- Email: [email protected]
dark conditions
General and Comparative Endocrinology 152 (2007) 144–147 www.elsevier.com/locate/ygcen
Cry1 expression in the chicken pineal gland: EVects of changes in the light/dark conditions András D. Nagy ¤, Valér J. Csernus Department of Anatomy, Medical School, University of Pécs, and Neurohumoral Regulations Research Group of the Hungarian Academy of Sciences, H-7633 Pécs, Szigeti út, Hungary Received 15 September 2006; revised 16 January 2007; accepted 19 January 2007 Available online 26 January 2007
Abstract Cryptochromes (Cry) are core components in the gene regulation of circadian rhythmic processes. It was shown earlier, that Cry1 mRNA content of the avian pineal gland was increased after a 4 h exposure to light during subjective night; however, a 30 min exposure was ineVective. In this study, changes in pineal Cry1 expression were detected in chickens during and after being placed into reversed light/dark environment. Cry1 mRNA content was higher if light was on during the night; however, in the Wrst 2 h of light exposure at night, Cry1 mRNA contents were decreased. Following the Wrst overnight light exposure, the peak of the mRNA expression was delayed for 12 h compared to controls. Our results suggest that environmental illumination activates a complex regulatory cascade that includes both up- and down-regulation of the Cry1 gene which inverses the 24 h pattern of Cry1 mRNA expression within one period. © 2007 Elsevier Inc. All rights reserved. Keywords: Circadian; Avian; Pineal gland; Light; Clock genes; Cry1
1. Introduction Entrainment of the circadian biological rhythms was shown to be associated with the regulation of clock gene expression by environmental stimuli (Nuesslein-Hildesheim et al., 2000). Cryptochromes (Cry1 and Cry2) are principal mediators of transcriptional regulation in circadian clocks (Kume et al., 1999). Promoter sequences of the Cry1 gene contain binding sites for both repressor (Rev/ Erb, Etchegaray et al., 2003) and activator complexes (Clock/Bmal, Shearman et al., 2000) of the molecular clockwork. Data on the eVects of environmental illumination on the expression of Cry1 can provide details on mechanisms which entrain the clock. Unlike in mammals, the pineal glands of several non-mammalian species, including birds, contain an autonomous circadian clock connected to functioning *
Corresponding author. E-mail address: [email protected] (A.D. Nagy).
0016-6480/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2007.01.019
photoreceptors (Zimmerman and Menaker, 1975; Falcon et al., 1989; Natesan et al., 2002). The avian pineal gland, therefore, can be used well as a model to study how biological clocks are synchronized to the environment. Although changes in Cry1 expression happen approximately parallel to the phase of the rhythmic environmental illumination (Miyamoto and Sancar, 1999; Yamamoto et al., 2001; Yasuo et al., 2003), a brief exposure to light (15–30 min) during the early phase of the subjective night is insuYcient to induce transcription in both avian pineal and mammalian SCN clocks (Miyamoto and Sancar, 1999; Yasuo et al., 2003). These data suggest that Cry1 expression is regulated by a complex light sensitive clock mechanism including a cascade of several steps. Detecting changes in the rhythm of Cry1 expression during experimental phase-shifts of light/dark cycles is a useful method to collect more data on the mechanisms that synchronize biological clocks (Reddy et al., 2002). Since data on the eVects of light on the Cry1 expression of the avian
A.D. Nagy, V.J. Csernus / General and Comparative Endocrinology 152 (2007) 144–147
pineal oscillator were found controversial (Yamamoto et al., 2001; Fu et al., 2002; Bailey et al., 2003; Yasuo et al., 2003; Helfer et al., 2006), in this study, Cry1 mRNA contents of pineal glands were measured in chickens during and after an overnight light exposure of various durations. 2. Materials and methods 2.1. Animals Newly hatched white Leghorn chickens were housed under 14/10 h cycles of light/dark environment (light on at 06:00 D ZT 0, i.e., zeitgeber time), at a temperature of 24 °C. The chickens were illuminated with Xuorescent lamps providing 400 lux measured at the level of the bird’s head. Food and water were available ad libitum. Animal housing, care, and application of experimental procedures were in accordance to institutional guidelines under approved protocols (University of Pécs, No. BA02/200031/2001). The experiments were carried out on the 6th week after hatching. In the control groups (n D 20 in each experiment), light/dark conditions were not modiWed. In the Wrst experiment, chickens were exposed to light for 28 h beginning ZT 0 (“exposed” group, n D 20). To monitor the acute eVects of light at night on the pineal Cry1 expression, pineal glands were collected in 2 h intervals, between ZT 14 and ZT 0. In the next experiment, light/dark conditions were reversed (“reversed” group, n D 20, lights on at the same time as lights oV in the control group, i.e. ZT 14). Glands were collected beginning 4 h before the dark phase of the Wrst cycle of reversed light/dark conditions (ZT 0 in the control group). To detect changes in the 24 h pattern of Cry1 expression, taking samples every 4 h provided enough data, as it is commonly accepted. After decapitation, the glands were immediately removed, homogenized, and subsequently frozen at ¡70 °C.
