Cross-talk between CD38 and TTP Is Essential for Resolution of Inflammation during Microbial Sepsis

Article

Cross-talk between CD38 and TTP Is Essential for Resolution of Inflammation during Microbial Sepsis Graphical Abstract

Authors Yeonsoo Joe, Yingqing Chen, Jeongmin Park, ..., Jeong Woo Park, Uh-Hyun Kim, Hun Taeg Chung

Correspondence [email protected] (U.-H.K.), [email protected] (H.T.C.)

In Brief Sepsis as a clinical syndrome is characterized by systemic inflammation and widespread tissue injury. Joe et al. suggest that the activation of TTP, an RNA binding protein, helps to ameliorate the inflammatory response and promote bacterial clearance in sepsis.

Highlights d

CD38 induces TTP in the onset of acute inflammation

d

TTP-dependent degradation of CD38 activates Sirt1 at the onset of resolution

d

TTP controls the resolution of inflammation during sepsis

d

Carbon monoxide inhibits inflammation in sepsis by increasing TTP expression

Joe et al., 2020, Cell Reports 30, 1063–1076 January 28, 2020 ª 2019 The Author(s). https://doi.org/10.1016/j.celrep.2019.12.090

Cell Reports

Article Cross-talk between CD38 and TTP Is Essential for Resolution of Inflammation during Microbial Sepsis Yeonsoo Joe,1,6 Yingqing Chen,2,3,6 Jeongmin Park,1 Hyo Jeong Kim,1 So-Young Rah,2 Jinhyun Ryu,4 Gyeong Jae Cho,4 Hye-Seon Choi,1 Stefan W. Ryter,5 Jeong Woo Park,1 Uh-Hyun Kim,2,* and Hun Taeg Chung1,7,* 1School

of Biological Sciences, University of Ulsan, Ulsan 44610, Korea Creative Research Laboratory for Ca2+ signaling Network, Chonbuk National University Medical School, Jeonju 54907, Korea 3Dalian University Medical College, Dalian 116622, China 4Department of Anatomy, School of Medicine and Institute of Health Sciences, Gyeongsang National University, Jinju 52728, Korea 5Joan and Sanford I. Weill Department of Medicine, Division of Pulmonary and Critical Care Medicine, Weill Cornell Medical Center, New York, NY 10065, USA 6These authors contributed equally 7Lead Contact *Correspondence: [email protected] (U.-H.K.), [email protected] (H.T.C.) https://doi.org/10.1016/j.celrep.2019.12.090 2National

SUMMARY

The resolution phase of acute inflammation is essential for tissue homeostasis, yet the underlying mechanisms remain unclear. We demonstrate that resolution of inflammation involves interactions between CD38 and tristetraprolin (TTP). During the onset of acute inflammation, CD38 levels are increased, leading to the production of Ca2+signaling messengers, nicotinic acid adenine dinucleotide phosphate (NAADP), ADP ribose (ADPR), and cyclic ADPR (cADPR) from NAD(P)+. To initiate the onset of resolution, TTP expression is increased by the second messengers, NAADP and cADPR, which downregulate CD38 expression. The activation of TTP by Sirt1-dependent deacetylation, in response to increased NAD+ levels, suppresses the acute inflammatory response and decreases Rheb expression, inhibits mTORC1, and induces autophagolysosomes for bacterial clearance. TTP may represent a mechanistic target of anti-inflammatory agents, such as carbon monoxide. TTP mediates crosstalk between acute inflammation and autophagic clearance of bacteria from damaged tissue in the resolution of inflammation during sepsis. INTRODUCTION Sepsis as a clinical syndrome is characterized by systemic inflammation and widespread tissue injury (Kotas and Medzhitov, 2015). The innate immune response involves several processes including inflammation, resolution, and post-resolution (Newson et al., 2014). To preserve tissue homeostasis during the inflammatory response, the stage of inflammation resolution is required in sepsis or chronic inflammation (Kotas and Medz-

hitov, 2015; Rauber et al., 2017). Nevertheless, the mechanisms underlying the resolution of metabolic deregulation and the prevention of multi-organ dysfunction or failure remain elusive. Stressed or damaged cells in tissue can release NAD+, which can act as a potential damage-associated molecular pattern (DAMP). NAD+ is mainly hydrolyzed by CD38 (NAD glycohydrolase [NADase]), which is expressed on a wide variety of cell types. CD38 has diverse functions, including the generation of Ca2+-mobilizing metabolites, cell activation, and chemotaxis (Malavasi et al., 2008). CD38 can exert multiple enzymatic activities, such as synthesizing and hydrolyzing Ca2+-signaling messengers, cyclic ADP-ribose (cADPR), and nicotinic acid adenine dinucleotide phosphate (NAADP) (Kim, 2014; Lee, 2011). An increase of intracellular Ca2+ levels ([Ca2+]i) in response to cADPR or NAADP can promote chemotaxis (Rah et al., 2005), phagocytosis (Kang et al., 2012), and cytokine secretion (Rah and Kim, 2012). However, following the inflammation phase, the role of CD38 has not been studied. The immune response commences with a marked stabilization of inflammation-associated mRNAs, including cytokine and chemokine mRNAs, whereas a timely and efficient degradation of such transcripts highlights the resolution phase of inflammation (Ebner et al., 2017; Kafasla et al., 2014). mRNA stability is controlled by cis-acting regulatory elements located mostly in the 30 -UTRs and by trans-acting RNA-binding proteins and microRNAs (miRNAs) (Kafasla et al., 2014; Wells et al., 2017). Tristetraprolin (TTP, encoded by Ttp, also known as Zfp36) is an RNA-binding and RNA-destabilizing protein that preferentially targets AU-rich elements (AREs) in 30 UTRs of mRNAs targeted for degradation by recruiting the deadenylase and the decapping complex (Wells et al., 2017). A multifaceted and incompletely understood regulation of TTP by transcriptional, posttranscriptional, and posttranslational mechanisms orchestrates TTP activity, such that an efficient degradation of target mRNAs occurs in the resolution phase of inflammation, thus avoiding premature degradation of target

Cell Reports 30, 1063–1076, January 28, 2020 ª 2019 The Author(s). 1063 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Figure 1. CD38-Catalyzed NAADP and cADPR Induces TTP Expression via the cAMP/PKA/CREB Pathways in LPS-Challenged Macrophages (A and B) Expression of Cd38 (A) in BMDMs of C57BL/6 mice and Ttp (B) in BMDMs of Cd38+/+ and Cd38/ mice treated with or without LPS (100 ng/mL) for 12 h (n = 4). (C) Expression of Ttp in BMDMs of Ttp+/+ and Ttp/ pretreated with BAPTA-AM (20 mM), NED-19 (10 mM), xestospongin C (Xes, 2 mM), 8-Br-cADPR (100 mM), and 8-Br-ADPR (100 mM) for 30 min and then treated with LPS (100 ng/mL) for 12 h (n = 3). (D and E) Expression of Ttp in BMDMs of CD38+/+ and CD38/ treated with NAADP-AM (100 nM) (D) and cADPR (100 nM) (E) in the presence or absence of LPS (100 ng/mL) for 12 h (n = 4).

(legend continued on next page)

1064 Cell Reports 30, 1063–1076, January 28, 2020

mRNAs (Brook et al., 2006; Hitti et al., 2006; Kratochvill et al., 2011; Schaljo et al., 2009; Stoecklin et al., 2004). Gene expression and protein stability of TTP is dependent on p38 mitogen-activated protein kinase (p38 MAPK), whereas its anti-inflammatory action is regulated by phosphorylation of TTP at S52 and S178 (Mahtani et al., 2001; Marchese et al., 2010; Ross et al., 2017). During the inflammatory response, TTP dephosphorylation catalyzed by protein phosphatase-2A (PP2A) generates the active form of TTP, leading to the degradation of pro-inflammatory cytokines (Shanley et al., 2001; Sun et al., 2007). During the onset and resolution phases in chronic inflammatory disease or sepsis, the mechanisms of TTP regulation remain unknown. We suggest that the increase of TTP expression and activity may resolve severe inflammation associated with diseases such as sepsis. Carbon monoxide (CO), as an inducer of TTP activation (Joe et al., 2015), may represent a possible therapeutic strategy to ameliorate septic shock. CO is produced endogenously by heme oxygenase (HO) enzymes (Ryter and Choi, 2013). Application of CO at low concentration can modulate vascular tone (Durante et al., 2006), inflammation (Otterbein et al., 2000), neurotransmission (Verma et al., 1993), cell proliferation (Morita et al., 1997), programmed cell death (Brouard et al., 2000), mitochondrial biogenesis (Suliman et al., 2007), and autophagy (Lee et al., 2011). Previously, we have shown that CO increased TTP expression in acute lung injury (ALI) to inhibit the inflammatory response (Joe et al., 2015). Therefore, to resolve the late stage of inflammation, an endogenous TTP activator such as CO may be required. In the current study, we sought to identify the regulation of key signaling pathways throughout the entire innate immune response. We found that the increase of CD38 at the onset of inflammation increased TTP expression and activity, and subsequently, at the start of the resolution phase, led to CD38 degradation, a rise of NAD+ levels, and activation of Sirt1. We suggest a mechanism by which the active form of TTP is regulated by Sirt1-dependent deacetylation in chronic inflammation or sepsis. Consequently, TTP activation by Sirt1 suppressed the expression of Ras homology enriched in brain (Rheb), via destabilizing Rheb mRNA, leading to mTORC1 inactivation and increased autophagolysosome formation. Therefore, we demonstrate that TTP activation ameliorates the inflammatory response and promotes autophagic bacterial clearance in sepsis. We also provide further evidence that TTP is a mechanistic target that mediates the anti-inflammatory activity of CO in sepsis. We conclude that the nexus of TTP and CD38 provides a mechanism of control that spans the onset to the resolution of inflammation in sepsis.

