Cryopreservation of embryogenic tissues from mature holm oak trees

Cryobiology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Cryobiology journal homepage: www.elsevier.com/locate/ycryo

Cryopreservation of embryogenic tissues from mature holm oak trees q Azahara Barra-Jiménez a,⇑, Tuija S. Aronen b, Jesús Alegre a, Mariano Toribio a a b

Instituto Madrileño de Investigación y Desarrollo Rural, Agrario y Alimentario (IMIDRA), Finca El Encín. Apdo. 127, 28800 Alcalá de Henares (Madrid), Spain Finnish Forest Research Institute, Punkaharju Unit, Finlandiantie 18, FI-58450 Punkaharju, Finland

a r t i c l e

i n f o

Article history: Received 26 August 2014 Accepted 22 February 2015 Available online xxxx Keywords: Cryogenic storage Forest biotechnology Quercus ilex Somatic embryogenesis Vegetative propagation Vitrification Genetic stability SSR

a b s t r a c t The development of a vitrification method for cryopreservation of embryogenic lines from mature holm oak (Quercus ilex L.) trees is reported. Globular embryogenic clusters of three embryogenic lines grown on gelled medium, and embryogenic clumps of one line collected from liquid cultures, were used as samples. The effect of both high-sucrose preculture and dehydration by incubation in the PVS2 solution for 30–90 min, on both survival and maintenance of the differentiation ability was evaluated in somatic embryo explants with and without immersion into liquid nitrogen. Growth recovery of the treated samples and ability to differentiate cotyledonary embryos largely depended on genotype. Overall, high growth recovery frequencies on gelled medium and increase of fresh weight in liquid medium were obtained in all the tested lines, also after freezing. However, the differentiation ability of the embryogenic lines was severely hampered following immersion into LN. Two of the embryogenic lines from gelled medium were able to recover the differentiation ability, one not. In the lines with reduced or no differentiation ability, variation in the microsatellite markers was observed when comparing samples taken prior to and after cryopreservation. The best results were achieved in the genotype Q8 in which 80% of explants grown on gelled medium differentiated into cotyledonary embryos following cryopreservation when they were precultured on medium with 0.3 M sucrose and then incubated for 30 min in the PVS2 solution. Explants of the same genotype from liquid medium were unable to recover the differentiation ability. A 4-weeks storage period both in liquid nitrogen and in an ultra-low temperature freezer at 80 °C was also evaluated with four embryogenic lines from gelled medium using the best vitrification treatment. Growth recovery frequencies of all lines from the two storage systems were very high, but their differentiation ability was completely lost. Ó 2015 Elsevier Inc. All rights reserved.

Introduction Holm oak (Quercus ilex L.) is one of the most important tree species in Mediterranean landscapes. It is part of the Iberian agroforestry system named dehesa (Spanish) or montado (Portuguese) that plays a relevant role in rural development, both ecologically and economically [41]. Holm oak produces acorns used to nourish pigs of the Iberian race, which are exploited in a high quality food industry. It also establishes mycorrhiza relationships with several

q The research leading to these results has received funding from the Spanish Ministry of Science and Innovation (AGL2010-22292-C01 project) and the European Union’s Seventh Framework Programme for research, technological development and demonstration under grant agreement n° 284181 (‘‘Trees4Future’’). The contents of this publication reflect only the author’s/authors’ views and the European Union is not liable for any use that may be made of the information contained therein. This work was also supported by a postgraduate fellowship from IMIDRA to A. Barra-Jiménez and it is part of the requirements to fulfil A. BarraJiménez’s Ph.D. degree. ⇑ Corresponding author.

edible fungi from the Tuber genus, as the gastronomically highly appreciated black truffle. The large variability observed in the production of both acorn in dehesas [6] and truffle fruitbodies in mycorrhized holm oak plantations [52], justifies undertaking genetic improvement programs. Conservation and breeding programs of oak species are constrained by long life cycles, seed recalcitrance in conservation, and impossibility to perform vegetative propagation by traditional techniques [47]. Somatic embryogenesis (SE) has been developed as a powerful biotechnology of plant regeneration in several forest species, which enables their large-scale clonal propagation and gives breeders the fastest and most flexible method to produce genetically improved material [29]. Plantlet regeneration by SE has been achieved in most of the economically important Quercus species, even using tissues from adult trees [8]. Recently, SE induction has been achieved in tissues from adult holm oak trees both in male catkins [4] and also in ovule integuments, from whose somatic embryos were plantlets regenerated [3].

http://dx.doi.org/10.1016/j.cryobiol.2015.02.006 0011-2240/Ó 2015 Elsevier Inc. All rights reserved.

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006

2

A. Barra-Jiménez et al. / Cryobiology xxx (2015) xxx–xxx

Cryopreservation in liquid nitrogen (LN) ensures the long-term storage of a broad range of plant materials, including seeds, zygotic embryos, dormant buds, shoot tips, somatic embryos and cell suspensions [40]. Embryogenic tissues and somatic embryos are highly amenable to cryopreservation. Usually, these tissues are able to undergo secondary or repetitive embryogenesis and therefore, new embryos can be produced from undamaged cells after freezing [23,59]. Cryopreservation of embryogenic tissues prevents the loss of cultures by contamination and genetic alterations due to prolonged subcultures. Besides, they are routinely applied to large numbers of clonal lines awaiting field testing results while maintain the juvenile potential for mass propagation [16]. The cryopreservation of selected plant material is not only useful for conservation purposes, it is also the method of choice to prevent the loss of embryogenic potential and the ability for further development with time in many species, particularly in conifers, [9]. In the case of embryogenic lines from mature holm oak trees, the loss of embryogenic potential has also been observed [3] and as it has been claimed that the use cryopreservation increases the embryogenic capacity of declining lines [35], it may be useful to solve this problem. Different methods of cryopreservation have been successfully applied to several explants of forest species. In Fagaceae, desiccation, encapsulation, encapsulation-dehydration and vitrification have been applied to embryogenic tissues [21,7,13,58]. Among all these methods, vitrification has proven to be very effective in Quercus species [8]. The encapsulation/dehydration method has also been successfully used in cork oak, claiming that it is a better method because toxic substances such as dimethyl sulfoxide (DMSO) are not needed [13]. However, vitrification procedures offer simplicity and reproducibility [40], and are more appropriate for complex organs such as shoot tips and embryos [12]. Although some studies refer that cryoprotectants may be a risk for genetic fidelity [25], regenerated plants from vitrification-cryopreserved Quercus robur embryogenic lines showed marker stability [46]. All published protocols on cryopreservation of embryogenic lines of Quercus species deal with material from semisolid cultures. Suspension cultures in liquid medium represent important advantages comparing with gelled cultures: they imply less economical input and manual labour, and are more amenable to automation. Therefore, they are essential for mass propagation. Based on a protocol for establishing cork oak suspensions [20], we initiated liquid cultures from embryogenic lines of holm oak (unpublished results). Most vitrification protocols have two main steps before immersion of the samples into LN: (i) preconditioning of explants and (ii) dehydration with a highly concentrated vitrification solution, usually PSV2. Many species require an intermediate loading treatment [43], which was not included in the protocols developed for pedunculate oak [33] and cork oak [56]. Several treatments for preconditioning of explants have been described, but the most commonly used is the preculture on media with high sucrose concentration. This kind of preculture has been applied to both shoot tips and embryogenic tissues of some Fagaceae species [58], although for some species preconditioning on media with the usual basal sucrose concentration of 0.09 M gave better regeneration frequencies [54]. In addition to the type of vitrification solution, the exposure time of samples to the solution is a main factor influencing the survival after plunging in LN [53]. An optimal incubation time is a compromise between the possible toxic effects of the solution and the need to replace water by the vitrification solution [38]. As consequence, specific vitrification protocols should be developed for each species and explant types. In order to guarantee true-to-type plant regeneration, microsatellites or simple sequence repeats (SSR) analyses have become popular standard techniques for assessing the genetic variation of the plant material that has been generated by

