. & Murphy, K. P. (1996). Evaluation of linked protonation effects in protein binding reactions using isothermal titration calorimetry. Biophys. J. 71, 2049-2055. Murphy, K. P., Freire, E. & Paterson, Y. (1995). Con®gurational effects in antibody-antigen interactions studied by microcalorimetry. Proteins: Struct. Funct. Genet. 21, 83-90. Wibbenmeyer, J. A., Schuck, P., Smith-Gill, S. J. & Willson, R. C. (1999). Salt links dominate af®nity of antibody HyHEL-5 for lysozyme through enthalpic contributions. J. Biol. Chem. 274, 26838-26842. Lavigne, P., Bagu, J. R., Boyko, R., Willard, L., Holmes, C. F. B. & Sykes, B. D. (2000). Structurebased thermodynamic analysis of the dissociation of protein phosphatase-1 catalytic subunit and microcystin-LR docked complexes. Protein Sci. 9, 252-264.

308 24. Murphy, K. P., Xie, D., Thompson, K. S., Amzel, L. M. & Freire, E. (1994). Entropy in biological binding processes: Estimation of translational entropy loss. Proteins: Struct. Funct. Genet. 18, 63-67. 25. Eichler, J., Lucka, A. W. & Houghten, R. A. (1994). Cyclic peptide template combinatorial libraries: synthesis and identi®cation of chymotrypsin inhibitors. Pept. Res. 7, 300-307. 26. Satoh, T., Li, S., Friedman, T. M., Wiaderkiewicz, R., Korngold, R. & Huang, Z. (1996). Synthetic peptides derived from the fourth domain of CD4 antagonize off function and inhibit T cell activation. Biochem. Biophys. Res. Commun. 224, 438-443. 27. Giebel, L. B., Cass, R. T., Milligan, D. L., Young, D. C., Arze, R. & Johnson, C. R. (1995). Screening of cyclic peptide phage libraries identi®es ligands that bind streptavidin with high af®nities. Biochemistry, 34, 15430-15435. 28. Ried, C., Wahl, C., Miethke, T., Wellnhofer, G., Landgraf, C., Schneider-Mergener, J. & Hoess, A. (1996). High af®nity endotoxin-binding and neutralizing peptides based on the crystal structure of recombinant Limulus anti-lipopolysaccharide factor. J. Biol. Chem. 271, 28120-28127. 29. Belhadj-Jrad, B., Massou, S., Czaplicki, J., Moureau, C., Moynier, M., Fourquet, P. et al. (1998). Structure/antigenicity relationship of cyclic and linear peptides mimicking the V3 loop of HIV2 envelope glycoprotein. Res. Virol. 149, 363-373. 30. Cabezas, E., Wang, M., Parren, P. W., Stan®eld, R. L. & Satterthwait, A. C. (2000). A structure-based approach to a synthetic vaccine for HIV-1. Biochemistry, 39, 14377-14391. 31. Venkatesh, N., Im, S. H., Balass, M., Fuchs, S. & Katchalski-Katzir, E. (2000). Prevention of passively transferred experimental autoimmune myasthenia gravis by a phage library-derived cyclic peptide. Proc. Natl Acad. Sci. USA, 97, 761-766. 32. Padlan, E. A. (1996). X-ray crystallography of antibodies. Advan. Protein Chem. 49, 57-133. 33. Webster, D. M., Henry, A. H. & Rees, A. R. (1994). Antibody-antigen interactions. Curr. Opin. Struct. Biol. 4, 123-129. 34. Stan®eld, R. L. & Wilson, I. A. (1995). Protein-peptide interactions. Curr. Opin. Struct. Biol. 5, 103-113. 35. MacCallum, R. M., Martin, A. C. & Thornton, J. M. (1996). Antibody-antigen interactions: contact analysis and binding site topography. J. Mol. Biol. 262, 732-745. 36. Wilson, I. A. & Stan®eld, R. L. (1994). Antibodyantigen interactions: new structures and new conformational changes. Curr. Opin. Struct. Biol. 4, 857-867. 37. Schneider-Mergener, J., Kramer, A. & Reineke, U. (1996). Peptide libraries bound to continuous cellulose membranes: tools to study molecular recognition. In Combinatorial Libraries: Synthesis, Screening and Application Potential (Riccardo Cortese, R., ed.), vol. 53-68, , Walter de Gruyter, Berlin, NewYork. 38. Hawkins, R. E., Russell, S. J., Baier, M. & Winter, G. (1993). The contribution of contact and non-contact residues of antibody in the af®nity of binding to antigen. The interaction of mutant D1.3 antibodies with lysozyme. J. Mol. Biol. 234, 958-964. 39. Wedemayer, G. J., Patten, P. A., Wang, L. H., Schultz, P. G. & Stevens, R. C. (1997). Structural insights into the evolution of an antibody combining site. Science, 276, 1665-1669. 40. Stan®eld, R. L., Fieser, T. M., Lerner, R. A. & Wilson, I. A. (1990). Crystal structures of an anti-

Cross-reactive Peptide Binding to tAb2 Antibody

41.

42.

43.

44.

45.

46.

47.

48. 49. 50.

51.

52.

53. 54.