RESULTS CD38-Catalyzed NAADP and cADPR Production Induces TTP Expression via the cAMP/PKA/CREB Pathways in LPS-Challenged Macrophages CD38 regulates the innate immune response against infection by enhancing chemotaxis and phagocytosis (Kang et al., 2012; Lischke et al., 2013; Song et al., 2008). After clearing the infection, the body must maintain homeostasis of the immune response. We hypothesized that when inflammation increases in the early phase of the innate immune response, the immune system prepares for the resolution of inflammation via the regulation of CD38. Consistent with previously reported results (Lee et al., 2012), LPS treatment significantly increased Cd38 mRNA expression in macrophages (Figure 1A). In addition, LPS is known to increase TTP expression via transcriptional regulation, yet the mechanisms remain unclear (Tchen et al., 2004). Here, we demonstrated that the regulation of TTP expression by LPS is dependent on CD38. Ttp mRNA levels were increased by LPS in wild-type (Cd38+/+) BMDM but not in Cd38/ BMDM (Figure 1B). The activation of CD38 produces three Ca2+ mobilizing second messengers: ADPR, cADPR, and NAADP. To investigate the effects of these molecules on TTP expression during LPS challenge, we applied an intracellular calcium chelator, BAPTA-AM, and several Ca2+ channel inhibitors. As shown in Figure 1C, TTP expression induced by LPS was suppressed by BAPTA-AM, an intracellular Ca2+ chelator. However, xestospongin C (XeC), an inositol trisphosphate (IP3) receptor antagonist, did not inhibit LPS-induced TTP expression, suggesting that IP3-mediated Ca2+ increase is not required for TTP expression. Treatment with NED-19, a structural analog of NAADP that blocks NAADP-dependent Ca2+ release or with 8-Br-cADPR, a cell permeable antagonist of cADPR, reduced LPS-induced TTP expression in BMDM. However, treatment with 8-Br-ADPR, a cell permeable antagonist of ADPR, did not decrease LPS-induced TTP expression in BMDM (Figure 1C). As expected, the regulation of Ttp mRNA by LPS or antagonist compounds was not observed in Ttp/ BMDM (Figure 1C). To further evaluate the effect of CD38 on TTP expression, we treated BMDM isolated from Cd38+/+ and Cd38/ mice, with NAADP-AM or cADPR with or without LPS challenge (Figures 1D, 1E, and S1A). NAADP-AM or cADPR significantly increased Ttp mRNA levels in both Cd38+/+ and Cd38/ BMDM. However, the increase of TTP expression by NAADP-AM (Figure 1D) or cADPR alone (Figure 1E) in Cd38/ BMDM was lower than that observed in Cd38+/+ BMDM. Treatment with NAADP-AM or cADPR during LPS challenge synergistically increased TTP expression in Cd38+/+ BMDM (Figures 1D and 1E). As shown in

(F) Levels of intracellular cAMP in RAW 264.7 cells treated with LPS (100 ng/mL) for 30 min, NAADP-AM (100 nM), cADPR (100 nM), and forskolin (10 mM) for 10 min (n = 3). (G and H) IB analysis (G) and Ttp expression (H) of RAW 264.7 cells pretreated with H89 (2 mM) for 30 min and then treated with LPS (100 ng/mL), NAADP-AM (100 nM), cADPR (100 nM), and forskolin (100 mM) for 10 min (n = 4). (I–K) Luciferase activity in HepG2 cells treated with NAADP-AM (100 nM) or cADPR (100 nM) for 24 h (I) (n = 3); pretreated with H89 (2 mM) for 30 min and then treated with NAADP-AM (100 nM) or cADPR (100 nM) (J) (n = 3); and transfected with control siRNA or CREB-siRNA for 48 h (K) (n = 3). Data are represented as mean ± SD, *p < 0.05; **p < 0.01; ***p < 0.001; NS, not significant. (L) Proposed model of CD38-induced TTP expression. See also Figure S1.

Cell Reports 30, 1063–1076, January 28, 2020 1065

Figures 1D and 1E, NAADP-AM or cADPR promoted TTP expression in Cd38/ BMDM in the presence of LPS; whereas LPS alone had no effect in Cd38/ BMDM. These results confirm that CD38 plays an important role in the upregulation of TTP during LPS challenge. Taken together, we demonstrated that among the three end-products of CD38 activation, the regulation of TTP expression was mediated primarily by NAADP and cADPR. NAADP and cADPR can modulate the cAMP/protein kinaseA (PKA) signaling pathway (Rah et al., 2010); and both Ttp mRNA and TTP protein levels can be increased with cAMP analogs (Jalonen et al., 2007). Based on these reports, we investigated whether Ttp mRNA expression induced by NAADP or cADPR may be mediated by the cAMP-PKA-CREB signaling pathway. We observed that the concentration of cAMP was significantly increased by LPS, NAADP, cADPR, and by the positive control forskolin (Figure 1F). LPS-induced cAMP was blocked by BAPTA-AM or Ned19 (Figure S1B), suggesting that the responsible adenylyl cyclase is dependent on NAADP-mediated Ca2+ signals. Sub-micromolar Ca2+ activates AC1, AC3, and AC8, among nine AC isoforms (Halls and Cooper, 2011). As shown in Figure S1C, LPS-induced cAMP is mediated by AC3, which is dependent on NAADP-Ca2+ signals. Next, we found that the level of phospho (p)-CREB after treatment with LPS, NAADP, cADPR, or forskolin was remarkably increased; whereas after pretreatment with the PKA inhibitor, H89, the expression of p-CREB in response to these agents was significantly decreased (Figure 1G). Moreover, LPS-induced TTP expression was decreased by H89 in a dose-dependent manner (Figure S1D). Application of H89 decreased NAADP, cADPR, and forskolin-dependent TTP expression (Figure 1H). We also demonstrated the transcriptional upregulation of TTP in response to NAADP or cADPR, using a Ttp promoter luciferase assay (Figure 1I). The activation of TTP promoter activity by NAADP or cADPR was suppressed in the presence of H89 (Figure 1J). Putative binding sites for CREB were previously identified in the Ttp promoter (Li and Dahiya, 2002). To investigate the involvement of CREB in the regulation of TTP transcription in response to NAADP or cADPR, a series of promoter constructs including the full-length region (hTTP-1343), and truncated promoter regions, hTTP-812, hTTP-211, and hTTP-41 were generated (Figure S1E, left). The promoter construct with deletion of two CREB biding sites (hTTP-41) displayed no significant activity in response to NAADP treatment in comparison with the full-length construct (hTTP-1343), or with the two constructs with deletion of one CREB binding site (hTTP-812 or hTTP-211) (Figure S1E, right). To clarify whether the TTP transcription was related to the activation of p-CREB, we performed a dual luciferase assay after transfection with either non-targeting (scramble) small interfering RNA (siRNA), or siRNA targeting CREB. In cells subjected to CREB knockdown, NAADP or cADPR did not increase Ttp promoter activity (Figure 1K). This result indicates that the transcription of TTP is clearly regulated by p-CREB. We suggest that CD38 regulates the expression of TTP in response to LPS challenge, through the production of NAADP and cADPR, which is mediated by the cAMP/p-CREB signaling pathway (see schema in Figure 1L).

1066 Cell Reports 30, 1063–1076, January 28, 2020

TTP Reduces CD38 Expression in the Resolution Phase of Inflammation CD38 acts as a critical regulator of inflammation by controlling neutrophil chemotaxis (Partida-Sa´nchez et al., 2001). Nevertheless, in sepsis, the inhibition of CD38/cADPR signaling pathway protects against sepsis-induced damage (Peng et al., 2016). Therefore, CD38 should be regulated in the resolution of inflammation. We suggest the possibility of posttranscriptional regulation because Cd38 has several AU-rich elements (ARE) in the 30 untranslated region (UTR) (Figure S1F). First, we measured the Cd38 mRNA levels in Ttp+/+ and Ttp/ BMDM after LPS treatment to determine the role of TTP in CD38 regulation by LPS (Figure 2A). In wild-type (Ttp+/+) BMDM, Cd38 expression in response to LPS increased to high levels at 6 h, and then decreased gradually thereafter. However, in Ttp/ BMDM, Cd38 levels continued to rise after 6 h of LPS treatment. This result indicates that the reduction of Cd38 mRNA expression at later time points after LPS-treatment is dependent on TTP. To confirm whether TTP can regulate Cd38 mRNA stability, we overexpressed Ttp mRNA in BMDM, and subsequently challenged these cells with LPS. In cells transfected with pcDNA6 (control vector), the Cd38 expression was significantly increased in response to stimulation with LPS, while cells overexpressing TTP (V5-TTP) displayed remarkably decreased Cd38 mRNA levels (Figures 2B and 2C). Next, we analyzed the direct ability of TTP for degradation of LPS-induced Cd38 mRNA. The halflife of Cd38 mRNA was significantly decreased in cells transfected with v5-TTP compared to pcDNA6 transfected cells after stimulation with LPS (Figure 2D). By measuring the luciferase activity of a Cd38 30 -UTR construct (Figure 2E), we confirmed that TTP regulates CD38 at a post-transcriptional level, and decreases the mRNA stability of Cd38. In addition, cells transfected with siRNA against TTP significantly increased Cd38 mRNA expression after stimulation with LPS, relative to cells transfected with non-targeting siRNA (Figures 2F–2H). Furthermore, we found that LPS-induced TTP protein co-immunoprecipitated with Cd38 mRNA, in an RNA immunoprecipitation (RNA-IP) reaction (Figure 2I). To control inflammation, not only TTP expression, but also TTP activation, may play a critical role. TTP activity is potentially regulated by phosphorylation and dephosphorylation. For example, it has been reported that TTP must be negatively regulated via p38 MAPK, in order to stabilize tumor necrosis factor alpha (TNF-a) (tnfa) or interleukin (IL)-1b (Il1b) mRNA (Mahtani et al., 2001). p38 MAPK activation controls the gene expression and protein stability of TTP via regulating the phosphorylation status of TTP protein (Mahtani et al., 2001; Marchese et al., 2010). Consistent with these previous results, a p38 MAPK inhibitor, SB20358, inhibited LPS-induced TNF-a, IL-1b, and TTP expression in wild-type (Ttp+/+) cells (Figures S2G–S2I). It has also been reported that the activation of PP2A and calcineurin may play an important role in TTP activation (Ross et al., 2017; Wu et al., 2018). Thus, to determine whether PP2A and calcineurin mediate the degradation of tnfa or cd38 mRNA via TTP activation, we assessed the mRNA levels of TNF-a and CD38 in BMDM after LPS treatment in the presence or absence of PP2A inhibitor okadaic acid (OA) or calcineurin inhibitors (FK506 or CsA). When treated with OA, FK506, or CsA, the degradation of tnfa or cd38 mRNA was impaired at late times

Figure 2. TTP Reduces CD38 Expression in the Resolution Phase of Inflammation (A) Cd38 expression in Ttp+/+ and Ttp/ BMDMs treated with LPS for the indicated time (n = 4). (B and C) Expression of Cd38 and Ttp in RAW 264.7 cells transfected with pcDNA6 and TTP-V5 stimulated with LPS (100 ng/mL) for 24 h, RT-PCR (upper panel), western blot analysis (lower panel) (B), and qRT-PCR (C) (n = 3). (D) Stability of Cd38 expression at indicated time after actinomycin D (5 mg/mL) in RAW 264.7 cells transfected with pcDNA6 and TTP-V5 plasmids and then treated with LPS (100 ng/mL) for 24 h (n = 3). (E) Luciferase activity in RAW 264.7 cells co-transfected with psiCHECK2-cd38 30 -UTR construct and pcDNA6/V5-TTP (0.1 mg or 0.5 mg) for 24 h incubation (n = 4). (F–H) Expression of Ttp and Cd38 in RAW 264.7 cells transfected with scramble RNA (scRNA) and siRNA against Ttp (siTTP) for 36 h, and then treated with LPS (100 ng/mL) for 24 h, RT-PCR (upper panel), western blot analysis (lower panel) (F), and qRT-PCR (G and H) (n = 3). (I) Expression of CD38 bound with TTP protein by RNA immunoprecipitation (RIP) in RAW 264.7 cells transfected with pcDNA6 and TTP-V5 plasmids for 36 h and then treated with LPS (100 ng/mL) for 24 h (RT-PCR, upper in left panel; qRT-PCR, right in left panel) (n = 3). IB analysis of product from immunoprecipitation (IP) with anti-TTP antibody (middle) and IB analysis of cell lysates and supernatant (lower panel). Data are represented as mean ± SD, *p < 0.05; **p < 0.01; ***p < 0.001. See also Figure S1.