vegetative propagation [30,61] and stored in LN [13,18]. Primers for SSR loci have been developed for some Quercus species and the transferability of some of them to holm oak has been already proved in gene diversity and hybrids detection studies [49,50,31]. Cryopreservation is usually carried out by long-term cryostorage in LN. This implies the need of constantly replacing evaporated LN, which can be difficult at small or remote facilities and poses labour risks. With the increasing availability of ultra-low temperature freezers at decreasing prices, their use for storing cultures may be more economical and easier than cryogenic tanks with LN. Cryopreservation using these freezers at temperatures between 80 and 152 °C has been reported to maintain the biological activity of different living organisms, such as fungal pathogens [28], goat sperm cells [34], dog sperm cells [1], or human stem cells [14]. However, to our knowledge conservation of plant cells in ultra-low temperature freezers has not been reported yet. Cryopreservation of holm oak was attempted using zygotic embryo axes and a desiccation protocol at different cooling rates. Cryopreserved axes showed up to 15% shoot elongation, but no plantlets were recovered [15]. But to our knowledge neither cryopreservation nor its genetic evaluation has been carried out with embryogenic tissues of this species. Hence, the aim of this work is to develop vitrification protocols of embryogenic lines of holm oak, by studying the effect of preculture on medium with high sucrose concentration and determining the optimum time of incubation in the PVS2 vitrification solution both without (Experiment 1) and with cryopreservation in LN (Experiment 2). Studies were performed with explants both from solid and liquid cultures, and the genetic stability/fidelity of the cryopreserved materials assessed using microsatellite markers In addition, conservation of cryopreserved material in an ultra-low temperature freezer as an alternative for LN was evaluated (Experiment 3).

Material and methods Plant material and culture conditions Embryogenic lines were initiated from integuments of developing ovules of four trees (B6, E00 Q8 and E2) [3]. These trees are from two different Regions of Provenance in central Spain. Tree Q8 is growing in a natural stand in Quintos de Mora (Toledo); it is about 6 m high and 80 years-old and it was selected for high acorn production. Tree B6 is growing in a natural stand in Los Santos de la Humosa (Madrid); it is about 7 m high and 100 years-old. Trees E00 and E2 were planted in 1992 in the Experimental farm El Encín (Madrid), using acorns from the same Provenance Region; they are about 4 m high. The embryogenic lines were maintained for more than two years by secondary embryogenesis, by sequential subculture at 4-week intervals on a gelled basal medium (gelled-BM) consisting of SH macronutrients [48], MS micronutrients, vitamins and Fe-EDTA [36], supplemented with 0.09 M sucrose and 0.6% agar (B&V, PLANTAGAR S1000). This medium lacked plant growth regulators. The pH of the medium was adjusted to 5.7 before sterilisation by autoclaving at 121 °C for 20 min. Proliferating lines were cultured in darkness at 25 °C. Clusters of somatic embryos from line Q8 were used to establish cultures in liquid medium using a method based on Jiménez et al. (2013) [20] 6 months before the beginning of the cryopreservation experiments. The liquid medium (liquid-BM) had the same composition of gelled medium but lacked agar. Cultures were maintained by monthly subculture of inoculating a starting density of 8 gl 1 of the fraction comprised between 41 and 800 lm. Liquid cultures were in 150 ml Erlenmeyer flasks placed on rotary shakers at 110 rpm in a growth chamber with a 16 h photoperiod (50–60 lmol m 2 s 1) and 25 °C.

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006

A. Barra-Jiménez et al. / Cryobiology xxx (2015) xxx–xxx

To develop the vitrification protocols, two types of explants were used. Those from gelled-BM were clusters of globular secondary embryos collected from proliferating cultures 3 weeks after the last subculture. Each sample comprised 10 clusters. The explants from liquid-BM were cell clumps between 41 and 800 lm collected from liquid cultures 2 weeks after subculturing. Samples were 50 mg of these embryogenic clumps. Vitrification procedure Explant samples of three embryogenic lines (B6, E00, Q8) from gelled-BM, and embryogenic line Q8 from liquid-BM, were precultured on gelled-BM with the sucrose concentration at the usual level of 0.09 M or increased to 0.3 M for 3 days. Then, they were dehydrated in 2 ml cryovials (sample of 10 embryo clusters per vial, and sample of 50 mg embryogenic clumps per vial) containing 1.8 ml of PVS2 vitrification solution consisting of 30% w/v glycerol, 15% w/v DMSO (Me2SO) and 15% w/v ethylene glycol in liquid-BM containing 0.4 M sucrose [44]. After 0, 30, 60 or 90 min at 24 °C in PVS2 solution, the samples were washed and treated as described below (Experiment 1) or were resuspended in 0.6 ml of PVS2 and were then immersed into LN and maintained there for 24 h (Experiment 2). Thawing procedure Cryovials that underwent LN immersion were rapidly warmed by 2 min immersion in a 40 °C water bath and the PVS2 solution was drained off. The samples were then washed with liquid-BM supplemented with 1.2 M sucrose, with two changes of medium, each for 10 min, before being placed on filter paper discs on gelled-BM in 9 cm diameter Petri dishes. After 24 h, the samples were transferred, without any filter paper, to fresh proliferation medium (either gelled or liquid-BM), where they remained until they were evaluated for viability and resumption of embryogenesis. Further experiment Experiment 3 was carried out using the embryogenic lines B6, E00 and Q8 from gelled cultures. An additional line E2 was included. Samples of 10 globular embryo clusters were vitrified by means of a 3-days preculture on gelled-BM containing 0.3 M sucrose followed by 30 min incubation in PVS2. They were plunged into LN and then stored in a freezer at 80 °C for 4 weeks. As control, equal treatments were performed storing the samples in LN for also 4 weeks. For evaluation, samples were thawed and cultured as above. Evaluation of genetic stability during cryopreservation Samples of the proliferating embryogenic cultures (SE), suspension cultures of Q8 (S), and the cultures recovered from cryopreservation (Experiment 2) either on gelled medium (C) or as liquid cultures (CS) were examined to determine the genetic stability of the material. Genomic DNA was extracted from 150 mg of tissue when using the CTAB-based method [11], or 50 mg when E.Z.N.A.Ò SP Plant DNA kit (Omega Bio-tekÒ) was used. For the analysis, eight nuclear microsatellites were selected from those developed for Quercus (Table 1). Briefly, of all nSSRs, MSQ4 and MSQ13 were developed for Q. macrocarpa [10]. Three, ZAG9, ZAG15 and ZAG36, were first described by Steinkellner et al. (1997) for Q. petraea (Matts.) [51]; and the other three, ZAG7, ZAG11 and ZAG112, were first developed by Kamper et al. (1998) for Q. robur [22]. The transferability of eight of these loci