55. 56.

body to a peptide and its complex with peptide Ê . Science, 248, 712-719. antigen at 2.8 A Wien, M. W., Filman, D. J., Stura, E. A., Guillot, S., Delpeyroux, F., Crainic, R. & Hogle, J. M. (1995). Structure of the complex between the Fab fragment of a neutralizing antibody for type 1 poliovirus and its viral epitope. Nature Struct. Biol. 2, 232-243. Keitel, T., Kramer, A., Wessner, H., Scholz, C., Schneider-Mergener, J. & HoÈhne, W. (1997). Crystallographic analysis of anti-p24 (HIV-1) monoclonal antibody cross-reactivity and polyspeci®city. Cell, 91, 811-820. Harvey, T. S., Wilkinson, A. J., Tappin, M. J., Cooke, R. M. & Campbell, I. D. (1991). The solution structure of human transforming growth factor alpha. Eur. J. Biochem. 198, 555-562. Murphy, K. P., Xie, D., Garcia, K. C., Amzel, L. M. & Freire, E. (1993). Structural energetics of peptide recognition: angiotensin II/antibody binding. Proteins: Struct. Funct. Genet. 15, 113-120. Shick, K. A., Xavier, K. A., Rajpal, A., Smith-Gill, S. J. & Willson, R. C. (1997). Association of the antihen egg lysozyme antibody HyHEL-5 with avian species variant and mutant lysozymes. Biochim. Biophys. Acta, 1340, 205-214. Xavier, K. A., Shick, K. A., Smith-Gill, S. J. & Willson, R. C. (1997). Involvement of water molecules in the assoziation of monoclonal antibody HyHEL-5 with bobwhite quail lysozyme. Biophys. J. 73, 2116-2125. Lumry, R. & Rajender, S. (1970). Enthalpy-entropy compensation phenomena in water solutions of proteins and small molecules: a ubiquitous property of water. Biopolmers, 9, 1125-1127. Dunitz, J. D. (1995). Win some, lose some. Enthalpyentropy compensation in weak intermolecular interactions. Chem. Biol. 2, 709-712. Murphy, K. P. & Freire, E. (1992). Thermodynamics of structural stability and cooperative folding behavior in proteins. Advan. Protein Chem. 43, 323-361. Bhat, T. N., Bentley, G. A., Boulot, G., Greene, M. I., Tello, D., Dall'Acqua, W. et al. (1994). Bound water molecules and conformational stabilization help mediate an antigen-antibody association. Proc. Natl Acad. Sci. USA, 91, 1089-1093. Pongs, O. & RuÈterjans, H. (1971). On the mechanism of action of ribonuclease T1. Nuclear magnetic resonance study on the active site. Eur. J. Biochem. 18, 313-318. McNutt, M., Mullins, M. S., Raushel, F. M. & Pace, C. N. (1990). Contribution of histidine residues to the conformational stability of ribonuclease T1 and mutant Glu58-Ala. Biochemistry, 29, 7572-7576. Creighton, T. E. (1993). Proteins: Structures and Molecular Properties, 2nd edit., p. 6, W. H. Freeman and Company, New York. Haun, M. F., Wirth, M. & RuÈterjans, H. (1995). Calorimetric investigation of thermal stability and ligand-binding characteristics of disul®de-bondcleaved ribonuclease T1. Eur. J. Biochem. 227, 516523. Jones, S. T. & Bendig, M. M. (1991). Rapid cloning of full-length mouse immunoglobulin variable regions. Biotechnology, 9, 88-89. Frank, R. & Overwin, H. (1996). SPOT synthesis. Epitope analysis with arrays of synthetic peptides prepared on cellulose membranes. Methods Mol. Biol. 66, 149-169.

Cross-reactive Peptide Binding to tAb2 Antibody 57. Volkmer-Engert, R., Landgraf, C. & SchneiderMergener, J. (1998). Charcoal surface-assisted catalysis of intramolecular disul®de bond formation in peptides. J. Pept. Res. 51, 365-369. 58. Volkmer-Engert, R., Ehrhard, B., Hellwig, J., Kramer, A., HoÈhne, W. E. & Schneider-Mergener, J. (1994). Preparation, analysis and antibody binding studies of simultaneously synthesized soluble and cellulose-bound HIV-1 p24 peptide epitope libraries. Letters Pept. Sci. 1, 143-153. 59. Navaza, J. (1994). AMoRe: an automated package for molecular replacement. Acta Crystallog. sect. A, 50, 157-163. 60. Lescar, J., Pellegrini, M., Souchon, H., Tello, D., Poljak, R. J., Peterson, N. et al. (1995). Crystal structure of a cross-reaction complex between Fab F9.13.7 and guinea fowl lysozyme. J. Biol. Chem. 270, 1806718076. 61. BruÈnger, A. T. (1992). X-PLOR Manual, Version 3.1, Yale University Press, New Haven, CT.

309 62. Murshudov, G. N., Vagin, A. A. & Dodson, E. J. (1997). Re®nement of macromolecular structures by the maximum-likelihood method. Acta Crystallog. sect. D, 53, 240-255. 63. Jones, T. A. (1978). A graphics model building and re®nement system for macromolecules. J. Appl. Crystallog. 11, 268-272. 64. Lamzin, V. S. & Wilson, K. S. (1993). Automated re®nement of protein models. Acta Crystallog. sect. D, 49, 129-147. 65. Gill, S. C. & von Hippel, P. H. (1989). Calculation of protein extinction coef®cients from amino acid sequence data. Anal. Biochem. 182, 319-326. 66. Christensen, J. J., Hansen, L. D. & Izatt, R. M. (1976). Handbook of Proton Ionization Heats, John Wiley & Sons, New York. 67. Fukuda, H. & Takahashi, K. (1998). Enthalpy and heat capacity changes for the proton dissociation of various buffer components in 0.1 M potassium chloride. Proteins: Struct. Funct. Genet. 33, 159-166.

Edited by I. Wilson (Received 18 May 2001; received in revised form 26 September 2001; accepted 27 September 2001)