after LPS challenge (Figures S2J–S2L). These results suggest that PP2A and calcineurin are involved in TTP activation. However, the regulation of TTP activity by phosphorylation and dephosphorylation remains incompletely understood. The activation of p38 MAPK by LPS treatment showed two peaks of phosphorylation: one at early time points (5–15 min) and one at

late time points (9–12 h) (Figure S2H). Both p38 MAPK activation and TTP phosphorylation were detected at late times after LPS treatment (Figure S2M). However, despite these observations, the degradation of tnfa or cd38 mRNA, which bear the ARE binding site, was still evident at late time points. These results are in contrast to previous findings suggesting that p38

Cell Reports 30, 1063–1076, January 28, 2020 1067

MAPK-dependent phosphorylation is sufficient to downregulate TTP activity (Mahtani et al., 2001). These results suggest that there may exist additional systems required for TTP regulation in response to LPS, in addition to phosphorylation and dephosphorylation (see schema in Figure S2N). Destabilization of CD38 by TTP Drives the Increase of NAD+ Levels and Sirt1 Activation Among the multiple enzymatic activities of CD38 (Kim, 2014), NADase activity is particularly high (Zocchi et al., 1993). Therefore, significantly high NAD+ levels have been observed in tissues from CD38 knockout mice (Young et al., 2006). Based on these reports, we hypothesized that the degradation of Cd38 as a target transcript of TTP may lead to an increase of NAD+ levels during the innate immune response. NAD+ levels peaked at 12 h after LPS treatment (Figure 3A), consistent with a previous report (Liu et al., 2011). To evaluate whether LPS-induced NAD+ is dependent on TTP expression, cells transfected with TTP-targeting siRNA were challenged with LPS for 12 h. As expected, LPS increased NAD+ levels and NAD+/NADH ratio, whereas in TTP knockdown cells, NAD+ levels were not enhanced by LPS challenge (Figure 3B). As the increase of NAD+/NADH ratio drives Sirt1 activation, we investigated the role of Sirt1 and TTP in the late phase of innate immunity (see schema in Figure 3C). According to a web server for KAT-specific acetylation site prediction, we found several lysine sites in the amino acid sequence of TTP, which can be acetylated by CREB binding protein (CBP)/p300 acetyltransferase. The expression of acetylated TTP increased by CBP was remarkably decreased by overexpression of Sirt1, whereas in cells transfected with the mutant inactive form of Sirt1, the acetylation of TTP was not suppressed (Figure 3D). By using co-immunoprecipitation, the interaction of TTP and Sirt1 was confirmed (Figure S2A). The activity of Sirt1 was verified by detecting the level of acetyl-p53 as another target of Sirt1 (Figures S2B and S2C). These results indicate that TTP can be acetylated, and in turn deacetylated by Sirt1. To evaluate the role of Sirt1 activity in TTP regulation, we pretreated cells with EX527, a potent and selective inhibitor of Sirt1, followed by LPS stimulation. We confirmed that LPS induced Tnfa mRNA and TNF-a protein at 3 h, which was subsequently decreased at 12 h or 24 h in the late phase of inflammation (Figures 3E, 3F, and S2D). However, EX527 pretreatment attenuated the decrease of Tnfa mRNA and TNF-a protein in the late phase of LPS treatment compared to that observed in the absence of EX527 (Figures 3E, 3F, and S2D). Under these conditions, acetyl-TTP was detected at 4 h after LPS treatment but not at 24 h. In contrast, the inhibition of Sirt1 by EX527 resulted in increased acetyl-TTP at 24 h (Figure 3G). Using a Tnfa mRNA stability assay, we found that the half-life of Tnfa mRNA in EX527 pretreated Ttp+/+ BMDM was 62 min, in comparison to the half-life observed in the absence of EX527 pretreatment (t1/2 = 29 min). Additionally, in Ttp/ BMDM, the half-life of Tnfa mRNA exceeded 120 min in both the presence and absence of EX527 (Figure S2E). Taken together, our data suggest that CD38 expression was increased by LPS treatment at early time points; whereas was reduced at a time point coincident with TTP activation after LPS treatment. CD38 reduction results in increased NAD+ avail-

1068 Cell Reports 30, 1063–1076, January 28, 2020

ability and activation of Sirt1. Active Sirt1 induces TTP activation for inflammation resolution, by deacetylating TTP, resulting in the degradation of pro-inflammatory mRNA transcripts, including Tnfa. TTP Is Required for Protection in CLP Our data suggest that NAD+-induced Sirt1 activation plays a critical role in the resolution of inflammation. To overcome inflammation, we hypothesized that NAD+ inducers increase Sirt1 activation, and subsequently, that Sirt1-dependent TTP deacetylation resolves the inflammation via degradation of pro-inflammatory cytokine mRNAs bearing an ARE region in the 30 -UTR. Supporting our hypothesis, the increase of NAD+ levels is required to resolve inflammation (Vachharajani et al., 2014). Most cAMP inducers increase NAD+ levels (Park et al., 2012). We previously demonstrated that exogenous carbon monoxide (CO) enhanced the decay of mRNAs encoding pro-inflammatory cytokines via TTP (Joe et al., 2014, 2015). Based on these observations, we evaluated whether carbon monoxide releasing molecule-2 (CORM2) activates TTP through increasing plasma cAMP and NAD+ levels. Stimulation with CORM2 in RAW 264.7 cells resulted in an increase of plasma cAMP and NAD+ levels as well as TTP mRNA expression (Figures 4A–4C). In addition, inhibitors of cAMP-degrading phosphodiesterase such as cilostazol (a selective inhibitor of phosphodiesterase type-3), rolipram (a selective inhibitor of phosphodiesterase type-4), and resveratrol (a competitive inhibitor of cAMP-specific phosphodiesterases, an activator of Sirt1) (Hubbard et al., 2013) increased the levels of cAMP, NAD+, and TTP (Figures S3A–S3C). CORM2 or forskolin (an adenylate cyclase activator), increased CREB phosphorylation via PKA activation (Figure S3D). For that reason, we used CO to examine the protective effect of TTP on severe inflammation; we used cecal ligation and puncture (CLP), an animal model of polymicrobial sepsis. CO increased the survival rate of wild-type mice after CLP surgery (Figure 4D). Mice genetically deficient in TTP (Ttp/) were susceptible to the lethal effects of CLP; and CO inhalation failed to rescue these mice (Figure 4D). CO decreased the levels of pro-inflammatory cytokines TNF-a (Figure 4E), IL-6, and IL-1b (Figures S3E and S3F) induced by CLP in peritoneal fluid. We also measured the serum pro-inflammatory cytokines, TNF-a (Figure 4F) and IL-1b (Figure S3G) and the levels of TNF-a, IL-6, and IL-1b in lung tissue (Figures S3H–S3J). In Ttp+/+ mice, CLP induced pro-inflammatory cytokines, which in turn were significantly decreased by CO treatment. The anti-inflammatory effects of inhaled CO were abolished in Ttp/ mice. Consistent with previous findings (Joe et al., 2015), lung histology as determined by H&E staining yielded similar results (Figure S3K). The administration of CO significantly reduced CLP-induced lung injury in Ttp+/+ mice, whereas CO failed to protect against CLP-induced lung injury in Ttp/ mice (Figure S3K). Furthermore, CLP-induced monocyte chemoattractant protein (MCP)-1 and myeloperoxidase (MPO) levels in lung tissues were decreased by CO inhalation in Ttp+/+ mice but not in Ttp/ mice (Figures 4G and 4H). As expected, in Ttp+/+ mice subjected to CLP, CO pretreatment significantly enhanced TTP expression, whereas in Ttp/ mice, no significant changes were observed in TTP expression in the absence or presence of CO (Figure S3L).

Figure 3. Destabilization of CD38 by TTP Drives the Increase of NAD+ Levels and Sirt1 Activation (A) NAD+/NADH ratio measured in RAW 264.7 cells with LPS (100 ng/mL) at the indicated times (n = 3). (B) NAD+, NADH, and NAD+/NADH ratio measured in scRNA and siTTP transfected RAW 264.7 cells with LPS (100 ng/mL) for 12 h (n = 4). (C) Hypothetical model for the mechanism for TTP activation by NAD-induced Sirt1 in the late phase of LPS treatment. (D) IP with anti-V5-tag magnetic beads and then IB analysis with anti-acetylated lysine using co-transfected HEK293 cells with vectors harboring pcDNA6, pECE, V5-TTP, HA-CBP, Flag-SIRT1, and Mut-Flag-SIRT1 for 36 h (n = 4). (E) The effect of the Sirt1 inhibitor, EX527 (20 mg/mL, 1 h) on TNF a mRNA levels in RAW 264.7 cells (upper panel). Quantification of TNF-a/GAPDH is shown in the lower panel (n = 4). (F) TNF-a levels by ELISA in RAW 264.7 cells after treatment with LPS (100 ng/mL) in the presence of the EX527 (20 mg/mL, 1 h). (G) Deacetylation of TTP in RAW 264.7 cells after treatment with LPS (100 ng/mL) in the presence of either vehicle or the EX527 (20 mg/mL, 1 h) (upper panel). Quantification of TTP acetylation/total TTP is shown in the lower panel (n = 3). Data were expressed as mean ± SD, *p < 0.05 **p < 0.01; ***p < 0.001; ND, notdetectable; NS, not significant. See also Figure S2.

To confirm the effects of CO on sepsis using alternate models, we used the LPS-induced sepsis model in mice. As shown Figure 4I, CO increased the survival rate in LPS-challenged Ttp+/+ mice. The Ttp/ mice were more susceptible to the lethal effects of LPS, and CO inhalation failed to rescue these mice (Fig-

ure 4I). In vitro, CORM2 synergistically increased TTP expression in BMDM challenged with LPS (Figure 4J), while LPS-induced CD38 levels were decreased by CORM2 (Figure 4K). In contrast, CORM2 did not modulate the levels of TTP and CD38 in Ttp/ BMDM subjected to LPS challenge (Figure 4J and 4K).