3

to Q. ilex has previously been already reported [49,50,31]. To amplify all the selected microsatellites by PCR, we used the primers designed by the authors. For each DNA sample, PCR amplification of each of the four microsatellite loci was performed in a total volume of 13 lL containing reaction buffer (QiagenÒ Multiplex PCR Catalog no. 206143), 1.5 pmol/L of each dNTP, 2 lL forward primer, 2 lL of reverse primer, 0.24 U of HotStarTaqÒ DNA polymerase (Qiagen), and 10.0 ng of DNA. The PCR profile was: an initial denaturation step of 94 °C for 15 min, two cycles of 94 °C for 45 s, 55 °C for 45 s, and 72 °C for 30 s, 10 touchdown cycles of 94 °C for 45 s, 52 °C for 45 s ( 0.5 °C per cycle), and 72 °C for 45 s, 20 cycles of 94 °C for 45 s, 49 °C for 45 s, and 72 °C for 30 s, and a final extension step of 72 °C for 4 min. Completed PCRs were electrophoresed and fragment lengths were determined with ±1 base accuracy using Beckman Coulter CEQ8000 Genetic Analysis System. Experimental design and statistical analysis Experiments 1 and 2 were completely randomised factorial designs testing simultaneously the effect of two main factors, sucrose concentration in the preculture (two levels: 0.09 M and 0.3 M) and time of incubation in PSV2 (four levels: 0, 30, 60 or 90 min), and their interaction, on viability and resumption of embryogenesis. Results of each genotype were analysed independently. For explants from gelled-BM, viability level was assessed by counting the explants (single embryo clusters) that showed new tissues arising from them, and expressed it as the percentage of explants within treatment that showed new growth after 4 weeks on proliferation medium. Resumption of embryogenesis was recorded when cotyledons differentiated from the new grown tissues; it was evaluated as the percentage of embryo clusters that developed cotyledonary embryos after 8 weeks of culture. For explants from liquid-BM, the viability level was assessed by weighing the sediment (fresh weight, FW) after 4 weeks in the proliferation medium and determining the fresh weight increase. This sediment was then recovered and cultured on gelled-BM for 4 additional weeks. Resumption of embryogenesis was recorded when the embryogenic clumps were able to differentiate cotyledons; it was evaluated as the percentage of samples that developed cotyledonary embryos at the end of this period. At least three samples (replicates) per treatment were used in each experiment, and each experiment was performed twice. Percentage data were subjected to arcsine transformation prior to analysis (data shown in the tables are all untransformed). The viability results were subjected to analysis of variance followed by mean comparison with the least significant difference (LSD) test at the P 6 0.05 level. Frequency data of resumption of embryogenesis were analysed through contingency tables and the Fisher’s exact test when the comparison was between two percentages and the Chi-square test when more percentages were compared. Results Embryogenic tissue from gelled medium The response of embryogenic clusters collected from gelled medium to both preculture on high-sucrose medium and dehydration by vitrification solution was highly dependent on genotype. Differences between genotypes for the recovery of embryogenic ability became more evident after LN treatment. Therefore, results of the three embryogenic lines were analysed independently. Morphologically, the explants that did not undergo immersion in LN (Experiment 1, Fig. 1A) grew and differentiated embryos

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006

4

A. Barra-Jiménez et al. / Cryobiology xxx (2015) xxx–xxx

Table 1 Characteristics of the microsatellites used in this study. Locus and microsatellite sequence

Forward primer

Reverse primer

Range of PCR product sizes (nt)

Source

MSQ4 (AGn) MSQ13 (TCn) ZAG9 (AG12) ZAG15 (AG23) ZAG36 (AG19) ZAG7 (TC17) ZAG11 (TC22) ZAG112 (GA32)

TCTCCTCTCCCCATAAACAGG TGGCTGCACCTATGGCTCTTAG GCAATTACAGGCTAGGCTGG CGATTTGATAATGACACTATGG GATCAAAATTTGGAATATTAAGAGAG CAACTTGGTGTTCGGATCAA CCTTGAACTCGAAGGTGTCCTT TTCTTGCTTTGGTGCGCG

GTTCCTCTATCCAATCAGTAGTGAG ACACTCAGACCCACCATTTTTCC GTCTGGACCTAGCCCTCATG CATCGACTCATTGTTAAGCAC ACTGTGGTGGTGAGTCTAACATGTAG GTGCATTTCTTTTATAGCATTCAC GTAGGTCAAAACCATTGGTTGACT GTGGTCAGAGACTCGGTAAGTATTC

203–227 222–246 182–210 108–152 210–336 115–153 238–267 85–96

[10] [10] [51] [51] [51] [22] [22] [22]

A

B

Fig. 1. Growth recovery and resumption of embryogenesis (differentiation of cotyledonary embryos from new nodular masses of tissues) of the B6 embryogenic line from gelled medium precultured with 0.3 M sucrose and dehydrated with the PVS2 solution, without (A) and with (B) freezing in LN, after 8 weeks of culture on gelled-BM (recovery medium).

similarly to the observed in maintenance cultures [3]. However, after LN immersion and rewarming (Experiment 2) explants became brownish and growth resumption took place from these necrotic structures, producing new yellowish globular structures that kept the cyclic proliferation state of the cultures. When differentiation occurred, cotyledonary embryos arose from those structures (Fig. 1B). When embryogenic tissues did not undergo freezing (Experiment 1), the viability of explants after preculture and PVS2 treatments ranged between 70% and 100% depending on genotype. Preculture on high-sucrose medium had a significant effect on the viability of two of the three tested lines, enhancing in the case of genotype B6 and decreasing in Q8 (Table 2). The effect of the time of incubation in the vitrification solution also depended on genotype. While it had no effect in genotype B6, longer incubation periods reduced the viability of explants of the other two genotypes (Table 2). There was no interaction between preculture and dehydration time, except for genotype E00, in which the reduction of explant viability occurred with longer periods of PVS2 exposure in explants precultured on high-sucrose medium. Regarding embryogenesis resumption, the tested lines also behaved differently. Neither the high-sucrose preculture medium nor the treatment with the PVS2 solution, affected the ability to differentiate cotyledonary embryos of genotype E00 (Fig. 2). However, decreasing percentages of differentiation were observed with longer incubation times in PVS2 for the other two lines. This trend was less pronounced in genotype Q8 when explants were precultured on high-sucrose medium. Nevertheless, this positive effect was not observed in genotype B6 (Fig. 2). When embryogenic tissues were frozen (Experiment 2), a reduction of viability was observed, even though more than two third of the explants recovered growth after thawing. Significant effects of the preculture on high-sucrose medium and the incubation time in PVS2 were not observed in any of the tested genotypes (Table 2). However, differences between genotypes were much more striking