2.2. Semi-quantitative RT-PCR Total RNA was extracted from pineal glands with Sigma’s TRI Reagent following the manufacturer’s protocol. Using 200 ng pineal RNA, one-step RT-PCR was performed with 5 U MMLV Reverse Transcriptase (Applied Biosystems) and 0.2 U RedTaq DNA polymerase (Sigma). After 15 min of incubation at 42 °C and denaturation for 5 min at 94 °C, the reaction was run for 26 cycles (94 °C for 30 s, 58 °C for 30 s, and then at 72 °C for 1 min). The primers for Cry1 mRNA (forward: GAATGCTGGAAGCTGGATGTG, and reverse CCTTCTGGACAC TCTCTGG) were designed earlier in our laboratory (Csernus et al., 2005). To use a 500 bp fragment of the chicken -actin mRNA for internal standard, GATGGACTCTGGTGATGGTG and AGGGCTGTGATCT CCTTCTG primer pairs were applied. PCR products were separated with 3 mm thin, 2% agarose mini-gels (in TAE buVer), which were post-stained with SYBR Green I (Sigma) and trans-illuminated with blue light (Dark Reader, Clare Chemical Ltd., USA). Pixel intensities of bands on gel photos were measured with Image-J software (NIH). Cry1 expression level was determined by dividing mean band intensities of Cry1 by that of the -actin.
2.3. Statistical analysis DiVerences in Cry1 mRNA contents between samples taken at diVerent time points were analyzed with one-way factorial ANOVA and Fisher’s least signiWcant diVerence (LSD) post hoc test. EVect of changes in the environmental illumination on the gene’s expression proWle was examined with two-way factorial ANOVA. If two-way ANOVA returned signiWcant diVerences, the diVerence between experimental and control data at each time point was analyzed with Student’s t-test. DiVerences between the eVects of a 14 h light exposure at night (Wrst experiment) and the eVects of the same exposure after one cycle of reversed light/dark conditions (second experiment) were analyzed with two-way ANOVA, using data collected at ZT 16 and ZT 20.
145
3. Results 3.1. Changes in Cry1 mRNA contents of chicken pineal glands during 14 h of light exposure at night Pineal samples were collected during the subjective night period (between ZT 14 and ZT 0), in 2 h intervals. During exposure, pineal Cry1 expression decreased in 2 h (p D 0.040, Fig. 1). In turn, 8 h after the beginning of the exposure, Cry1 mRNA contents were increased (p D 0.050 at ZT 22 and p D 0.042 at ZT 0). In control chickens, Cry1 mRNA expression decreased during the night (p D 0.029). Light exposure altered the pattern of Cry1 expression at night (p D 0.0037). Compared to control, after the beginning of the exposure, Cry1 mRNA contents were lower in 2 h (p D 0.0433), but higher in 8 h (p D 0.0429 at ZT 22 and p D 0.0234 at ZT 0, Fig. 1). 3.2. EVects of a reversed light/dark cycle on the 24 h pattern of Cry1 expression in the chicken pineal gland Pineal glands were collected between ZT 0 (4 h before lights oV in the reversed group) and ZT 20 in 4 h intervals. Pineal Cry1 expression showed episodic changes already in the Wrst cycle of reversed light/dark conditions (p D 0.000074, Fig. 2). mRNA contents decreased 4 h after lights oV (ZT 8, p D 0.0083 or p D 0.0487 if related to ZT 0 or ZT 4, respectively). By the end of the Wrst reversed cycle, Cry1 expression increased (ZT 12, p D 0.00097), and remained at the same level during the Wrst 6 h of the next cycle (p D 0.0364 and p D 0.0252 at ZT 16 and 20, respectively). In control chickens, changes in Cry1 mRNA
Fig. 1. Changes in Cry1 mRNA contents of chicken pineal glands during 14 h of light exposure during subjective night. Graphs represent means § SEM of Cry1/-actin mRNA contents of 2–4 glands (Wlled squares, experimental group; empty squares, control group). Horizontal bars show light/dark conditions for each group (black indicates dark period). SigniWcant diVerences (p < 0.050) between experimental and control groups are shown with asterisks. Results of statistical analysis (p values): Exposed group: ANOVA, 0,019; post hoc ZT14, 0.04; ZT18, 0.155; ZT20, 0.168; ZT22, 0.050; ZT0, 0.043. Control group: ANOVA, 0.083; post hoc ZT14, 0.043; ZT16, 0.029; ZT18, 0.126; ZT22, 0.29; ZT0, 0.302. Comparison of groups: ANOVA: exposure, 0.803; Zeitgeber, 0.038; interaction, 0.0037. Student’s t-test: ZT14, 0.348; ZT16, 0.043; ZT18, 0.155; ZT20, 0.340; ZT22, 0.043; ZT0, 0.023.