Cell Reports 30, 1063–1076, January 28, 2020 1069

Figure 4. TTP Is Required for Protection in CLP (A) Cyclic AMP levels in RAW 264.7 cells after treatment with CORM2 (20 mM) for 10 min (n = 3). (B) NAD+/NADH ratio measured in RAW 264.7 cells treated with CORM2 (20 mM) for 6 h (n = 3). (C) TTP mRNA levels in RAW 264.7 cells treated with CORM2 (20 mM) for 6 h (n = 4). (D) Survival rate of 8-week-old Ttp+/+ (n = 4 or 5) and Ttp/ male mice (n = 4 or 5) with inhalation of 250 ppm CO gas (2 h/day) for 5 days and then subjected to cecal ligation puncture (CLP). p = 0.02; CLP versus CLP+CO in Ttp+/+, p = 0.001; CLP+CO in Ttp+/+ versus CLP+CO in Ttp/. (E and F) TNF-a levels in peritoneal fluid (E) and serum (F) from Ttp+/+ and Ttp/ male mice (n = 6 per group), 5 h after CLP surgery in the presence of CO inhalation (250 ppm/2 h/day) for 5 days (n = 3). (G and H) MCP-1 mRNA levels (G) and MPO protein levels (H) in lung tissues were detected by qRT-PCR and ELISA, respectively. (I) Survival rate of Ttp+/+ (n = 8) and Ttp/ mice (n = 4 or 5) with inhalation of 250 ppm CO gas (2 h/day) for 5 days followed by injection of LPS (25 mg/kg, intraperitoneal [i.p.]) p = 0.02; LPS versus LPS+CO in Ttp+/+, p = 0.0002; LPS+CO in Ttp+/+ versus LPS+CO in Ttp/. (J–L) mRNA (upper panel) and protein (lower panel) levels of TTP (J), CD38 (K), and TNF-a in Ttp+/+ and Ttp/ BMDMs pretreated with CORM2 (20 mM) for 9 h, followed by stimulation with LPS (100 ng/mL) for another 9 h (n = 3). Log-rank test was used for survival rate. Data were expressed as mean ± SD,*p < 0.05; **p < 0.01; ***p < 0.001; NS, not significant. See also Figure S3.

Furthermore, LPS-induced TNF-a was reduced by CORM2 in Ttp+/+ but not Ttp/ BMDM (Figure 4L). To further investigate the protective roles of TTP in infection using either Gram (+) and Gram () bacteria, mice were infected with Streptococcus pneumonia (S.p) or Pseudomonas aeruginosa (P.a) by intranasal administration. Consistent with the CLP and LPS models, S.p and P.a infection induced TTP and CD38 expression (Figures S3M–S3AF). To investigate a chemical modulator for pre-clinical application, we used resveratrol, a Sirt1 activator, in S.p and P.a infected mice. Resveratrol treatment reduced the pro-inflammatory cytokines induced by S.p and P.a, in a manner dependent on

1070 Cell Reports 30, 1063–1076, January 28, 2020

TTP activation (Figures S3M–S3AF). Taken together, these results indicate that TTP can mediate the anti-inflammatory effects of CO and resveratrol. Moreover, these results suggest that TTP plays an important role in the resolution of inflammation and exerts protective effects in mouse models of CLP, Gram (+) and Gram () bacteria-induced sepsis or LPS-induced lung injury. TTP Plays a Key Role in Bacterial Clearance by Increasing Autophagy in the CLP Model Host resistance to CLP-induced sepsis results from the regulation of the inflammatory response and augmented bacterial

clearance (Bonilla et al., 2013; Yuan et al., 2012). We demonstrated a role for TTP in the regulation of inflammatory cytokines in the CLP model (Figure 4). We, thus, investigated whether TTP modulates cellular processes, such as autophagy or phagocytosis, in the setting of CLP to enhance bacterial clearance. We first demonstrated that CO-induced TTP significantly reduced bacterial burden in peritoneal lavage fluid and extraperitoneal tissues, including the blood, peritoneal fluid, lung, liver, kidney, intestine, and spleen (Figure 5A). After engulfment of a pathogen, phagocytes clear the target by either conventional autophagy or LC3-associated phagocytosis (Sarkar et al., 2017; Yuan et al., 2012). To address the role of TTP in autophagy induction for bacterial clearance, Ttp+/+ and Ttp/ mice were subjected to CLP to induce polymicrobial sepsis, and pretreated with CO to induce TTP levels and activity. As shown in Figure 5B, the levels of LC3B-II in Ttp+/+ mice subjected to CLP were increased compared with the sham-operated Ttp+/+ mice and were further increased by CO inhalation. We also found that p62, an autophagy substrate protein, was decreased in Ttp+/+ mice by the treatment of CLP in combination with CO (Figure 5C). Here, we also demonstrate that the levels LC3B-II and p62 in sham-operated Ttp/ mice were higher at baseline than in sham-operated Ttp+/+ mice and were not further increased by CLP and CO treatment (Figures 5B and 5C). To understand this phenomenon, we investigated whether TTP plays a crucial role in the regulation of autophagic flux. As shown in Figure S4A, we confirmed that CO-induced TTP increased autophagy flux in Ttp+/+ but not Ttp/ BMDM by measuring LC3II and p62 levels. Treatment with the autophagy flux inhibitors chloroquine (CQ) and bafilomycin, further increased apparent LC3B-II levels and p62 levels in Ttp+/+ BMDM but not Ttp/ BMDM. These results suggest that TTP is required for the modulation of autophagic flux by CO (Figure S4B). To clear invading pathogens, an autolysosome is formed by the fusion of autophagosomes with lysosomes (Sarkar et al., 2017; Yuan et al., 2012). First, to determine whether TTP participates in lysosome biogenesis, we measured the mRNA expression of lysosome markers, including LAMP1, cathepsin B (CTSB), tripeptidyl peptidase (TPP), and mucolipin-1 (MCOLN1), in lung tissues from Ttp+/+ and Ttp/ mice. As expected, compared with the mice from CLP group, administration of CO in CLP-challenged wild-type mice significantly increased Lamp1 and Ctsb mRNA, whereas Tpp and Mcoln1 were not regulated by CO. Interestingly, we also observed that genetic deletion of TTP abrogated the beneficial effects of CO on lysosomal biogenesis (Figure 5D). To examine the role of COinduced TTP in the induction of the phagolysosome, E. coli bioparticles and lysotracker were internalized in RAW 264.7 cells transfected with either scramble RNA (scRNA) or siRNA against TTP (siTTP). Compared with the treatment of E. coli alone, the administration of CORM2 significantly increased the formation of the lysosome, and the colocalization of the lysosome with E. coli bioparticles, in control RAW 264.7 cells, but not in RAW 264.7 cells transfected with siTTP (Figures 5E and S4C). According to these results, we suggest that TTP plays an important role in autophagic flux and is required for autophagolysome formation to clear pathogens.

TTP Activation Increases Autophagy via Posttranscriptional Regulation of Rheb We investigated the underlying regulatory mechanism of TTPinduced autophagy. The activity of mTOR is inhibited under nutrient starvation, which represents a crucial step for autophagy induction in eukaryotes (Babcock and Quilliam, 2011; Ma et al., 2010). Active AMPK leads to phosphorylation and activation of the TSC1/2 (tuberous sclerosis complex), which inhibits mTOR activity through inhibition of Rheb (Inoki et al., 2003). Moreover, we found a potential AU-rich element (ARE) binding site for TTP in the 30 -UTR of Rheb (Figure 6A). We speculated that TTP may destabilize the mRNA expression of Rheb, leading to suppression of the activity of mTOR to induce the autophagy and phagocytosis processes (Figure 6B). To confirm this hypothesis, we first measured the activity of the Rheb 30 -UTR in TTPoverexpressing HEK293 cells using a luciferase assay. As expected, TTP overexpression significantly decreased the activity of the Rheb 30 -UTR (Figure 6C), while a Rheb 30 -UTR bearing a mutant ARE region displayed no significant changes in luciferase activity (Figure 6D). Overexpression of TTP decreased the levels of Rheb mRNA and protein (Figures 6E and 6F). Moreover, we assessed the mRNA stability of Rheb after stimulation of LPS. BMDM (Ttp+/+ or Ttp/) treated with LPS for 4 h showed no significant changes in Rheb mRNA stability. However, in BMDM treated with LPS for 24 h, the Rheb mRNA stability in Ttp+/+ BMDM was remarkably decreased compared to Ttp/ BMDM (Figure 6G). To confirm that TTP binds to the Rheb 30 -UTR region to destabilize Rheb, we performed an RNA-immunoprecipitation analysis. As shown in Figures 6H and 6I, we found that active TTP bound to Rheb mRNA, by measuring Rheb mRNA via RTPCR or qRT-PCR after immunoprecipitation with TTP antibody. The regulation of Rheb by TTP is summarized in Figure 6J. TTP activation in the late phase of inflammation was caused by Sirt1 activation. The active TTP degraded Rheb mRNA. We confirmed that the degradation of Rheb was dependent on Sirt1-dependent TTP activation using EX527. LPS-induced Rheb was reduced in the late phase of inflammation, at 12 h or 24 h after LPS treatment. However, EX527 treatment attenuated the reduction of Rheb at 12 h or 24 h (Figures 6K and 6L). Thus, we suggest that Rheb degradation by active TTP leads to mTOR inactivation as a regulatory mechanism by which TTP promotes autophagy. To validate this mechanism in vivo, Ttp+/+ and Ttp/ mice were subjected to the CLP model in the absence or presence of CO inhalation. In association with the TTP increase, CO decreased Rheb or p-S6 levels in Ttp+/+ mice but not Ttp/ mice (Figure S5A). In the case of p-4EBP, due to lack of stimulation, we did not detect any difference between the inhaled CO group and the control group (Figure S5A). Various stimuli such as virus, bacteria, and hyperoxia suppress autophagy by activating mTOR (Desai et al., 2015; Maiese, 2016). CLP increased the levels of p-S6 and p-4EBP1, which signifies mTOR activation by CLP. CO inhalation during CLP decreased mTOR activation by reducing Rheb (Figure 6M). Taken together, these data suggest that TTP induces autophagy and phagocytosis processes through inhibiting the activity of mTOR via destabilizing Rheb mRNA expression. Finally, we conclude that TTP controls the entire process from onset of inflammation to resolution of inflammation phase (as shown in Figure S5B).

Cell Reports 30, 1063–1076, January 28, 2020 1071

Figure 5. TTP Plays a Key Role in Bacterial Clearance by Increasing Autophagy in the CLP Model (A–D) 8-week-old Ttp+/+ and Ttp/ male mice (n = 6 per group) were subjected to inhalation of 250 ppm CO gas (2 h/day) for 5 days and then CLP or control surgery. (A) The number of bacterial colony-forming units (CFUs) from the blood, peritoneal fluid as well as homogenization of lung, liver, kidney, small intestine, and spleen (n = 3). (B and C) The protein levels of LC3 (B) and p62 (C) in lung tissues (left). Quantification of LC3 and p62 is shown in the right panel (n = 3). (D) Levels of LAMP1, CTSB, TPP, and MCOLN1 in lung tissues (n = 3). (E) Alexa Fluor 488-labeled E. coli (green), lysosomal compartment (red), and DAPI stained nucleus (blue) RAW 264.7 cells treated with CORM2 (20 mM) for 6 h, after transfection with scramble RNA (scRNA) or siRNA against TTP (siTTP) (n = 3). Scale bar, 5 mm. Data were expressed as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001; NS, not significant. See also Figure S4.