Table 2 Effect of the preculture on medium with high sucrose concentration and dehydration with different incubation times in PVS2 solution on the viability of holm oak embryogenic clusters collected from semisolid medium. Viability is given as percentage (%) of explants that showed new arising tissues after 4 weeks of culture on gelled-BM. Six samples were included in each treatment, and each sample comprised 10 explants. Data are mean values of viability associated to each factor level from ANOVA for each one of the tested genotypes (B6, E00 and Q8), without freezing (Experiment 1) and after immersion in LN and thawing (Experiment 2). Without freezing

After freezing

B6

E00

Q8

B6

E00

Q8

Preculture Sucrose 0.09 M Sucrose 0.30 M

74 93

98 96

97 89

70 80

78 80

80 86

Dehydration PSV2 0 min PSV2 30 min PSV2 60 min PSV2 90 min

82 86 85 82

100 100 82 91

100 91 97 84

66 76 80 78

87 77 81 71

80 95 79 78

*

ns

*

ns ns

**

*

**

ns

ns ns ns

ns ns ns

ns ns ns

Significance1 Preculture Dehydration Preculture  dehydration ns = not significant. 1 ANOVA. * P 6 0.05. ** P 6 0.01.

for the differentiation capacity. Genotype E00 lost completely the ability to differentiate cotyledonary embryos, whereas Q8 and B6 considerably reduced it (Fig. 2). Both preculture on high-sucrose medium and time of incubation in PVS2 did not affect the frequencies of differentiation of genotype B6. However, 30 min of incubation in the vitrification solution significantly increased the percentage of explants of genotype Q8 that formed cotyledonary embryos, especially when they were precultured on high-sucrose medium (Fig. 2).

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006

A. Barra-Jiménez et al. / Cryobiology xxx (2015) xxx–xxx

5

preculture medium on the FW increase was observed. However, the time of incubation in the vitrification solution had a significant effect on the growth ability, by reducing the proliferation as the time increased (Table 3). Neither the preculture on the highsucrose medium nor the time of incubation in the PVS2 solution had significant effects on the ability to differentiate cotyledonary embryos. When embryogenic tissues were frozen (Experiment 2), there was not an important reduction in the ability to recover growth, multiplying the inoculated weight by a factor similar to that observed in the not frozen cultures (Table 3). However, these tissues were unable to differentiate cotyledonary embryos. Conservation of cryopreserved material in an ultra-low temperature freezer The percentages of growth recovery after the conservation of LN-treated tissues in a freezer at 80 °C during 4 weeks was very high for all the tested genotypes, ranging from 75% to 100% (Table 4). No significant differences between storage in LN and in freezer were recorded for most of the genotypes, except line E2 in which higher viability was obtained when it was stored in the freezer. In spite of the good growth recovery, differentiation of cotyledonary embryos was not obtained in any of the embryogenic lines, both stored in LN as in freezer. Evaluation of genetic stability during cryopreservation The amplification of all of the SSR markers produced 276 fragments/alleles that ranged from 84 (primer ZAG112) to 267 (ZAG11) in size (Table 5) [39]. All the allele sizes were within the given values described in the literature for the given species. When samples taken prior to and after cryopreservation were compared, some genetic differences were observed. Genotype B6 presented allelic variations in five loci, E00 in two; while in Q8 no variations were detected, revealing that there is a relationship between the genetic stability and the genotype. Suspension cultures of Q8 were assumed to be stable since no variation was detected in the samples prior or after cryopreservation.

Fig. 2. Effect of preculture on medium with increased sucrose concentration and dehydration with different incubation times in PVS2 vitrification solution on the resumption of embryogenesis of holm oak embryogenic lines B6, E00 and Q8, collected from gelled medium. Resumption of embryogenesis is given as percentage (%) of explants (out of 36 per treatment) that showed cotyledonary embryos after 4 weeks of culture on gelled-BM. Data are from experiments without freezing (Experiment 1) and after immersion in LN and thawing (Experiment 2).

Embryogenic tissue from liquid medium The embryogenic clumps of genotype Q8 collected from suspension cultures, which underwent treatments with high sucrose and vitrification solution but not LN immersion, grew and differentiated embryos similarly to the embryogenic clusters from gelled medium (Experiment 1, Fig. 3A). After LN immersion and rewarming (Experiment 2), growth resumption took place from necrotic structures as happened with explants from gelled medium, although no differentiation was observed (Fig. 3B). After preculture and PVS2 treatments, embryogenic tissues that did not undergo freezing (Experiment 1) continued growing, multiplying the inoculation FW by more than 3 times after 4 weeks in suspension culture. No significant effect of the high sucrose

Discussion Cryopreservation of holm oak embryogenic tissues has been achieved for the first time. Overall, holm oak tissues showed good tolerance to the osmotic stress and dehydration caused by the preculture on high-sucrose medium and the incubation in the vitrification solution PVS2, respectively. Explants from both gelled medium and liquid medium showed high frequencies of growth recovery and multiplication rate, respectively. These results are very similar to those obtained in the closely related species Quercus suber, in which almost all explants from three embryogenic lines continued growing after preculture on high-sucrose medium and PVS2 treatments [56]. After freezing and thawing, frequencies of growth recovery and multiplication rate of holm oak embryogenic tissues were high as well, also matching the cork oak results [56]. No major differences of growth recovery were observed between the three tested genotypes of this study, as it happened in cork oak [56]. However, genotypic differences in the tolerance of osmotic stress in holm oak cannot be ruled out, because clear genotypic differences were observed in the recovery frequencies (18–100%) when a larger number of genotypes were used in the establishment of a cryopreserved cork oak gene bank [58].

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006

6

A. Barra-Jiménez et al. / Cryobiology xxx (2015) xxx–xxx

A

B

Fig. 3. Growth recovery and resumption of embryogenesis (differentiation of cotyledonary embryos from embryogenic clumps) of the Q8 embryogenic line from liquid medium precultured with 0.3 M sucrose and dehydrated with the PVS2 solution, without (A) and with (B) freezing in LN, after 8 weeks of culture on gelled-BM (recovery medium). Frozen tissues proliferated after thawing but lost the differentiation ability.

Table 3 Effect of preculture on medium with high sucrose concentration and dehydration with different incubation times in PVS2 solution on the viability and resumption of embryogenesis of holm oak embryogenic line Q8 collected from liquid medium. Viability is given as the increase in fresh weight (DFW, mg) of the 50 mg samples after 4 weeks of culture in liquid-BM, and resumption of embryogenesis as percentage (%) of samples that developed cotyledonary embryos after 4 weeks of culture on gelledBM. Six samples were included in each treatment. Viability data are mean values associated to each factor level from ANOVA, without freezing (Experiment 1) and after immersion in LN and thawing (Experiment 2). Data on resumption of embryogenesis are frequencies of embryogenic clumps out of 36 explants per treatment. Without freezing

After freezing

DFW (mg)

Embryogenic (%)

DFW (mg)

Embryogenic (%)

Preculture No (sucrose 0.09 M) Yes (sucrose 0.30 M)

173 159

20.8 17.4

155 147

0 0

Dehydration PSV2 0 min PSV2 30 min PSV2 60 min PSV2 90 min

206 178 121 157

8.3 0.0 54.5 16.7

163 148 154 139

0 0 0 0

ns

ns ns –

ns ns ns

ns ns –

Significance1 Preculture Dehydration Preculture  dehydration

**

ns

ns = not significant. 1 ANOVA for DFW; Fisher’s exact test (preculture) and v2 (dehydration) for % embryogenic. ** P 6 0.01.