146
A.D. Nagy, V.J. Csernus / General and Comparative Endocrinology 152 (2007) 144–147
Fig. 2. EVects of one reversed light/dark cycle on the rhythm of Cry1 expression in the chicken pineal gland. The keys of this Wgure are similar to those of Fig. 1. Results of statistical analysis (p values): Reversed group: ANOVA, 0.000074; post hoc ZT0, 0.0083; ZT4, 0.0487; ZT12, 0.0009; ZT16, 0.0364; ZT20, 0.0252. Control group: ANOVA, 0.0098; post hoc ZT0, 0.0742; ZT4, 0.0128; ZT8, 0.0089; ZT12, 0.0043; ZT16, 0.0555. Comparison of groups: ANOVA: exposure, 0.9625; Zeitgeber, 0.0466; interaction, 0.000002. Student’s t-test: ZT0, 0.0392; ZT4, 0.1099; ZT8, 0.0129; ZT12, 0.1428; ZT16, 0.1378; ZT20, 0.0157.
contents showed circadian pattern (p D 0.0098) with peak values at late subjective day (ZT 12, p D 0.0043), as expected. The circadian pattern of Cry1 expression in the chicken pineal gland was altered by the inversion of the light/dark cycle (p D 0.000002). Compared to control, Cry1 mRNA contents were higher 10 h after the beginning of the Wrst reversed cycle (ZT 0, p D 0.0392), and lower 4 h after lights oV (ZT 8, p D 0.0129, Fig. 2). Also, by the 6th hour of the second reversed cycle, Cry1 expression was increased (ZT 20, p D 0.0179). 3.3. DiVerences between the eVects of a 14 h light exposure at night and the eVects of the same exposure after one cycle of reversed light/dark conditions Compared to the exposed group, Cry1 mRNA contents were higher in the reversed group (p D 0.0145 with two-way ANOVA) between ZT 16 and ZT 20 i.e., during illumination. Also, the onset of increased Cry1 expression was seen 10 h earlier (ZT 12 in the reversed group vs. ZT 22 in the exposed group, Fig. 2). A decrease in Cry1 mRNA contents during light exposure was detected in the Wrst 4 h of the Wrst overnight illumination, but not during the second cycle of the reversed light/dark conditions (ZT 16, Figs. 1 and 2). 4. Discussion Under normal LD conditions, the Cry1 expression of the chicken pineal gland peaks before the day–night transition (Control group in our experiments and Yamamoto et al., 2001; Fu et al., 2002; Bailey et al., 2003; Yasuo et al., 2003; Csernus et al., 2005; Helfer et al., 2006). Also our data support that pineal Cry1 transcription is induced by light, since Cry1 mRNA contents of glands are higher after several hours of illumination (Figures of this study and Csernus et al., 2005).
Changes in both Cry1 (this study) and Per1/Per2 (Shigeyoshi et al., 1997; Yoshimura et al., 2000) expression run approximately parallel to the alterations of the environmental light. Unlike in case of Period genes (Shigeyoshi et al., 1997; Yoshimura et al., 2000), the activator eVect of light on the Cry1 transcription might not be direct: (1) the expression of Cry1 is not induced by a single, brief exposure to light (15–30 min) at early subjective night (Miyamoto and Sancar, 1999; Yasuo et al., 2003). In our experiments presented here, in vivo illumination increased pineal Cry1 expression after a temporarily decrease within the Wrst 4 h of the light exposure during subjective night in chickens (Fig. 1). However, light did not induce decrease in Cry1 mRNA contents during the second cycle of reversed light/ dark conditions (Fig. 2). Figures of earlier reports indicated that Cry1 mRNA contents were decreased in the Wrst 2 h of an acute delay in the environmental light/dark cycles in both avian pineal or mammalian SCN models, although the authors did not mention this fact (Fig. 1. in Miyamoto and Sancar, 1999; Fig. 4 in Reddy et al., 2002; and Fig. 7 in Yasuo et al., 2003). Based on these data it seems obvious that an exposure to light during early subjective night may induce short-time repression of Cry1 transcription. Furthermore, (2) increase in Cry1 mRNA contents was seen already during the dark phase of the Wrst cycle of reversed light/dark conditions (Fig. 2), similar to data collected on the mammalian SCN (Reddy et al., 2002). These data support the idea that the light-dependent induction of Cry1 expression might be mediated by more complex mechanisms compared to those which regulate Period clock genes. Under reversed light/dark conditions, peak values of Cry1 mRNA contents in chicken pineal glands were detected 12 h later already in the Wrst cycle of the reversed pattern of environmental illumination, if compared to control (ZT 0 vs. ZT 12, Fig. 2). Also, by the time of dark-tolight transition at the beginning of the second reversed cycle, Cry1 expression is already induced (Fig. 2), as it is around dark-to-light transitions under control conditions (Yamamoto et al., 2001; Fu et al., 2002; Bailey et al., 2003; Yasuo et al., 2003; Csernus et al., 2005; Helfer et al., 2006). Similar light-entrainment was shown in the mouse SCN: 6 h delay in the light/dark cycles resulted in phase-shifted Cry1 mRNA rhythm already on the next experimental day (Reddy et al., 2002). These data suggest that the 24 h pattern of Cry1 expression can be reorganized in vivo within 24 h by altered environmental light/dark cycles in circadian clocks of vertebrates. Further studies are needed to prove whether the Rev/Erb and Clock/Bmal complexes mediate the rapid, light-dependent entrainment in vivo, or a yet unknown mechanism has to be revealed. Based on our Wndings, the circadian oscillator of the avian pineal clock shows better functional homology with the oscillator in the mammalian SCN clock, than with that of mammalian peripheral clocks: (1) phase-amplitude changes of the rhythmic Cry1 expression are similar in the chicken pineal gland and the mammalian SCN not only under normal LD conditions (Yamamoto et al., 2001), but