1072 Cell Reports 30, 1063–1076, January 28, 2020

Figure 6. TTP Activation Increases Autophagy via Post-transcriptional Regulation of Rheb (A) Schematic structure of ARE in human and mouse Rheb mRNA 30 UTR and its nucleotide positions. (B) Scheme illustrates the hypothesis that TTP activity regulated by Sirt1 may be associated with the destabilization of Rheb mRNA. (C and D) Luciferase activity in RAW 264.7 cells co-transfected with psiCHECK2-Rheb 30 UTR construct, or psiCHECK2-Rheb mutant 30 UTR construct and pcDNA6/V5-TTP (0.1 mg or 0.5 mg) (n = 3). (E and F) TTP and Rheb mRNA (E) and protein levels of TTP and Rheb (F) in HEK293 cells transfected with pcDNA6 or TTP-V5 (n = 3). (G) Rheb mRNA in Ttp+/+ and Ttp/ BMDMs treated with LPS (100 ng/mL for 4 h or 24 h) in the presence of 5 mg/mL actinomycin D for the indicated times (n = 3). (H and I) Rheb mRNA levels determined by RT-PCR (H) and qRT-PCR (I) after IP with anti-TTP antibody (n = 3). (J) Scheme depicts the activation of TTP regulated by Sirt1 mediates the degradation of Rheb mRNA.

(legend continued on next page)

Cell Reports 30, 1063–1076, January 28, 2020 1073

DISCUSSION In contrast to previous studies on the resolution of inflammation (Robb et al., 2016; Serhan et al., 2007), which identify phase-specific mediators, we demonstrate here that TTP regulates the entire inflammatory process, from onset to resolution of inflammation. TTP dampens the expression of inflammatory cytokines by binding to the ARE in the 30 -UTR of their corresponding mRNAs and promotes the resolution of inflammation (Ebner et al., 2017). Although the activation of TTP is regulated by p38 MAPK (Mahtani et al., 2001) or PP2A (Ross et al., 2017) in the early phase of inflammation, the regulation and function of TTP in the late stages of inflammation remain incompletely understood. Our studies show that activation of TTP in the late phase of inflammation by Sirt1-dependent deacetylation promotes bacterial clearance via enhancing autophagolysosome formation. Our key findings on the mechanisms of TTP action throughout the process of inflammation have several critical points: (1) the upregulation of TTP expression is dependent on CD38; (2) CD38, as a target of TTP, causes Sirt1 activation by increasing NAD+ levels; (3) Sirt1-dependent deacetylation of TTP leads to degradation of Rheb. CD38 produces Ca2+ signaling messengers, NAD(P) metabolites, which play an important role for inflammatory processes of immune cells (Malavasi et al., 2008). The present data showed that CD38-mediated Ca2+ signaling also plays an essential role for self-degradation via TTP expression, which ultimately results in resolution of inflammation. Therefore, regulation of on-time CD38 expression/activity is crucial for proper initiation of inflammation as well as for resolution of inflammation to prevent sepsis. Anti-inflammatory and pro-resolving actions of TTP were evaluated in the CLP model, an established murine model of polymicrobial sepsis that closely resembles human pathology (Spite et al., 2009). The increase of TTP activation may have therapeutic effects in the resolution of acute inflammation. TTP inducers such as CO, cilostazol, rolipram, and resveratrol led to the increase of cAMP and NAD+ levels. As a consequence, TTP expression was induced by the cAMP-PKA-CREB pathway. By demonstrating that CO-induced TTP expression increased survival rate and alleviated the inflammatory response in the CLP model, this study, in conjunction with previous studies (Joe et al., 2015), provides an explanation for how TTP upregulation resolves sepsis. The decrease of pro-inflammatory cytokines and CD38 as well as the increase of resolution of infection and organ protection in the CLP model is regulated by TTP induction and activation. To improve the resolution of inflammation in sepsis, resolvin D2 decreases both local and systemic bacterial burden (Chiang et al., 2015), while NLRP3 increases pathogen clearance by increasing phagocytosis and autophagy (Bonilla et al., 2013; Jin et al., 2017). In this study, we demonstrated

that CO-induced TTP expression increases bacterial clearance and autophagy in the CLP model. Moreover, we suggest that TTP contributes to the formation of the autophagolysosome and increases the expression of lysosomal genes (Figures 5D and 5E). Thus, autophagy increased by TTP promotes bacterial clearance. Here, we suggest a mechanism for autophagolysosome regulation by which Rheb destabilization by TTP inhibits the mTOR signaling pathway (Figure 6B). Finally, the inhibition of mTOR by TTP-regulated Rheb expression enhances autophagy and lysosomal biogenesis, which may contribute to the resolution of inflammation. A limitation of the current study is that some chemical inhibitors were used at single concentrations derived from published studies, and a comprehensive dose-response analysis of all chemical inhibitors was beyond the scope of the study. Taken together, these data have introduced a player in the arena of cellular homeostasis under acute inflammation. Upon initiating the resolution of inflammation, TTP expression is upregulated by the NAADP/cADPR-cAMP-PKA pathway. Subsequently, dephosphorylation and deacetylation of TTP leads to TTP activation, which reduces pro-inflammatory cytokines expression and induces autophagolysome formation to resolve the inflammation. Finally, TTP plays a crucial role in the resolution of inflammation, in which TTP expression is regulated by CD38, while TTP activity is regulated by Sirt1 (see schema in Figure S5B). Our studies therefore identify the targets for therapies aimed at modulating inflammation and its resolution. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS B Animals B Cell Lines METHOD DETAILS B Lung Histology B Transfection B RT-PCR and qRT-PCR B Western Blot Assays B Immunoprecipitation B RNA immunoprecipitation B Luciferase Assay B Enzyme-Linked Immunosorbent Assays (ELISA) B cAMP assay + B NAD and NADH measurements B CFU determination B Phagocytosis assay

(K and L) Rheb mRNA levels measured by qRT-PCR (K) and RT-PCR (L, upper) in RAW 264.7 cells treated with LPS (100 ng/mL) at the indicated times in the presence of the Sirt1 inhibitor, EX527 (20 mg/mL), for 1 h. Quantification of Rheb/GAPDH is shown in the lower panel of (L) (n = 3). (M) The protein levels of Rheb, p-S6, and p-4EBP1 in lung tissues from Ttp+/+ and Ttp/ male mice (n = 6 per group) in the presence of CO inhalation (250 ppm/2 h/day for 5 days) (left). Quantification of Rheb, p-S6, and p-4EBP-1 is shown in the right three panels (n = 3). Data were expressed as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001; NS, not significant. See also Figure S5.

1074 Cell Reports 30, 1063–1076, January 28, 2020

d d

QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. celrep.2019.12.090. ACKNOWLEDGMENTS This work was supported by the Priority Research Centers Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2014R1A6A1030318 to H.T.C., NRF-2012R1A3A2026453 to U.-H.K, and NRF-2017R1A6A3A11031089 to Y.J.). AUTHOR CONTRIBUTIONS

sion, stability, and binding to adenine/uridine-rich element. Mol. Cell. Biol. 26, 2399–2407. Hubbard, B.P., Gomes, A.P., Dai, H., Li, J., Case, A.W., Considine, T., Riera, T.V., Lee, J.E., E, S.Y., Lamming, D.W., et al. (2013). Evidence for a common mechanism of SIRT1 regulation by allosteric activators. Science 339, 1216– 1219. Inoki, K., Li, Y., Xu, T., and Guan, K.L. (2003). Rheb GTPase is a direct target of TSC2 GAP activity and regulates mTOR signaling. Genes Dev. 17, 1829–1834. Jalonen, U., Leppa¨nen, T., Kankaanranta, H., and Moilanen, E. (2007). Salbutamol increases tristetraprolin expression in macrophages. Life Sci. 81, 1651– 1658. Jin, L., Batra, S., and Jeyaseelan, S. (2017). Deletion of Nlrp3 Augments Survival during Polymicrobial Sepsis by Decreasing Autophagy and Enhancing Phagocytosis. J. Immunol. 198, 1253–1262. Joe, Y., Uddin, M.J., Zheng, M., Kim, H.J., Chen, Y., Yoon, N.A., Cho, G.J., Park, J.W., and Chung, H.T. (2014). Tristetraprolin mediates anti-inflammatory effect of carbon monoxide against DSS-induced colitis. PLoS ONE 9, e88776.

H.T.C., U.-H.K., and Y.J. designed the experiments. Y.J. and Y.C. have performed most of the experiments with help from J.P., H.J.K., S.-Y.R., J.R., G.J.C., H.-S.C., and J.W.P. Data were analyzed by H.T.C., U.-H.K., Y.J., Y.C., H.-S.C., S.W.R., and J.W.P. The manuscript was written by H.T.C., U.-H.K., Y.J., Y.C., and S.W.R.

Joe, Y., Kim, S.K., Chen, Y., Yang, J.W., Lee, J.H., Cho, G.J., Park, J.W., and Chung, H.T. (2015). Tristetraprolin mediates anti-inflammatory effects of carbon monoxide on lipopolysaccharide-induced acute lung injury. Am. J. Pathol. 185, 2867–2874.

DECLARATION OF INTERESTS

Kafasla, P., Skliris, A., and Kontoyiannis, D.L. (2014). Post-transcriptional coordination of immunological responses by RNA-binding proteins. Nat. Immunol. 15, 492–502.

The authors declare no competing interests. Received: May 22, 2019 Revised: October 12, 2019 Accepted: December 24, 2019 Published: January 28, 2020 REFERENCES Babcock, J.T., and Quilliam, L.A. (2011). Rheb/mTOR activation and regulation in cancer: novel treatment strategies beyond rapamycin. Curr. Drug Targets 12, 1223–1231. Bonilla, D.L., Bhattacharya, A., Sha, Y., Xu, Y., Xiang, Q., Kan, A., Jagannath, C., Komatsu, M., and Eissa, N.T. (2013). Autophagy regulates phagocytosis by modulating the expression of scavenger receptors. Immunity 39, 537–547. Brook, M., Tchen, C.R., Santalucia, T., McIlrath, J., Arthur, J.S., Saklatvala, J., and Clark, A.R. (2006). Posttranslational regulation of tristetraprolin subcellular localization and protein stability by p38 mitogen-activated protein kinase and extracellular signal-regulated kinase pathways. Mol. Cell. Biol. 26, 2408–2418. Brouard, S., Otterbein, L.E., Anrather, J., Tobiasch, E., Bach, F.H., Choi, A.M., and Soares, M.P. (2000). Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis. J. Exp. Med. 192, 1015–1026.

Kang, J., Park, K.H., Kim, J.J., Jo, E.K., Han, M.K., and Kim, U.H. (2012). The role of CD38 in Fcg receptor (FcgR)-mediated phagocytosis in murine macrophages. J. Biol. Chem. 287, 14502–14514. Kim, U.H. (2014). Multiple Enzymatic Activities of CD38 for Ca2+ Signaling Messengers. Messenger 3, 6–14. Kotas, M.E., and Medzhitov, R. (2015). Homeostasis, inflammation, and disease susceptibility. Cell 160, 816–827. Kratochvill, F., Machacek, C., Vogl, C., Ebner, F., Sedlyarov, V., Gruber, A.R., €licke, T., et al. (2011). TrisHartweger, H., Vielnascher, R., Karaghiosoff, M., Ru tetraprolin-driven regulatory circuit controls quality and timing of mRNA decay in inflammation. Mol. Syst. Biol. 7, 560. Lee, H.C. (2011). Cyclic ADP-ribose and NAADP: fraternal twin messengers for calcium signaling. Sci. China Life Sci. 54, 699–711. Lee, S.J., Ryter, S.W., Xu, J.F., Nakahira, K., Kim, H.P., Choi, A.M., and Kim, Y.S. (2011). Carbon monoxide activates autophagy via mitochondrial reactive oxygen species formation. Am. J. Respir. Cell Mol. Biol. 45, 867–873. Lee, C.U., Song, E.K., Yoo, C.H., Kwak, Y.K., and Han, M.K. (2012). Lipopolysaccharide induces CD38 expression and solubilization in J774 macrophage cells. Mol. Cells 34, 573–576. Li, L.C., and Dahiya, R. (2002). MethPrimer: designing primers for methylation PCRs. Bioinformatics 18, 1427–1431.