Table 4 Effect of the storage system (LN immersion vs preservation in an ultralow freezer at 80 °C) during 4 weeks on the viability of four holm oak embryogenic lines (B6, E00, E2, Q8) collected from gelled medium. Six samples were included in each treatment. Viability is given as percentage (%) of explants that showed new arising tissues after 4 weeks of culture on gelled-BM. Viability data are mean values from ANOVA. Storage

B6

E00

E2

Q8

Liquid Nitrogen Ultralow freezer Significance1 Storage system

87 75

98 100

33 95

100 100

ns

ns

***

ns

ns = not significant. 1 ANOVA. *** P 6 0.001.

Despite the good growth recovery observed in holm oak embryogenic tissues, both from gelled and liquid medium, the

differentiation of cotyledonary embryos was detrimentally affected by the incubation in the PVS2 solution, especially after immersion into LN and when using samples from liquid cultures. This result is in sharp discrepancy with the observations made in other oak species in which all the recovered explants were able to differentiate embryos [58,8]. This fact may be related to the high instability shown by holm oak embryogenic lines to conserve the differentiation ability during the recurrent proliferation on maintenance medium. While almost all cork oak and pedunculate oak embryogenic lines can be maintained by monthly subculture without losing the embryogenic ability for years [59], most holm oak embryogenic lines lost the ability to differentiate cotyledonary embryos very quickly [3]. The microsatellite analysis revealed genetic variation in the cryopreserved samples of the embryogenic tissues from the gelled cultures. However, there were differences between the cryopreserved lines that pointed to a genotypic effect and it may be related to the rates of differentiation capacity registered after the cryopreservation of embryogenic tissues. The loss of the differentiation capacity might also be related to the instability of the lines, since the cryopreserved samples of both B6 and E00 presented over two mutated allele at more than 2 different loci. In Quercus robur, a genotypic effect in the microsatellite instability during SE was observed by Wilhelm (2005) [61], but the RAPD analysis of the regenerated plantlets from cryopreserved tissues did not showed genetic differences [46]. Fernandes et al. (2008) [13] reported no changes in the ploidy and SSR in the cryopreserved samples of Q. suber, although the AFLP analyses detected otherwise. The genetic data showed that the genetic stability is affected by cryopreservation protocols depending on the genotype, and the type of culture (liquid vs. semisolid). Some authors have suggested the hypothesis that there is a relationship between the detected genetic variation and the differentiation capacity [45,5]. We cannot, however confirm it with the present material because no changes were detected in the SSR amplification of the suspension cultures; and the line B6 showing most variation was yet able to produce cotyledonary embryos after LN immersion. The decrease of the embryo differentiation ability of holm oak lines may also have epigenetic basis. Several authors described changes at gene transcription level such as DNA methylation or histone modification linked to the embryogenic response [60], somatic embryo maturation [55] and complete somatic embryo development and conversion [37]. Such changes were also observed in the different steps of the cryopreservation procedure [17]. Epigenetic changes may occur during both the preculture

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006

7

A. Barra-Jiménez et al. / Cryobiology xxx (2015) xxx–xxx

Table 5 Microsatellite loci amplified in Quercus ilex. Allele sizes found in the samples of this study, with the mutated samples shown separately. The range of the observed allele size in the other studies are from Lumaret and Jabbour-Zahab [31]; Ortego and Bonal [39] and Soto et al. [49], Soto et al. [50]. SE = sample of embryogenic culture prior to cryopreservation, S = samples of suspension culture prior to cryopreservation, C = cryopreserved sample, CS = cryopreserved sample from suspension culture.

1

Genotype

B6

Loci

Sample

Sample alleles

E00 Sample

Sample alleles

Q8 Sample

Sample alleles

Allele size (bp) in other publications

MSQ4

SE C

185/196 196/196

SE SE C

195/195 1961/1961 186/196

SE, S, C, CS

195/195

193–215

MSQ13

SE, C

200/210

SE C

200/200 186/200

SE, S, C, CS

200/205

190–220

ZAG9

SE C C

233/247 185/234 2341/247

SE, C

243/250

SE, S, C, CS

244/249

219–261

ZAG15

SE, C

113/121

SE, C

127/135

SE, S, C, CS

113/133

108–145

ZAG36

SE, C C

202/218 202/222

SE, C

202/218

SE, S, C, CS C

202/216 2031/216

197–251

ZAG7

SE, C C

113/113 113/115

SE, C

113/115

SE, S, C, CS

113/115

114–147

ZAG11

SE C C

264/264 2651/2651 267/267

SE, C

262/262

SE, S, C, CS

265/265

244–304

ZAG112

SE, C

84/84

SE, C

84/84

SE, S, C, CS

90/96

80–112

The measurement accuracy of the method used is ±1 base, i.e. 1 base difference cannot be interpreted as confirmed mutation.

phase [32] and the treatment with the vitrification solution [19]. If they have contributed to the loss of embryogenic competence of cryopreserved holm oak lines, remains to be studied. The effect of the preculture on high-sucrose medium and the incubation time in PVS2 on the growth recovery of non-frozen tissues strongly depended on genotype. This genotypic effect was also observed in Liriodendron tulipifera and Liquidambar spp. embryogenic cultures [57]. Regarding the preconditioning of explants, preculture on highsucrose medium has been routinely used to cryopreserve several Quercus species [33,56,46]. In other species, high concentrations of sugar alcohols such as sorbitol were used [57]. These higher solute concentrations enhance the accumulation of endogenous cryoprotectants (sugars, sugar alcohols and proline) that may increase the stability of the membranes and, in addition, the inner osmolality reduces the possibility of ice nucleation inside the cells. However, in other species the usual basal sucrose concentrations rendered better growth recovery results than increased sucrose concentrations, as shown in Carica papaya shoot tips [54]. When this factor was tested in holm oak, a significant effect was recorded in two out of the three tested genotypes in a contrasting way, although both the increase and the decrease of the frequencies of growth recovery were low. However, since a positive influence of the preculture on high-sucrose medium on the differentiation ability of one of the genotypes and no detrimental effects of this preconditioning were observed, it is advisable to maintain this treatment for holm oak cryopreservation. The dehydration treatment with the PVS2 solution of nonfrozen tissues had also different effects on growth recovery dependent on the genotype. Longer incubation times did not modify the growth recovery of one of the genotypes, as occurred in other species such as Aesculus hippocastanum [26]. Whereas the other two genotypes, one of them from both gelled and liquid medium, followed the pattern widely observed in many species. The vitrification solution increases dehydration and cell viscosity inhibiting the ice formation, but it can also be toxic [43]. In these holm oak genotypes, extending incubation times reduced growth recovery, likely due to chemical toxicity and hyper-osmotic effects of PVS2 solution. These differences between genotypes could be caused by differences in the nature of embryogenic tissues, mostly related