A.D. Nagy, V.J. Csernus / General and Comparative Endocrinology 152 (2007) 144–147
also during an acute shift in the light–dark cycle. Also, (2) various, mostly yet unknown components of the clock mechanisms might be activated by the in vivo illumination simultaneously, since transcription of Cry1 is not only upregulated, but is also down-regulated temporarily by acute light exposure in circadian clocks of rodents and birds. To summarize, it seems obvious, that environmental illumination activates a complex regulatory cascade that includes both up- and down-regulation of the Cry1 gene which inverses the 24 h pattern of Cry1 mRNA expression within one period. Since photoreceptors function in vivo in avian pinealocytes (Natesan et al., 2002), but not in the mammalian SCN, further in vitro experiments on the chicken pineal model may clarify details of the mechanisms which synchronize the rhythm of clock gene expression to the environmental illumination. Acknowledgements The authors thank Beatrix Brumán and Tüne Mercz for the excellent technical assistance. This work was supported by the Hungarian National Science Research Fund (OTKA 034491), The Hungarian Medical Research Council (ETT 635/2003) and the Hungarian Academy of Sciences. References Bailey, M.J., Beremand, P.D., Hammer, R., Bell-Pedersen, D., Thomas, T.L., Cassone, V.M., 2003. Transcriptional proWling of the chick pineal gland, a photoreceptive circadian oscillator and pacemaker. Mol. Endocrinol. 17, 2084–2095. Csernus, V., Faluhelyi, N., Nagy, A.D., 2005. Features of the circadian clock in the avian pineal gland. Ann. N.Y. Acad. Sci. 1040, 281–287. Etchegaray, J.P., Lee, C., Wade, P.A., Reppert, S.M., 2003. Rhythmic histone acetylation underlies transcription in the mammalian circadian clock. Nature 421, 177–182. Falcon, J., Marmillon, J.B., Claustrat, B., Collin, J.P., 1989. Regulation of melatonin secretion in a photoreceptive pineal organ: an in vitro study in the pike. J. Neurosci. 9, 1943–1950.
147
Fu, Z., Inaba, M., Noguchi, T., Kato, H., 2002. Molecular cloning and circadian regulation of cryptochrome genes in Japanese quail (Coturnix coturnix japonica). J. Biol. Rhythms 17, 14–27. Helfer, G., Fidler, A.E., Vallone, D., Foulkes, N.S., Brandstaetter, R., 2006. Molecular analysis of clock gene expression in the avian brain. Chronobiol. Int. 23, 113–127. Kume, K., Zylka, M.J., Sriram, S., Shearman, L.P., Weaver, D.R., Jin, X., Maywood, E.S., Hastings, M.H., Reppert, S.M., 1999. mCRY1 and mCRY2 are essential components of the negative limb of the circadian clock feedback loop. Cell 98, 193–205. Miyamoto, Y., Sancar, A., 1999. Circadian regulation of cryptochrome genes in the mouse. Brain Res. Mol. Brain Res. 71, 238–243. Natesan, A., Geetha, L., Zatz, M., 2002. Rhythm and soul in the avian pineal. Cell. Tissue Res. 309, 35–45. Nuesslein-Hildesheim, B., O’Brien, J.A., Ebling, F.J., Maywood, E.S., Hastings, M.H., 2000. The circadian cycle of mPER clock gene products in the suprachiasmatic nucleus of the siberian hamster encodes both daily and seasonal time. Eur. J. Neurosci. 12, 2856–2864. Reddy, A.B., Field, M.D., Maywood, E.S., Hastings, M.H., 2002. DiVerential resynchronisation of circadian clock gene expression within the suprachiasmatic nuclei of mice subjected to experimental jet lag. J. Neurosci. 22, 7326–7330. Shearman, L.P., Sriram, S., Weaver, D.R., Maywood, E.S., Chaves, I., Zheng, B., Kume, K., Lee, C.C., van der Horst, G.T., Hastings, M.H., Reppert, S.M., 2000. Interacting molecular loops in the mammalian circadian clock. Science 288, 1013–1019. Shigeyoshi, Y., Taguchi, K., Yamamoto, S., Takekida, S., Yan, L., Tei, H., Moriya, T., Shibata, S., Loros, J.J., Dunlap, J.C., Okamura, H., 1997. Light-induced resetting of a mammalian circadian clock is associated with rapid induction of the mPer1 transcript. Cell 91, 1043–1053. Yamamoto, K., Okano, T., Fukada, Y., 2001. Chicken pineal Cry genes: light-dependent up-regulation of cCry1 and cCry2 transcripts. Neurosci. Lett. 313, 13–16. Yasuo, S., Watanabe, M., Okabayashi, N., Ebihara, S., Yoshimura, T., 2003. Circadian clock genes and photoperiodism: Comprehensive analysis of clock gene expression in the mediobasal hypothalamus, the suprachiasmatic nucleus, and the pineal gland of Japanese Quail under various light schedules. Endocrinology 144, 3742–3748. Yoshimura, T., Suzuki, Y., Makino, E., Suzuki, T., Kuroiwa, A., Matsuda, Y., Namikawa, T., Ebihara, S., 2000. Molecular analysis of avian circadian clock genes. Brain Res. Mol. Brain Res. 78, 207–215. Zimmerman, N.H., Menaker, M., 1975. Neural connections of sparrow pineal: role in circadian control of activity. Science 190, 477–479.