Chiang, N., Dalli, J., Colas, R.A., and Serhan, C.N. (2015). Identification of resolvin D2 receptor mediating resolution of infections and organ protection. J. Exp. Med. 212, 1203–1217.

Lischke, T., Heesch, K., Schumacher, V., Schneider, M., Haag, F., Koch-Nolte, €cker, H.W. (2013). CD38 controls the innate immune response F., and Mittru against Listeria monocytogenes. Infect. Immun. 81, 4091–4099.

Desai, M., Fang, R., and Sun, J. (2015). The role of autophagy in microbial infection and immunity. ImmunoTargets Ther. 4, 13–26.

Liu, T.F., Yoza, B.K., El Gazzar, M., Vachharajani, V.T., and McCall, C.E. (2011). NAD+-dependent SIRT1 deacetylase participates in epigenetic reprogramming during endotoxin tolerance. J. Biol. Chem. 286, 9856–9864.

Durante, W., Johnson, F.K., and Johnson, R.A. (2006). Role of carbon monoxide in cardiovascular function. J. Cell. Mol. Med. 10, 672–686. Ebner, F., Sedlyarov, V., Tasciyan, S., Ivin, M., Kratochvill, F., Gratz, N., Kenner, L., Villunger, A., Sixt, M., and Kovarik, P. (2017). The RNA-binding protein tristetraprolin schedules apoptosis of pathogen-engaged neutrophils during bacterial infection. J. Clin. Invest. 127, 2051–2065. Halls, M.L., and Cooper, D.M. (2011). Regulation by Ca2+-signaling pathways of adenylyl cyclases. Cold Spring Harb. Perspect. Biol. 3, a004143. Hitti, E., Iakovleva, T., Brook, M., Deppenmeier, S., Gruber, A.D., Radzioch, D., Clark, A.R., Blackshear, P.J., Kotlyarov, A., and Gaestel, M. (2006). Mitogenactivated protein kinase-activated protein kinase 2 regulates tumor necrosis factor mRNA stability and translation mainly by altering tristetraprolin expres-

Ma, D., Bai, X., Zou, H., Lai, Y., and Jiang, Y. (2010). Rheb GTPase controls apoptosis by regulating interaction of FKBP38 with Bcl-2 and Bcl-XL. J. Biol. Chem. 285, 8621–8627. Mahtani, K.R., Brook, M., Dean, J.L., Sully, G., Saklatvala, J., and Clark, A.R. (2001). Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha mRNA stability. Mol. Cell. Biol. 21, 6461–6469. Maiese, K. (2016). Targeting molecules to medicine with mTOR, autophagy and neurodegenerative disorders. Br. J. Clin. Pharmacol. 82, 1245–1266. Malavasi, F., Deaglio, S., Funaro, A., Ferrero, E., Horenstein, A.L., Ortolan, E., Vaisitti, T., and Aydin, S. (2008). Evolution and function of the ADP ribosyl

Cell Reports 30, 1063–1076, January 28, 2020 1075

cyclase/CD38 gene family in physiology and pathology. Physiol. Rev. 88, 841–886. Marchese, F.P., Aubareda, A., Tudor, C., Saklatvala, J., Clark, A.R., and Dean, J.L. (2010). MAPKAP kinase 2 blocks tristetraprolin-directed mRNA decay by inhibiting CAF1 deadenylase recruitment. J. Biol. Chem. 285, 27590–27600. Morita, T., Mitsialis, S.A., Koike, H., Liu, Y., and Kourembanas, S. (1997). Carbon monoxide controls the proliferation of hypoxic vascular smooth muscle cells. J. Biol. Chem. 272, 32804–32809. Newson, J., Stables, M., Karra, E., Arce-Vargas, F., Quezada, S., Motwani, M., Mack, M., Yona, S., Audzevich, T., and Gilroy, D.W. (2014). Resolution of acute inflammation bridges the gap between innate and adaptive immunity. Blood 124, 1748–1764. Otterbein, L.E., Bach, F.H., Alam, J., Soares, M., Tao Lu, H., Wysk, M., Davis, R.J., Flavell, R.A., and Choi, A.M. (2000). Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nat. Med. 6, 422–428. Park, S.J., Ahmad, F., Philp, A., Baar, K., Williams, T., Luo, H., Ke, H., Rehmann, H., Taussig, R., Brown, A.L., et al. (2012). Resveratrol ameliorates aging-related metabolic phenotypes by inhibiting cAMP phosphodiesterases. Cell 148, 421–433. Partida-Sa´nchez, S., Cockayne, D.A., Monard, S., Jacobson, E.L., Oppenheimer, N., Garvy, B., Kusser, K., Goodrich, S., Howard, M., Harmsen, A., et al. (2001). Cyclic ADP-ribose production by CD38 regulates intracellular calcium release, extracellular calcium influx and chemotaxis in neutrophils and is required for bacterial clearance in vivo. Nat. Med. 7, 1209–1216. Peng, Q.Y., Ai, M.L., Zhang, L.N., Zou, Y., Ma, X.H., and Ai, Y.H. (2016). Blocking NAD(+)/CD38/cADPR/Ca(2+) pathway in sepsis prevents organ damage. J. Surg. Res. 201, 480–489. Rah, S.Y., Park, K.H., Han, M.K., Im, M.J., and Kim, U.H. (2005). Activation of CD38 by interleukin-8 signaling regulates intracellular Ca2+ level and motility of lymphokine-activated killer cells. J. Biol. Chem. 280, 2888–2895. Rah, S.Y., Mushtaq, M., Nam, T.S., Kim, S.H., and Kim, U.H. (2010). Generation of cyclic ADP-ribose and nicotinic acid adenine dinucleotide phosphate by CD38 for Ca2+ signaling in interleukin-8-treated lymphokine-activated killer cells. J. Biol. Chem. 285, 21877–21887. Rah, S.Y., and Kim, U.H. (2012). Critical Role of CD38 for Generation of Ca2+ SignalingMessengers in Angiotensin II-Stimulated Kupffer Cells. Messenger 1, 77–85. Rauber, S., Luber, M., Weber, S., Maul, L., Soare, A., Wohlfahrt, T., Lin, N.Y., Dietel, K., Bozec, A., Herrmann, M., et al. (2017). Resolution of inflammation by interleukin-9-producing type 2 innate lymphoid cells. Nat. Med. 23, 938–944. Robb, C.T., Regan, K.H., Dorward, D.A., and Rossi, A.G. (2016). Key mechanisms governing resolution of lung inflammation. Semin. Immunopathol. 38, 425–448. Ross, E.A., Naylor, A.J., O’Neil, J.D., Crowley, T., Ridley, M.L., Crowe, J., Smallie, T., Tang, T.J., Turner, J.D., Norling, L.V., et al. (2017). Treatment of inflammatory arthritis via targeting of tristetraprolin, a master regulator of pro-inflammatory gene expression. Ann. Rheum. Dis. 76, 612–619. Ryter, S.W., and Choi, A.M. (2013). Carbon monoxide: present and future indications for a medical gas. Korean J. Intern. Med. (Korean. Assoc. Intern. Med.) 28, 123–140. Sarkar, A., Tindle, C., Pranadinata, R.F., Reed, S., Eckmann, L., Stappenbeck, T.S., Ernst, P.B., and Das, S. (2017). ELMO1 Regulates Autophagy Induction and Bacterial Clearance During Enteric Infection. J. Infect. Dis. 216, 1655– 1666.

1076 Cell Reports 30, 1063–1076, January 28, 2020

Schaljo, B., Kratochvill, F., Gratz, N., Sadzak, I., Sauer, I., Hammer, M., Vogl, €ller, M., Blackshear, P.J., et al. (2009). Tristetraprolin is C., Strobl, B., Mu required for full anti-inflammatory response of murine macrophages to IL-10. J. Immunol. 183, 1197–1206. Serhan, C.N., Brain, S.D., Buckley, C.D., Gilroy, D.W., Haslett, C., O’Neill, L.A., Perretti, M., Rossi, A.G., and Wallace, J.L. (2007). Resolution of inflammation: state of the art, definitions and terms. FASEB J. 21, 325–332. Shanley, T.P., Vasi, N., Denenberg, A., and Wong, H.R. (2001). The serine/threonine phosphatase, PP2A: endogenous regulator of inflammatory cell signaling. J. Immunol. 166, 966–972. Song, E.K., Lee, Y.R., Yu, H.N., Kim, U.H., Rah, S.Y., Park, K.H., Shim, I.K., Lee, S.J., Park, Y.M., Chung, W.G., et al. (2008). Extracellular NAD is a regulator for FcgammaR-mediated phagocytosis in murine macrophages. Biochem. Biophys. Res. Commun. 367, 156–161. Spite, M., Norling, L.V., Summers, L., Yang, R., Cooper, D., Petasis, N.A., Flower, R.J., Perretti, M., and Serhan, C.N. (2009). Resolvin D2 is a potent regulator of leukocytes and controls microbial sepsis. Nature 461, 1287–1291. Stoecklin, G., Stubbs, T., Kedersha, N., Wax, S., Rigby, W.F., Blackwell, T.K., and Anderson, P. (2004). MK2-induced tristetraprolin:14-3-3 complexes prevent stress granule association and ARE-mRNA decay. EMBO J. 23, 1313– 1324. Suliman, H.B., Carraway, M.S., Tatro, L.G., and Piantadosi, C.A. (2007). A new activating role for CO in cardiac mitochondrial biogenesis. J. Cell Sci. 120, 299–308. Sun, L., Stoecklin, G., Van Way, S., Hinkovska-Galcheva, V., Guo, R.F., Anderson, P., and Shanley, T.P. (2007). Tristetraprolin (TTP)-14-3-3 complex formation protects TTP from dephosphorylation by protein phosphatase 2a and stabilizes tumor necrosis factor-alpha mRNA. J. Biol. Chem. 282, 3766–3777. Tchen, C.R., Brook, M., Saklatvala, J., and Clark, A.R. (2004). The stability of tristetraprolin mRNA is regulated by mitogen-activated protein kinase p38 and by tristetraprolin itself. J. Biol. Chem. 279, 32393–32400. Vachharajani, V.T., Liu, T., Brown, C.M., Wang, X., Buechler, N.L., Wells, J.D., Yoza, B.K., and McCall, C.E. (2014). SIRT1 inhibition during the hypoinflammatory phenotype of sepsis enhances immunity and improves outcome. J. Leukoc. Biol. 96, 785–796. Verma, A., Hirsch, D.J., Glatt, C.E., Ronnett, G.V., and Snyder, S.H. (1993). Carbon monoxide: a putative neural messenger. Science 259, 381–384. Wells, M.L., Perera, L., and Blackshear, P.J. (2017). An Ancient Family of RNABinding Proteins: Still Important!. Trends Biochem. Sci. 42, 285–296. Wu, X., Tommasi di Vignano, A., Zhou, Q., Michel-Dziunycz, P.J., Bai, F., Mi, J., Qin, J., Zu, T., and Hofbauer, G.F.L. (2018). The ARE-binding protein Tristetraprolin (TTP) is a novel target and mediator of calcineurin tumor suppressing function in the skin. PLoS Genet. 14, e1007366. Young, G.S., Choleris, E., Lund, F.E., and Kirkland, J.B. (2006). Decreased cADPR and increased NAD+ in the Cd38-/- mouse. Biochem. Biophys. Res. Commun. 346, 188–192. Yuan, K., Huang, C., Fox, J., Laturnus, D., Carlson, E., Zhang, B., Yin, Q., Gao, H., and Wu, M. (2012). Autophagy plays an essential role in the clearance of Pseudomonas aeruginosa by alveolar macrophages. J. Cell Sci. 125, 507–515. Zocchi, E., Franco, L., Guida, L., Benatti, U., Bargellesi, A., Malavasi, F., Lee, H.C., and De Flora, A. (1993). A single protein immunologically identified as CD38 displays NAD+ glycohydrolase, ADP-ribosyl cyclase and cyclic ADPribose hydrolase activities at the outer surface of human erythrocytes. Biochem. Biophys. Res. Commun. 196, 1459–1465.