to the proportion of hyperhydric vacuolated cells within them [26]. When tissues were frozen, no significant effects of any of the two tested factors on the growth recovery were recorded regardless genotype or explant source, which highlights the great tolerance of the holm oak embryogenic lines to cryopreservation procedures. Genotype also played a main role in preserving the embryo differentiation ability. When explants did not undergo freeze, genotype E00 was insensitive to both preculture on high-sucrose medium and time of incubation in PSV2. Meanwhile, the other two genotypes showed decreasing differentiation ability with the incubation time in PVS2 and unclear effect of the preconditioning with the higher sucrose concentration. After freezing and thawing, the differentiation ability was markedly reduced, as genotype E00 completely lost it. Preconditioning with higher sucrose concentration and PVS2 treatments did not affect genotype B6, whereas an improving effect of the vitrification solution together with the preculture on high-sucrose medium was observed in genotype Q8. As it has been mentioned before, our results may subscribe to the affirmation that the yield of cotyledonary embryos was positively correlated with genetic stability [5], or could also be considered as the relationship between genotype and genomic methylation and their combined influence into embryo differentiation [42]. Thus, different genotypes may have suffered different epigenetic changes in response to stress during cryopreservation, which would influence their embryogenicity, but it remains to be confirmed. The dramatic differences observed between explants from gelled and liquid medium of genotype Q8 could be ascribed to their different starting hydric status [26]. The 4-weeks storage, both in LN and in an ultra-low freezer at 80 °C caused the loss of differentiation ability of all the tested lines, although all of them showed high frequencies of growth recovery. Cryopreservation can cause stress-induced factors not only in the cryotreatment and thawing, but also during cryostorage, which may alter the morphogenic functionalities [35]. Most studies state that cryopreservation does not affect the differentiation ability of embryogenic tissues, and even report the enhancement of the embryogenic potential [35]. However, there are some authors that described the loss of this potential. In a transgenic Liquidambar styraciflua embryogenic line, which retained GUS expression following regrowth, no mature somatic embryos

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006

8

A. Barra-Jiménez et al. / Cryobiology xxx (2015) xxx–xxx

could be regenerated from it [57]. In addition, the storage in LN may change some characteristics of the cryopreserved material. In Abies cephalonica, the proliferation of a long-term cryostoraged embryogenic line was not as fast as when a 7-day period of cryopreservation was carried out using the same methodology. Moreover, a short transient lag phase after long-term cryostorage was observed in another line that was not monitored after the 7day period of cryopreservation [2,25]. In Abies alba, twelve embryogenic lines belonging to two half-sib families were longterm cryopreserved. After 6 years in LN, just one third of them recovered growth, and only two were able to differentiate embryos [24]. In tomato, modifications in the phenolic content were observed after different periods of days in LN, although neither germination nor phenotypic variations were recorded [62]. Therefore, although ultralow temperatures arrest metabolic processes, some changes may happen with time in storage that caused the observed loss of differentiation ability. Although the first two experiments and the 4-week-storage experiment took place within 4 months, the time lapse was long enough to consider it also as a factor in the reduction of embryogenic competence of the cultures after 4-weeks of cryostorage. In Scots pine, Latutrie and Aronen [27] observed that the status of the embryogenic cultures prior to cryopreservation affected the mature embryo production after the LN immersion. This potential cause of loss of differentiation should not be ruled out, since it has been reported before that the loss of differentiation of the holm oak embryogenic cultures may happen rapidly, i.e. within a month [3]. However, it should be kept in mind that the very same embryogenic lines are still maintained and they also produce cotyledonary embryos nowadays. In conclusion, holm oak embryogenic cultures can be cryopreserved without losing growth recover ability, even stored in an ultralow-temperature freezer instead of LN. However, the present results confirm that embryogenic system of this species shows instability to keep the capacity to differentiate embryos, and this instability was increased under the stressful conditions of cryopreservation. It would be recommendable to cryopreserve the cultures soon after their establishment to avoid differentiation problems related to culture ageing. Based on the microsatellite markers, the reduction of differentiation ability in the holm oak embryogenic cultures may also be related to genetic alterations taking place during cryopreservation. If also epigenetic or metabolic changes are involved, remains to be studied. Acknowledgments We would like to thank Aroa Albareda, Airi Huttunen, Annukka Korpijaakko, Katja Laukkanen, Paula Matikainen, Saila Varis and Aila Viinanen for the technical assistance. The research leading to these results has received funding from the Spanish Ministry of Science and Innovation (AGL2010-22292-C01 project) and the European Union’s Seventh Framework Programm for research, technological development and demonstration under grant agreement n° 284181 (‘‘Trees4Future’’). The contents of this publication reflect only the authors’ views and the European Union is not liable for any use that may be made of the information contained therein. This work was also supported by a postgraduate fellowship from IMIDRA to A. Barra-Jiménez and it is part of the requirements to fulfil A. Barra-Jiménez’s Ph.D. degree. References [1] D. Alamo, M. Batista, F. González, N. Rodríguez, G. Cruz, F. Cabrera, et al., Cryopreservation of semen in the dog: use of ultra-freezers of 152 °C as a viable alternative to liquid nitrogen, Theriogenology 63 (2005) 72–82, http:// dx.doi.org/10.1016/j.theriogenology.2004.03.016.