Cry1 expression in the chicken pineal gland: EVects of changes in the light/dark conditions András D. Nagy ¤, Valér J. Csernus Department of Anatomy, Medical School, University of Pécs, and Neurohumoral Regulations Research Group of the Hungarian Academy of Sciences, H-7633 Pécs, Szigeti út, Hungary Received 15 September 2006; revised 16 January 2007; accepted 19 January 2007 Available online 26 January 2007
Abstract Cryptochromes (Cry) are core components in the gene regulation of circadian rhythmic processes. It was shown earlier, that Cry1 mRNA content of the avian pineal gland was increased after a 4 h exposure to light during subjective night; however, a 30 min exposure was ineVective. In this study, changes in pineal Cry1 expression were detected in chickens during and after being placed into reversed light/dark environment. Cry1 mRNA content was higher if light was on during the night; however, in the Wrst 2 h of light exposure at night, Cry1 mRNA contents were decreased. Following the Wrst overnight light exposure, the peak of the mRNA expression was delayed for 12 h compared to controls. Our results suggest that environmental illumination activates a complex regulatory cascade that includes both up- and down-regulation of the Cry1 gene which inverses the 24 h pattern of Cry1 mRNA expression within one period. © 2007 Elsevier Inc. All rights reserved. Keywords: Circadian; Avian; Pineal gland; Light; Clock genes; Cry1
1. Introduction Entrainment of the circadian biological rhythms was shown to be associated with the regulation of clock gene expression by environmental stimuli (Nuesslein-Hildesheim et al., 2000). Cryptochromes (Cry1 and Cry2) are principal mediators of transcriptional regulation in circadian clocks (Kume et al., 1999). Promoter sequences of the Cry1 gene contain binding sites for both repressor (Rev/ Erb, Etchegaray et al., 2003) and activator complexes (Clock/Bmal, Shearman et al., 2000) of the molecular clockwork. Data on the eVects of environmental illumination on the expression of Cry1 can provide details on mechanisms which entrain the clock. Unlike in mammals, the pineal glands of several non-mammalian species, including birds, contain an autonomous circadian clock connected to functioning *
Corresponding author. E-mail address: [email protected] (A.D. Nagy).
0016-6480/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2007.01.019
photoreceptors (Zimmerman and Menaker, 1975; Falcon et al., 1989; Natesan et al., 2002). The avian pineal gland, therefore, can be used well as a model to study how biological clocks are synchronized to the environment. Although changes in Cry1 expression happen approximately parallel to the phase of the rhythmic environmental illumination (Miyamoto and Sancar, 1999; Yamamoto et al., 2001; Yasuo et al., 2003), a brief exposure to light (15–30 min) during the early phase of the subjective night is insuYcient to induce transcription in both avian pineal and mammalian SCN clocks (Miyamoto and Sancar, 1999; Yasuo et al., 2003). These data suggest that Cry1 expression is regulated by a complex light sensitive clock mechanism including a cascade of several steps. Detecting changes in the rhythm of Cry1 expression during experimental phase-shifts of light/dark cycles is a useful method to collect more data on the mechanisms that synchronize biological clocks (Reddy et al., 2002). Since data on the eVects of light on the Cry1 expression of the avian
A.D. Nagy, V.J. Csernus / General and Comparative Endocrinology 152 (2007) 144–147
pineal oscillator were found controversial (Yamamoto et al., 2001; Fu et al., 2002; Bailey et al., 2003; Yasuo et al., 2003; Helfer et al., 2006), in this study, Cry1 mRNA contents of pineal glands were measured in chickens during and after an overnight light exposure of various durations. 2. Materials and methods 2.1. Animals Newly hatched white Leghorn chickens were housed under 14/10 h cycles of light/dark environment (light on at 06:00 D ZT 0, i.e., zeitgeber time), at a temperature of 24 °C. The chickens were illuminated with Xuorescent lamps providing 400 lux measured at the level of the bird’s head. Food and water were available ad libitum. Animal housing, care, and application of experimental procedures were in accordance to institutional guidelines under approved protocols (University of Pécs, No. BA02/200031/2001). The experiments were carried out on the 6th week after hatching. In the control groups (n D 20 in each experiment), light/dark conditions were not modiWed. In the Wrst experiment, chickens were exposed to light for 28 h beginning ZT 0 (“exposed” group, n D 20). To monitor the acute eVects of light at night on the pineal Cry1 expression, pineal glands were collected in 2 h intervals, between ZT 14 and ZT 0. In the next experiment, light/dark conditions were reversed (“reversed” group, n D 20, lights on at the same time as lights oV in the control group, i.e. ZT 14). Glands were collected beginning 4 h before the dark phase of the Wrst cycle of reversed light/dark conditions (ZT 0 in the control group). To detect changes in the 24 h pattern of Cry1 expression, taking samples every 4 h provided enough data, as it is commonly accepted. After decapitation, the glands were immediately removed, homogenized, and subsequently frozen at ¡70 °C.