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Antibodies anti-phospho-CREB

Cell Signaling Technology

Cat#9191; RRID: AB_331606

anti-CREB-1(X-12)

Santa Cruz Biotechnology

Cat#sc-240; RRID: AB_627302

anti-phospho-p38

Cell Signaling Technology

Cat#9215; RRID: AB_331762

anti-p38

Cell Signaling Technology

Cat#9212; RRID: AB_330713

anti-TTP(N-terminal)

Sigma-Aldrich

Cat#T5327; RRID: AB_1841222

anti-acetylated-lysine

Cell Signaling Technology

Cat#9441; RRID: AB_331805

anti-Rheb (80-R)

Santa Cruz Biotechnology

Cat#sc-130398; RRID: AB_2178780

anti-Sirt1

Millipore

Cat#07-131; RRID: AB_2188349

anti-V5

Sigma-Aldrich

Cat#V8012; RRID: AB_261889

anti-FLAG

Sigma-Aldrich

Cat#F1804; RRID: AB_262044

Rabbit anti-p62

N/A

N/A

anti-LC3

Novus

Cat#NB100-2220; RRID: AB_791015

anti-phopho-S6 (Ser235/236)

Cell Signaling Technology

Cat#4856; RRID: AB_2181037

anti-S6 Ribosomal protein

Cell Signaling Technology

Cat#2317; RRID: AB_2238583

anti-phospho-4E-BP1

Cell Signaling Technology

Cat#2846; RRID: AB_2292749

anti-phospho-MAPKAPK-2

Cell Signaling Technology

Cat#3007; RRID: AB_490936

anti-MAPKAPK-2

Cell Signaling Technology

Cat#3042; RRID: AB_10694238

anti-beta-actin

Thermo Fisher Scientific

Cat#MA5-11116; RRID: AB_10985704

Anti-ac-p53

Cell Signaling Technology

Cat#2570; RRID: AB_823591

Anti-p53 (DO-1)

Santa Cruz Biotechnology

Cat#sc-126; RRID: AB_628082

Bacterial and Virus Strains Escherichia coli (K-12 strain) BioParticlesTM

Thermo Fisher Scientific

E13231

Pseudomonas aeruginosa

KCTC

N/A

Streptococcus pneumonia

KCTC

N/A

Chemicals, Peptides, and Recombinant Proteins Lipopolysaccharide

Sigma-Aldrich

Cat#L3024

BAPTA-AM

Sigma-Aldrich

Cat#A1076

8-Br-cADPR

Sigma-Aldrich

Cat#B5416

cADPR

Sigma-Aldrich

Cat#C7344

H-89

Sigma-Aldrich

Cat#B1427

CORM2

Sigma-Aldrich

Cat#288144

Forskolin

Sigma-Aldrich

Cat#F6886

EX527

Sigma-Aldrich

Cat#E7034

Rolipram

Sigma-Aldrich

Cat#R6520

Resveratrol

Sigma-Aldrich

Cat#R5010

Okadaic acid

Sigma-Aldrich

Cat#O9381

FK-506 monohydrate

Sigma-Aldrich

Cat#F4679

Cyclosporin A

Sigma-Aldrich

Cat#30024

Trans-NED19

Tocris Bioscience

Cat#3954

Xestospongin C

Tocris Bioscience

Cat#1280

8-Br-ADPR

BIOLOG

Cat#B5416

NAADP-AM

AAT Bioquest

Cat#21000

Cilostazol

Otsuka Pharmaceutical Co. Ltd

Cat#OPC-13013 (Continued on next page)

Cell Reports 30, 1063–1076.e1–e5, January 28, 2020 e1

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Recombinant murine M-CSF

PeproTech

Cat#315-02

Lipofectamine 2000 Transfection Reagent

Thermo Fisher Scientific

Cat#52887

LysoTrackerTM Red DND-99

Thermo Fisher Scientific

Cat#L7528

Critical Commercial Assays Dual-Luciferase Reporter Assay System

Promega

Cat#E1960

EnzyFluoTM NAD+:NADH assay kit

BioAssay Systems

Cat#EFND-100

cAMP Direct Immunoassay kit

BioVision

Cat#K371-100

SYBR Green qPCR Master Mix

Applied Biosystems

Cat#4367659

Mouse TNF-a ELISA kit

BioLegend

Cat#430903

Mouse IL-6 ELISA kit

BioLegend

Cat#431303

Mouse IL-1b ELISA kit

BioLegend

Cat#432603

RAW264.7 cell line

ATCC

Cat#TIB-71

HEK293 cell line

ATCC

Cat#PTA-4488

Experimental Models: Cell Lines

Experimental Models: Organisms/Strains Mouse: C57BL/6J

The Jackson Laboratory

Cat#JAX:000664

Mouse: Ttp/ mice

Dr. Perry J. Blackshear

N/A

Mouse: B6.129P2-Cd38tm1Lnd/J

The Jackson Laboratory

JAX stock #003727

Oligonucleotides Negative control si RNA

Ambion

AM4611

TTP si RNA

Santa Cruz

sc-36761

AC3 siRNA

Santa Cruz

Sc-29601

pcDNA

Addgene

RRID: Addgene_40201

pECE

Addgene

RRID: Addgene_26453

Recombinant DNA

pcDNA6-TTP-V5

Addgene

N/A

pCMV-Tag2B

Clontech

N/A

pCMV-p53

Clontech

N/A

pcDNA3b-FLAG-CBP-HA

Addgene

RRID: Addgene_32908

Flag-SIRT1

Addgene

RRID:Addgene_1791

Flag-SIRT1 H363Y

Addgene

RRID:Addgene_1792

Software and Algorithms Graph Pad Prism Software

GraphPad Software

Version 5.03

ImageJ2x software

N/A

Version 2.1.4.7

FV10-ASW 4.2 viewer software

Olympus Life Science

Version 4.2a

LEAD CONTACT AND MATERIALS AVAILABILITY Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Hun Taeg Chung ([email protected]). All unique/stable reagents generated in this study are available from the Lead Contact without restriction. EXPERIMENTAL MODEL AND SUBJECT DETAILS Animals All mice in this study were on pure C57BL/6 background. Ttp/ male mice, in C57BL/6 background, were provided by Dr. Perry J. Blackshear (Laboratory of Signal Transduction, National Institute of Environmental Health Sciences, USA). Animal studies were approved by the University of Ulsan Animal Care and Use Committee (Reference number HTC-14–030). All mice were maintained under specific pathogen-free conditions at 18-24 C and 40%–70% humidity, with a 12 h light-dark cycle. For animal survival analysis,