ˇ áková, H.M. Häggman, L.A. Ryynänen, Genetic fidelity of [2] T.S. Aronen, J. Krajn cryopreserved embryogenic cultures of open-pollinated Abies cephalonica, Plant Sci. 142 (1999) 163–172, http://dx.doi.org/10.1016/S01689452(98)00244-1. [3] A. Barra-Jiménez, M. Blasco, M. Ruiz-Galea, C. Celestino, J. Alegre, I. Arrillaga, et al., Cloning mature holm oak trees by somatic embryogenesis, Trees 28 (2014) 657–667, http://dx.doi.org/10.1007/s00468-014-0979-0. [4] M. Blasco, A. Barra-Jiménez, C. Brisa, E. Corredoira, J. Segura, M. Toribio, et al., Somatic embryogenesis in holm oak male catkins, Plant Growth Regul. 71 (2013) 261–270, http://dx.doi.org/10.1007/s10725-013-9826-3. [5] K. Burg, A. Helmersson, P. Bozhkov, S. von Arnold, Developmental and genetic variation in nuclear microsatellite stability during somatic embryogenesis in pine, J. Exp. Bot. 58 (2007) 687–698, http://dx.doi.org/10.1093/jxb/erl241. [6] F.S. Carevic Vergara, M. Fernández Martínez, R. Alejano Monje, J. Vázquez Piqué, R. Tapias, E. Corral, et al., Plant water relations and edaphoclimatic conditions affecting acorn production in a holm oak (Quercus ilex L. ssp. ballota) open woodland, Agrofor. Syst. 78 (2010) 299–308, http://dx.doi.org/ 10.1007/s10457-009-9245-7. [7] E. Corredoira, M.C. San José, A. Ballester, A.M. Vieitez, Cryopreservation of zygotic embryo axes and somatic embryos of european chestnut, CryoLetters 25 (2004) 33–42. [8] E. Corredoira, M. Toribio, A.M. Vieitez, Clonal propagation via somatic embryogenesis in Quercus spp., in: K.G. Ramawat, J.-M. Mérillon, M.R. Ahuja (Eds.), Tree Biotechnology, Taylor & Francis Group, 2014, pp. 262–302. [9] D.R. Cyr, Cryopreservation of embryogenic cultures of conifers and its application to clonal forestry, in: S.M. Jain, P.K. Gupta, R.J. Newton (Eds.), Somatic Embryogenesis in Woody Plants, Kluwer Academic Publishers, Dordrecht, 1999, pp. 239–261, http://dx.doi.org/10.1007/978-94-017-30327_10. [10] B.D. Dow, M.V. Ashley, H.F. Howe, Characterization of highly variable (GA/CT)n microsatellites in the bur oak, Quercus macrocarpa, Theor. Appl. Genet. 91 (1995) 137–141, http://dx.doi.org/10.1007/BF00220870. [11] J.J. Doyle, J.L. Doyle, A rapid DNA isolation procedure for small quantities of fresh leaf tissue, Phytochem. Bull. 19 (1987) 11–15. [12] F. Engelmann, Cryopreservation of embryos: an overview, in: T.A. Thorpe, E.C. Yeung (Eds.), Plant Embryo Culture: Methods and Protocols, Methods in Molecular Biology, Springer, Totowa, NJ, 2011, pp. 155–184, http://dx.doi.org/ 10.1007/978-1-61737-988-8_13. [13] J.P.V. Fernandes, E. Rodriguez, G. Pinto, I. Roldán-Ruiz, M. de Loose, C. dos Santos, Cryopreservation of Quercus suber somatic embryos by encapsulationdehydration and evaluation of genetic stability, Tree Physiol. 28 (2008) 1841– 1850. [14] A. Galmes, A. Gutierrez, A. Sampol, M. Canaro, M. Morey, J. Iglesias, et al., Longterm hematologic reconstitution and clinical evaluation of autologous peripheral blood stem cell transplantation after cryopreservation of cells with 5% and 10% dimethylsulfoxide at 80 °C in a mechanical freezer, Haematologica 92 (2007) 986–989, http://dx.doi.org/10.3324/ haematol.11060. [15] M.E. González-Benito, R. Moreno Prieto, E. Herradon, C. Martín, Cryopreservation of Quercus suber and Quercus ilex embryonic axes: in vitro culture, desiccation and cooling factors, CryoLetters 23 (2002) 283–290. [16] H.M. Häggman, T.S. Aronen, L.A. Ryynänen, Cryopreservation of embryogenic cultures of conifers, in: Somatic Embryogenesis in Woody Plants, Springer, Dordrecht, Netherlands, 2000, pp. 707–728, http://dx.doi.org/10.1007/978-94017-3030-3_26. [17] Y.-J. Hao, C.-X. You, X.-X. Deng, Analysis of ploidy and the patterns of amplified fragment length polymorphism and methylation sensitive amplified polymorphism in strawberry plants recovered from cryopreservation, CryoLetters 23 (2002) 37–46. [18] T. Hazubska-Przybył, P. Chmielarz, M. Michalak, M. Dering, K. Bojarczuk, Survival and genetic stability of Picea abies embryogenic cultures after cryopreservation using a pregrowth-dehydration method, Plant Cell Tiss. Organ Cult. 113 (2013) 303–313, http://dx.doi.org/10.1007/s11240-012-0270-2. [19] A.S. Heringer, D.A. Steinmacher, H.P.F. Fraga, L.N. Vieira, J.F. Ree, M.P. Guerra, Global DNA methylation profiles of somatic embryos of peach palm (Bactris gasipaes Kunth) are influenced by cryoprotectants and droplet-vitrification cryopreservation, Plant Cell Tiss. Organ Cult. 114 (2013) 365–372, http:// dx.doi.org/10.1007/s11240-013-0331-1. [20] J.A. Jiménez, D. López-Vela, M. Ruiz-Galea, C. Celestino, M. Toribio, J. Alegre, Embryogenic suspensions of adult cork oak: the first step towards mass propagation, Trees 27 (2013) 13–23, http://dx.doi.org/10.1007/s00468-0120763-y. [21] J. Jörgensen, Cryopreservation of haploid embryos of Quercus petraea, Fagus sylvatica and somatic embryos of Aesculus hippocastanum, in: Woody Plant Biotechnology, Springer, Boston, MA, US, 1992, pp. 355–356, http://dx.doi.org/ 10.1007/978-1-4684-7932-4_45. [22] S. Kampfer, C. Lexer, J. Glössl, H. Steinkellner, Characterization of (GA)n microsatellite loci from Quercus robur, Hereditas 129 (1998) 183–186, http:// dx.doi.org/10.1111/j.1601-5223.1998.00183.x. [23] L. Kong, P. von Aderkas, A novel method of cryopreservation without a cryoprotectant for immature somatic embryos of conifer, Plant Cell Tiss. Organ Cult. 106 (2011) 115–125, http://dx.doi.org/10.1007/s11240-010-9899-x. [24] J. Krajnˇáková, A. Bertolini, D. Gömöry, A. Vianello, H.M. Häggman, Initiation, long-term cryopreservation, and recovery of Abies alba Mill. Embryogenic cell lines, In Vitro Cell. Dev. Biol. Plant 49 (2013) 560–571, http://dx.doi.org/ 10.1007/s11627-013-9512-1.