2.2. Semi-quantitative RT-PCR Total RNA was extracted from pineal glands with Sigma’s TRI Reagent following the manufacturer’s protocol. Using 200 ng pineal RNA, one-step RT-PCR was performed with 5 U MMLV Reverse Transcriptase (Applied Biosystems) and 0.2 U RedTaq DNA polymerase (Sigma). After 15 min of incubation at 42 °C and denaturation for 5 min at 94 °C, the reaction was run for 26 cycles (94 °C for 30 s, 58 °C for 30 s, and then at 72 °C for 1 min). The primers for Cry1 mRNA (forward: GAATGCTGGAAGCTGGATGTG, and reverse CCTTCTGGACAC TCTCTGG) were designed earlier in our laboratory (Csernus et al., 2005). To use a 500 bp fragment of the chicken -actin mRNA for internal standard, GATGGACTCTGGTGATGGTG and AGGGCTGTGATCT CCTTCTG primer pairs were applied. PCR products were separated with 3 mm thin, 2% agarose mini-gels (in TAE buVer), which were post-stained with SYBR Green I (Sigma) and trans-illuminated with blue light (Dark Reader, Clare Chemical Ltd., USA). Pixel intensities of bands on gel photos were measured with Image-J software (NIH). Cry1 expression level was determined by dividing mean band intensities of Cry1 by that of the -actin.
2.3. Statistical analysis DiVerences in Cry1 mRNA contents between samples taken at diVerent time points were analyzed with one-way factorial ANOVA and Fisher’s least signiWcant diVerence (LSD) post hoc test. EVect of changes in the environmental illumination on the gene’s expression proWle was examined with two-way factorial ANOVA. If two-way ANOVA returned signiWcant diVerences, the diVerence between experimental and control data at each time point was analyzed with Student’s t-test. DiVerences between the eVects of a 14 h light exposure at night (Wrst experiment) and the eVects of the same exposure after one cycle of reversed light/dark conditions (second experiment) were analyzed with two-way ANOVA, using data collected at ZT 16 and ZT 20.
145
3. Results 3.1. Changes in Cry1 mRNA contents of chicken pineal glands during 14 h of light exposure at night Pineal samples were collected during the subjective night period (between ZT 14 and ZT 0), in 2 h intervals. During exposure, pineal Cry1 expression decreased in 2 h (p D 0.040, Fig. 1). In turn, 8 h after the beginning of the exposure, Cry1 mRNA contents were increased (p D 0.050 at ZT 22 and p D 0.042 at ZT 0). In control chickens, Cry1 mRNA expression decreased during the night (p D 0.029). Light exposure altered the pattern of Cry1 expression at night (p D 0.0037). Compared to control, after the beginning of the exposure, Cry1 mRNA contents were lower in 2 h (p D 0.0433), but higher in 8 h (p D 0.0429 at ZT 22 and p D 0.0234 at ZT 0, Fig. 1). 3.2. EVects of a reversed light/dark cycle on the 24 h pattern of Cry1 expression in the chicken pineal gland Pineal glands were collected between ZT 0 (4 h before lights oV in the reversed group) and ZT 20 in 4 h intervals. Pineal Cry1 expression showed episodic changes already in the Wrst cycle of reversed light/dark conditions (p D 0.000074, Fig. 2). mRNA contents decreased 4 h after lights oV (ZT 8, p D 0.0083 or p D 0.0487 if related to ZT 0 or ZT 4, respectively). By the end of the Wrst reversed cycle, Cry1 expression increased (ZT 12, p D 0.00097), and remained at the same level during the Wrst 6 h of the next cycle (p D 0.0364 and p D 0.0252 at ZT 16 and 20, respectively). In control chickens, changes in Cry1 mRNA
Fig. 1. Changes in Cry1 mRNA contents of chicken pineal glands during 14 h of light exposure during subjective night. Graphs represent means § SEM of Cry1/-actin mRNA contents of 2–4 glands (Wlled squares, experimental group; empty squares, control group). Horizontal bars show light/dark conditions for each group (black indicates dark period). SigniWcant diVerences (p < 0.050) between experimental and control groups are shown with asterisks. Results of statistical analysis (p values): Exposed group: ANOVA, 0,019; post hoc ZT14, 0.04; ZT18, 0.155; ZT20, 0.168; ZT22, 0.050; ZT0, 0.043. Control group: ANOVA, 0.083; post hoc ZT14, 0.043; ZT16, 0.029; ZT18, 0.126; ZT22, 0.29; ZT0, 0.302. Comparison of groups: ANOVA: exposure, 0.803; Zeitgeber, 0.038; interaction, 0.0037. Student’s t-test: ZT14, 0.348; ZT16, 0.043; ZT18, 0.155; ZT20, 0.340; ZT22, 0.043; ZT0, 0.023.