e2 Cell Reports 30, 1063–1076.e1–e5, January 28, 2020

10-week old Ttp+/+ and Ttp/ male mice were randomly assigned into four groups (10 mice in each group), including LPS, LPS+CO gas, CLP, CLP+CO gas. Mice were exposed to CO gas (250 ppm) for 4 h per day in an exposure chamber (LB Science, Daejeon, Korea) for 7 days. Then mice were challenged with LPS (25 mg/kg) or CLP surgery. The survival of mice was monitored every 5 h for the LPS-induced sepsis model or every 24 h for CLP-induced sepsis animal model. Cell Lines Mouse macrophage (RAW 264.7) and human embryonic kidney (HEK293) cell lines were cultured in DMEM supplemented with 10% FBS (GIBCO, Melbourne, Australia) and 1% penicillin- streptomycin (GIBCO, Grand Island, NY). Cells were grown at 37 C in humidified incubators containing an atmosphere of 5% CO2. Bone marrow-derived macrophages (BMDM) were isolated from 10-week-old Ttp+/+, Ttp/, Cd38+/+ and Cd38/ mice. After the mice were sacrificed, the femora and tibiae were carefully taken out and dissected free of adherent soft tissue. Bone marrow cells were collected by flushing the cavity by slowly injecting Hanks’ balanced salt solution (HBSS, GIBCO, Grand Island, NY). Then, collected cells were cultured in DMEM (GIBCO, Grand Island, NY), and 50 ng/ ml mouse macrophage colony-stimulating factor (M-CSF, PeproTech, Rocky Hill, NJ) was added to differentiate into BMDMs. Three days later, non-adherent cells were removed, and adherent cells were cultured in fresh DMEM. METHOD DETAILS Lung Histology To detect the pathological changes of lung tissues after the treatment of CLP, lung tissues from Ttp+/+ and Ttp/ mice were fixed in 10% neutral-buffered formation solution and then dehydrated in graded alcohol, embedded in paraffin, sectioned into 4 mm thick sections, and stained with hematoxylin and eosin (H&E). Transfection To silence TTP mRNA expression, RAW264.7 cells were transfected with predesigned siRNA, using the Lipofectamine 2000 method (Invitrogen, CA, USA), according to the manufacturer’s protocol. In addition, HEK cells were transfected with recombinant DNA, including pcDNA6, pECE, pcDNA6-TTP-V5, pcDNA3b-FLAG-CBP-HA, Flag-SIRT1, Flag-SIRT1H36Y, pCMV-Tag2B, and pCMVp53 according to the Lipofectamine 2000 method. RT-PCR and qRT-PCR Total RNA was isolated from cells and tissues by using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions. In brief, 2 mg of total RNA was used to generate cDNA using M-MLV reverse transcriptase (Promega, WI, USA). The resulting cDNA was subjected to PCR to amplify mouse GAPDH, 18S, TTP, TNF-a, IL-6 and IL-1b. Real-time quantitative PCR (qRT-PCR) was performed with SYBR Green qPCR Master Mix (Applied Biosystems, Carlsbad, CA) on the ABI 7500 Fast Real-Time PCR System (Applied Biosystems). TTP qPCR primer 50 /30 Forward: CCAGGCTGGCTTTGAACTCA, Reverse: ACCTGTAACCCCAGAACTTGGA, CD38 qPCR primer 50 /30 Forward: GTGGAGACCCTAGTACTTCT, Reverse: GAACACAGTAA TAGGGTTGTTG, RHEB qPCR primer 50 /30 Forward: AAGTCCCGGAAGATCGCCA, Reverse: GGTTGGATCGTAGGAATCAACAA, LAMP1 qPCR primer 50 /30 Forward: TAATGGCCAGCTTCTCTGCCTCCTT, Reverse: AGGCTGGGGTCAGAAACATTTTCTT, CTSB qPCR primer 50 /30 Forward: TTAGCGCTCTCACTTCCACTACC, Reverse: TGCTTGCTACCTTCCTCTGGTTA, GAPDH qPCR primer 50 /30 Forward: GGGAAGCCCATCACCATCT, Reverse: CGGCCTCACCCCATTTG, murine AC1 qPCR primer 50 /30 Forward: GGTTTGGCAACTCCTTT: TGGT, Reverse: CGCACGAAGACGCCATACA, murine AC3 qPCR primer 50 /30 Forward: TCTTTGACTGCTACGTGGTAGT, Reverse: GGCCCGTGAAAAGTTCAGG, murine AC8 qPCR primer 50 /30 Forward: CTCTACAC CATCCAACCGACG, Reverse: GCACCGAGTC: GCTAGACAG, murine b-actin qPCR primer 50 /30 Forward: AAGGCCAACCGT GAAAA: GATGACC, Reverse: ACCGCTCGTTGCCAATAGTGATGA. Western Blot Assays Cell lysates and lung tissues were prepared using RIPA buffer (Thermo Scientific) containing protease inhibitor (Sigma-Aldrich), phosphatase inhibitor cocktail 2 (Sigma-Aldrich) and phosphatase inhibitor cocktail 3 (Sigma-Aldrich). Total protein concentration of the lysates was measured using a BCA protein assay kit (Pierce Biotechnology, Rockford). Proteins were resolved by SDSPAGE, transferred onto polyvinylidene difluoride (PVDF) membrane (Millipore, Darmstadt, Germany), and probed with appropriate dilutions of the following antibodies: p-CREB (1:1000, Cell Signaling), CREB (1:1000, Santa Cruz), p-p38 (1:2000, Cell Signaling), p38 (1:2000, Cell Signaling), TTP (1:2000, Sigma), Ac-lysine (1:1000, Cell Signaling), RHEB (1:1000, Santa Cruz), Sirt1 (1:1000, Millipore), V5 (1:1000, Sigma), Flag (1:1000, Sigma), p62 (1:1000), LC3 (1:1000, NOVUS), p-S6 (1:1000, Cell Signaling), S6 (1:1000, Cell Signaling), p-4EBP1(1:1000, Cell Signaling), p-MK2 (1:1000, Cell Signaling), MK2 (1:1000, Cell Signaling) and b-actin (1:2000, Thermo Fisher Scientific). Then, membranes were incubated with secondary antibody at room temperature. Antibody binding was visualized with an ECL chemiluminescence system (GE Healthcare Bio-Sciences, Little Chalfont, UK) and chemiluminescence signal was read with an Azure Biosystems C300 analyzer (Azure Biosystems, Inc., Dublin, CA). The relative band density was analyzed by using ImageJ2x software (US National Institutes of Health, Bethesda, MD).

Cell Reports 30, 1063–1076.e1–e5, January 28, 2020 e3

Immunoprecipitation HEK293 cells were first transfected with several recombinant DNA, including pcDNA6, pECE, pcDNA6-TTP-V5, pcDNA3b-FLAGCBP-HA, Flag-SIRT1 and Flag-SIRT1-H363Y according to the Lipofectamine 2000 method. After 36h incubation, cells were harvested and lysed using RIPA buffer (Thermo Scientific) containing protease inhibitor (Sigma-Aldrich), phosphatase inhibitor cocktail 2 (Sigma-Aldrich), phosphatase inhibitor cocktail 3 (Sigma-Aldrich), and indoleacetic acid (IAA, Sigma). For immunoprecipitation, we utilized pierce A/G-coupled magnetic beads (88803, Thermo Scientific) according to the manufacturer’s protocol. Anti-V5 antibody was added in 15 mL magnetic beads and incubated for 2 h in room temperature. Then 100 mg cell lysates were added to beads-antibody complex and incubated overnight with rotation at 4 C. The supernatants were removed into new eppendorf tubes for Western Blot assays. Beads were washed two times with 1 x PBS with 0.5% tween 20, and then washed one time with 1 x PBS. Proteins in the immunoprecipitates were detected by Western Blot, and the corresponding antibodies used were, Ac-lysine (1:1000, Cell Signaling), TTP (1:2000, Sigma), V5 (1:1000, Sigma), Sirt1 (1:1000, Millipore), Flag (1:1000, Sigma) and b-actin (1:2000, Thermo Fisher Scientific). RNA immunoprecipitation Mouse macrophage cell line RAW 264.7 cells were seeded in 10 cm dishes (1 3 107 cells per dish) and were stimulated with LPS (100 ng/ml) for 6 h. Then, cells were harvested and resuspended in 2 mL DMEM. Cell pellets were collected by centrifugation at 1000 rpm for 5 min and resuspended in 500 mL RIP buffer (150 mM KCl, 25 mM Tris pH7.4, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40 and 100 U/ml RNase inhibitor and protease inhibitors). Resuspended cells were mechanically sheared using sonifiers, and cells were sonicated on ice 4 times at 30 s intervals. Supernatants were collected via centrifugation at 13,000 rpm for 10min. Antibodies to TTP (1:2000, Sigma) were added to Pierce A/G-coupled magnetic beads (Thermo Scientific), and incubated for 4 h at room temperature with gentle rotation, then 1000 mg protein was added into the supernatant, and incubated overnight in 4 C with gentle rotation. Beads were pelleted at 2,500 rpm for 30 s, the supernatant was transferred to new eppendorf tubes, and beads were resuspended in 500 mL RIP buffer, and this was repeated for a total of three RIP washes, followed by one wash in 1 3 PBS. Beads were resuspended in 750 mL of Trizol (Invitrogen), and precipitated RNAs were isolated. The protein isolated by the beads was detected by western blot analysis. Luciferase Assay For luciferase assays, cells were co-transfected with a pGL3/TTPp-1343, 812, 211, 41-luciferase reporter construct and pRL-SV40 Renilla luciferase construct using TurboFectTM in vitro transfection reagent (Thermo Scientific). Transfected cells were lysed with lysis buffer and mixed with luciferase assay reagent (Promega). The chemiluminescent signal was measured using a SpectraMax L Microplate (Molecular Devices, Sunnyvale, CA, USA). Firefly luciferase was normalized to Renilla luciferase in each sample. All luciferase assays reported in this study represent at least three independent experiments, each consisting of three wells per transfection. Enzyme-Linked Immunosorbent Assays (ELISA) Supernatants collected from cultured RAW 264.7 cells, serum, and peritoneal fluid extracted from sacrificed mice and kept on ice. Then the levels of TNF-a, IL-6 and IL-1b proteins were measured by using BioLegend MAXTM ELISA kits (BioLegend, San Diego, USA), respectively. cAMP assay Mouse macrophage cell line RAW 264.7 cells (5 3 105 cells per sample) were seeded in 6-well plates, and were challenged with LPS (100 ng/ml) in a time-dependent manner (0, 5 min, 10 min, 30 min, 60 min, 3 h, 6 h, 9 h, and 12 h). Intracellular cAMP was measured using a kit from Bio Vision (Bio Vision, CA, USA) according to the manufacturer’s instruction. NAD+ and NADH measurements RAW 264.7 cells were seeded in 6-well plates (5 3 105 cells per well) and were treated with LPS (100 ng/ml) in a time-dependent manner (0, 3, 6, 9, 12, 18, 24, and 36 h). Then, cells were scraped, and NAD+ and NADH levels were quantified by using the EnzyFluoTM NAD+: NADH assay kit (BioAssay Systems, Hayward, CA) according to the manufacturer’s protocol. CFU determination Blood collected from the cardiac puncture of mice during euthanasia was centrifuged to separate the serum. Peritoneal lavage fluid was collected by installation and withdrawal of 1 mL 1 3 PBS. Tissues of lung, liver, spleen, kidneys, small intestine and spleen were collected for homogenization, and the blood, peritoneal lavage fluid and the homogenized tissues were plated on LB agar (Thermo Fisher Scientific) media for overnight growth in an aerobic chamber at 37 C to determine the number of bacterial colony- forming units (CFUs) per sample. Phagocytosis assay To evaluate whether TTP mediates the phagocytotic efficiency of macrophages, RAW264.7 cells (1 3 105 per well) were seeded in confocal 4 well Lab-Tek chambered coverglass (Nunc, Thermo Scientific, Waltham, MA). Cells were first transfected with scramble

e4 Cell Reports 30, 1063–1076.e1–e5, January 28, 2020

RNA (scRNA) or siRNA against TTP (siTTP) for 36 h. After that, cells were treated with CORM2 (20 mM) for 6 h. Alexa Fluor 488-labeled bioparticle E. coli (2 3 106 per well, Invitrogen) and 0.2 mM lysotracker (Life Technology) were added in cells and incubated in the dark at 37 C for 50 min. Then cells were fixed with 4% paraformaldehyde in PBS at room temperature for 30 min, and stained with 1 mg/ml DAPI (Sigma) for 15 min. Samples were washed with 1 3 PBS (GIBCO, Grand Island, NY) for 3 times, and were imaged with an Olympus FV1200 confocal microscope (Olympus, Tokyo, Japan). To analyze the phagocytosis of RAW 264.7 macrophages, we applied FV10-ASW 4.2 viewer software (Olympus, Version 4.2a) to observe the co-localization of E. coli (green) and lysotracker (red) and utilized Pearson’s Correlation Coefficient for data analysis (n = 16 cells per group). QUANTIFICATION AND STATISTICAL ANALYSIS For statistical comparisons, all values were expressed as mean ± SD. Statistical differences between samples were assessed by ANOVA with post hoc Tukey’s honestly significant difference (HSD) test. Moreover, statistical differences between groups in Ttp+/+ and Ttp/ genotypes, as well as in scRNA and siTTP transfected cells, were assessed by two-way ANOVA with Bonferroni post-tests. Data were analyzed and presented with GraphPad Prism software version 5.03 (San Diego, CA). Probability values of p % 0.05 were considered to represent a statistically significant change. DATA AND CODE AVAILABILITY This study did not generate any unique datasets or code.

Cell Reports 30, 1063–1076.e1–e5, January 28, 2020 e5