146
A.D. Nagy, V.J. Csernus / General and Comparative Endocrinology 152 (2007) 144–147
Fig. 2. EVects of one reversed light/dark cycle on the rhythm of Cry1 expression in the chicken pineal gland. The keys of this Wgure are similar to those of Fig. 1. Results of statistical analysis (p values): Reversed group: ANOVA, 0.000074; post hoc ZT0, 0.0083; ZT4, 0.0487; ZT12, 0.0009; ZT16, 0.0364; ZT20, 0.0252. Control group: ANOVA, 0.0098; post hoc ZT0, 0.0742; ZT4, 0.0128; ZT8, 0.0089; ZT12, 0.0043; ZT16, 0.0555. Comparison of groups: ANOVA: exposure, 0.9625; Zeitgeber, 0.0466; interaction, 0.000002. Student’s t-test: ZT0, 0.0392; ZT4, 0.1099; ZT8, 0.0129; ZT12, 0.1428; ZT16, 0.1378; ZT20, 0.0157.
contents showed circadian pattern (p D 0.0098) with peak values at late subjective day (ZT 12, p D 0.0043), as expected. The circadian pattern of Cry1 expression in the chicken pineal gland was altered by the inversion of the light/dark cycle (p D 0.000002). Compared to control, Cry1 mRNA contents were higher 10 h after the beginning of the Wrst reversed cycle (ZT 0, p D 0.0392), and lower 4 h after lights oV (ZT 8, p D 0.0129, Fig. 2). Also, by the 6th hour of the second reversed cycle, Cry1 expression was increased (ZT 20, p D 0.0179). 3.3. DiVerences between the eVects of a 14 h light exposure at night and the eVects of the same exposure after one cycle of reversed light/dark conditions Compared to the exposed group, Cry1 mRNA contents were higher in the reversed group (p D 0.0145 with two-way ANOVA) between ZT 16 and ZT 20 i.e., during illumination. Also, the onset of increased Cry1 expression was seen 10 h earlier (ZT 12 in the reversed group vs. ZT 22 in the exposed group, Fig. 2). A decrease in Cry1 mRNA contents during light exposure was detected in the Wrst 4 h of the Wrst overnight illumination, but not during the second cycle of the reversed light/dark conditions (ZT 16, Figs. 1 and 2). 4. Discussion Under normal LD conditions, the Cry1 expression of the chicken pineal gland peaks before the day–night transition (Control group in our experiments and Yamamoto et al., 2001; Fu et al., 2002; Bailey et al., 2003; Yasuo et al., 2003; Csernus et al., 2005; Helfer et al., 2006). Also our data support that pineal Cry1 transcription is induced by light, since Cry1 mRNA contents of glands are higher after several hours of illumination (Figures of this study and Csernus et al., 2005).
Changes in both Cry1 (this study) and Per1/Per2 (Shigeyoshi et al., 1997; Yoshimura et al., 2000) expression run approximately parallel to the alterations of the environmental light. Unlike in case of Period genes (Shigeyoshi et al., 1997; Yoshimura et al., 2000), the activator eVect of light on the Cry1 transcription might not be direct: (1) the expression of Cry1 is not induced by a single, brief exposure to light (15–30 min) at early subjective night (Miyamoto and Sancar, 1999; Yasuo et al., 2003). In our experiments presented here, in vivo illumination increased pineal Cry1 expression after a temporarily decrease within the Wrst 4 h of the light exposure during subjective night in chickens (Fig. 1). However, light did not induce decrease in Cry1 mRNA contents during the second cycle of reversed light/ dark conditions (Fig. 2). Figures of earlier reports indicated that Cry1 mRNA contents were decreased in the Wrst 2 h of an acute delay in the environmental light/dark cycles in both avian pineal or mammalian SCN models, although the authors did not mention this fact (Fig. 1. in Miyamoto and Sancar, 1999; Fig. 4 in Reddy et al., 2002; and Fig. 7 in Yasuo et al., 2003). Based on these data it seems obvious that an exposure to light during early subjective night may induce short-time repression of Cry1 transcription. Furthermore, (2) increase in Cry1 mRNA contents was seen already during the dark phase of the Wrst cycle of reversed light/dark conditions (Fig. 2), similar to data collected on the mammalian SCN (Reddy et al., 2002). These data support the idea that the light-dependent induction of Cry1 expression might be mediated by more complex mechanisms compared to those which regulate Period clock genes. Under reversed light/dark conditions, peak values of Cry1 mRNA contents in chicken pineal glands were detected 12 h later already in the Wrst cycle of the reversed pattern of environmental illumination, if compared to control (ZT 0 vs. ZT 12, Fig. 2). Also, by the time of dark-tolight transition at the beginning of the second reversed cycle, Cry1 expression is already induced (Fig. 2), as it is around dark-to-light transitions under control conditions (Yamamoto et al., 2001; Fu et al., 2002; Bailey et al., 2003; Yasuo et al., 2003; Csernus et al., 2005; Helfer et al., 2006). Similar light-entrainment was shown in the mouse SCN: 6 h delay in the light/dark cycles resulted in phase-shifted Cry1 mRNA rhythm already on the next experimental day (Reddy et al., 2002). These data suggest that the 24 h pattern of Cry1 expression can be reorganized in vivo within 24 h by altered environmental light/dark cycles in circadian clocks of vertebrates. Further studies are needed to prove whether the Rev/Erb and Clock/Bmal complexes mediate the rapid, light-dependent entrainment in vivo, or a yet unknown mechanism has to be revealed. Based on our Wndings, the circadian oscillator of the avian pineal clock shows better functional homology with the oscillator in the mammalian SCN clock, than with that of mammalian peripheral clocks: (1) phase-amplitude changes of the rhythmic Cry1 expression are similar in the chicken pineal gland and the mammalian SCN not only under normal LD conditions (Yamamoto et al., 2001), but
A.D. Nagy, V.J. Csernus / General and Comparative Endocrinology 152 (2007) 144–147
also during an acute shift in the light–dark cycle. Also, (2) various, mostly yet unknown components of the clock mechanisms might be activated by the in vivo illumination simultaneously, since transcription of Cry1 is not only upregulated, but is also down-regulated temporarily by acute light exposure in circadian clocks of rodents and birds. To summarize, it seems obvious, that environmental illumination activates a complex regulatory cascade that includes both up- and down-regulation of the Cry1 gene which inverses the 24 h pattern of Cry1 mRNA expression within one period. Since photoreceptors function in vivo in avian pinealocytes (Natesan et al., 2002), but not in the mammalian SCN, further in vitro experiments on the chicken pineal model may clarify details of the mechanisms which synchronize the rhythm of clock gene expression to the environmental illumination. Acknowledgements The authors thank Beatrix Brumán and Tüne Mercz for the excellent technical assistance. This work was supported by the Hungarian National Science Research Fund (OTKA 034491), The Hungarian Medical Research Council (ETT 635/2003) and the Hungarian Academy of Sciences. References Bailey, M.J., Beremand, P.D., Hammer, R., Bell-Pedersen, D., Thomas, T.L., Cassone, V.M., 2003. Transcriptional proWling of the chick pineal gland, a photoreceptive circadian oscillator and pacemaker. Mol. Endocrinol. 17, 2084–2095. Csernus, V., Faluhelyi, N., Nagy, A.D., 2005. Features of the circadian clock in the avian pineal gland. Ann. N.Y. Acad. Sci. 1040, 281–287. Etchegaray, J.P., Lee, C., Wade, P.A., Reppert, S.M., 2003. Rhythmic histone acetylation underlies transcription in the mammalian circadian clock. Nature 421, 177–182. Falcon, J., Marmillon, J.B., Claustrat, B., Collin, J.P., 1989. Regulation of melatonin secretion in a photoreceptive pineal organ: an in vitro study in the pike. J. Neurosci. 9, 1943–1950.
147
Fu, Z., Inaba, M., Noguchi, T., Kato, H., 2002. Molecular cloning and circadian regulation of cryptochrome genes in Japanese quail (Coturnix coturnix japonica). J. Biol. Rhythms 17, 14–27. Helfer, G., Fidler, A.E., Vallone, D., Foulkes, N.S., Brandstaetter, R., 2006. Molecular analysis of clock gene expression in the avian brain. Chronobiol. Int. 23, 113–127. Kume, K., Zylka, M.J., Sriram, S., Shearman, L.P., Weaver, D.R., Jin, X., Maywood, E.S., Hastings, M.H., Reppert, S.M., 1999. mCRY1 and mCRY2 are essential components of the negative limb of the circadian clock feedback loop. Cell 98, 193–205. Miyamoto, Y., Sancar, A., 1999. Circadian regulation of cryptochrome genes in the mouse. Brain Res. Mol. Brain Res. 71, 238–243. Natesan, A., Geetha, L., Zatz, M., 2002. Rhythm and soul in the avian pineal. Cell. Tissue Res. 309, 35–45. Nuesslein-Hildesheim, B., O’Brien, J.A., Ebling, F.J., Maywood, E.S., Hastings, M.H., 2000. The circadian cycle of mPER clock gene products in the suprachiasmatic nucleus of the siberian hamster encodes both daily and seasonal time. Eur. J. Neurosci. 12, 2856–2864. Reddy, A.B., Field, M.D., Maywood, E.S., Hastings, M.H., 2002. DiVerential resynchronisation of circadian clock gene expression within the suprachiasmatic nuclei of mice subjected to experimental jet lag. J. Neurosci. 22, 7326–7330. Shearman, L.P., Sriram, S., Weaver, D.R., Maywood, E.S., Chaves, I., Zheng, B., Kume, K., Lee, C.C., van der Horst, G.T., Hastings, M.H., Reppert, S.M., 2000. Interacting molecular loops in the mammalian circadian clock. Science 288, 1013–1019. Shigeyoshi, Y., Taguchi, K., Yamamoto, S., Takekida, S., Yan, L., Tei, H., Moriya, T., Shibata, S., Loros, J.J., Dunlap, J.C., Okamura, H., 1997. Light-induced resetting of a mammalian circadian clock is associated with rapid induction of the mPer1 transcript. Cell 91, 1043–1053. Yamamoto, K., Okano, T., Fukada, Y., 2001. Chicken pineal Cry genes: light-dependent up-regulation of cCry1 and cCry2 transcripts. Neurosci. Lett. 313, 13–16. Yasuo, S., Watanabe, M., Okabayashi, N., Ebihara, S., Yoshimura, T., 2003. Circadian clock genes and photoperiodism: Comprehensive analysis of clock gene expression in the mediobasal hypothalamus, the suprachiasmatic nucleus, and the pineal gland of Japanese Quail under various light schedules. Endocrinology 144, 3742–3748. Yoshimura, T., Suzuki, Y., Makino, E., Suzuki, T., Kuroiwa, A., Matsuda, Y., Namikawa, T., Ebihara, S., 2000. Molecular analysis of avian circadian clock genes. Brain Res. Mol. Brain Res. 78, 207–215. Zimmerman, N.H., Menaker, M., 1975. Neural connections of sparrow pineal: role in circadian control of activity. Science 190, 477–479.