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006

A. Barra-Jiménez et al. / Cryobiology xxx (2015) xxx–xxx [25] J. Krajnˇáková, S. Sutela, T.S. Aronen, D. Gömöry, A. Vianello, H.M. Häggman, Long-term cryopreservation of Greek fir embryogenic cell lines: recovery, maturation and genetic fidelity, Cryobiology 63 (2011) 17–25, http:// dx.doi.org/10.1016/j.cryobiol.2011.04.004. [26] M. Lambardi, A. De Carlo, M. Capuana, Cryopreservation of embryogenic callus of Aesculus hippocastanum L. by vitrification or one-step freezing, CryoLetters 26 (2005) 185–192. [27] M. Latutrie, T.S. Aronen, Long-term cryopreservation of embryogenic Pinus sylvestris cultures, Scand. J. For. Res. 28 (2013) 103–109, http://dx.doi.org/ 10.1080/02827581.2012.701325. [28] D.E. Legard, C.K. Chandler, Cryopreservation of strawberry pathogens in a 95 °C mechanical ultra-low temperature freezer, Hort. Science. CryoLetters 35 (2000) 1357. [29] M.-A. Lelu-Walter, D. Thompson, L. Harvengt, L. Sánchez, M. Toribio, L.E. Pâques, Somatic embryogenesis in forestry with a focus on Europe: state-ofthe-art, benefits, challenges and future direction, Tree Genet. Genomes 9 (2013) 883–899, http://dx.doi.org/10.1007/s11295-013-0620-1. [30] T. Lopes, G. Pinto, J. Loureiro, A. Costa, C. dos Santos, Determination of genetic stability in long-term somatic embryogenic cultures and derived plantlets of cork oak using microsatellite markers, Tree Physiol. 26 (2006) 1145–1152, http://dx.doi.org/10.1093/treephys/26.9.1145. [31] R. Lumaret, R. Jabbour-Zahab, Ancient and current gene flow between two distantly related Mediterranean oak species, Quercus suber and Q. ilex, Ann. Bot. 104 (2009) 725–736, http://dx.doi.org/10.1093/aob/mcp149. [32] C. Martín, M.T. Cervera, M.E. González-Benito, Genetic stability analysis of chrysanthemum (Chrysanthemum x morifolium Ramat) after different stages of an encapsulation-dehydration cryopreservation protocol, J. Plant Physiol. 168 (2011) 158–166, http://dx.doi.org/10.1016/j.jplph.2010.06.025. [33] M.T. Martínez, A. Ballester, A.M. Vieitez, Cryopreservation of embryogenic cultures of Quercus robur using desiccation and vitrification procedures, Cryobiology 46 (2003) 182–189, http://dx.doi.org/10.1016/S00112240(03)00024-5. [34] A. Medrano, F. Cabrera, F. González, M. Batista, A. Gracia, Is sperm cryopreservation at 150 °C a feasible alternative?, CryoLetters 23 (2002) 167–172 [35] A. Mikuła, K. Tomiczak, J.J. Rybczyn´ski, Cryopreservation enhances embryogenic capacity of Gentiana cruciata (L.) suspension culture and maintains (epi)genetic uniformity of regenerants, Plant Cell Rep. 30 (2011) 565–574, http://dx.doi.org/10.1007/s00299-010-0970-1. [36] T. Murashige, F. Skoog, A revised medium for rapid growth and bio assays with tobacco tissue cultures, Physiol. Plant. 15 (1962) 473–497, http://dx.doi.org/ 10.1111/j.1399-3054.1962.tb08052.x. [37] G.I. Nic-Can, A. López-Torres, F.A. Barredo-Pool, K. Wrobel, V.M. Loyola-Vargas, R. Rojas-Herrera, et al., New insights into somatic embryogenesis: LEAFY COTYLEDON1, BABY BOOM1 and WUSCHEL-RELATED HOMEOBOX4 are epigenetically regulated in Coffea canephora, PLoS ONE 8 (2013) e72160, http://dx.doi.org/10.1371/journal.pone.0072160. [38] T. Niino, A. Sakai, H. Yakuwa, K. Nojiri, Cryopreservation of in vitro-grown shoot tips of apple and pear by vitrification, Plant Cell Tiss. Organ Cult. 28 (1992) 261–266, http://dx.doi.org/10.1007/BF00036122. [39] J. Ortego, R. Bonal, Natural hybridisation between kermes (Quercus coccifera L.) and holm oaks (Q. ilex L.) revealed by microsatellite markers, Plant Biol. 12 (2010) 234–238, http://dx.doi.org/10.1111/j.1438-8677.2009.00244.x. [40] B. Panis, M. Lambardi, Status of cryopreservation technologies in plants (crops and forest trees), in: The Role of Biotechnology in Exploring and Protecting Agricultural Genetic Resources, FAO, Villa Gualino, Rome, Italy, 2005, pp. 61–78. [41] T. Pinto-Correia, L. Kristensen, Linking research to practice: the landscape as the basis for integrating social and ecological perspectives of the rural, Landscape Urban Plann. 120 (2013) 248–256, http://dx.doi.org/10.1016/ j.landurbplan.2013.07.005. [42] A. Rival, P. Ilbert, A. Labeyrie, E. Torres, S. Doulbeau, A. Personne, et al., Variations in genomic DNA methylation during the long-term in vitro proliferation of oil palm embryogenic suspension cultures, Plant Cell Rep. 32 (2013) 359–368, http://dx.doi.org/10.1007/s00299-012-1369-y. [43] A. Sakai, F. Engelmann, Vitrification encapsulation-vitrification and dropletvitrification: a review, CryoLetters 28 (2007) 151–172. [44] A. Sakai, S. Kobayashi, I. Oiyama, Cryopreservation of nucellar cells of navel orange (Citrus sinensis Osb. var. brasiliensis Tanaka) by vitrification, Plant Cell Rep. 9 (1990) 30–33.

9

[45] M.C. Sánchez, M.T. Martínez, S. Valladares, E. Ferro, A.M. Vieitez, Maturation and germination of oak somatic embryos originated from leaf and stem explants: RAPD markers for genetic analysis of regenerants, J. Plant Physiol. 160 (2003) 699–707. [46] M.C. Sánchez, M.T. Martínez, N. Vidal, M.C. San José, S. Valladares, A.M. Vieitez, Preservation of Quercus robur germplasm by cryostorage of embryogenic cultures derived from mature trees and RAPD analysis of genetic stability, CryoLetters 29 (2008) 493–504. [47] P. Savill, P. Kanowski, Tree improvement programs for European oaks: goals and strategies, Ann. For. Sci. 50 (1993) 368s–383s. [48] R.U. Schenk, A.C. Hildebrandt, Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures, Can. J. Bot. 50 (1972) 199–204, http://dx.doi.org/10.1139/b72-026. [49] Á. Soto, Z. Lorenzo, L.A. Gil Sánchez, Nuclear microsatellite markers for the identification of Quercus ilex L. and Q. suber L. hybrids, Silvae Genetica 52 (2003) 63–66. [50] Á. Soto, Z. Lorenzo, L.A. Gil, Differences in fine-scale genetic structure and dispersal in Quercus ilex L. and Q. suber L.: consequences for regeneration of mediterranean open woods, Heredity 99 (2007) 601–607, http://dx.doi.org/ 10.1038/sj.hdy.6801007. [51] H. Steinkellner, S. Fluch, E. Turetschek, C. Lexer, R. Streiff, A. Kremer, et al., Identification and characterization of (GA/CT)n-microsatellite loci from Quercus petraea, Plant Mol. Biol. 33 (1997) 1093–1096. [52] L.M. Suz, M.P. Martín, D. Oliach, C.R. Fischer, C. Colinas, Mycelial abundance and other factors related to truffle productivity in Tuber melanosporumQuercus ilex orchards, FEMS Microbiol. Lett. 285 (2008) 72–78, http:// dx.doi.org/10.1111/j.1574-6968.2008.01213.x. [53] M. Suzuki, P. Tandon, M. Ishikawa, T. Toyomasu, Development of a new vitrification solution, VSL, and its application to the cryopreservation of gentian axillary buds, Plant Biotechnol. Rep. 2 (2008) 123–131, http:// dx.doi.org/10.1007/s11816-008-0056-5. [54] S.-F. Tsai, S.-D. Yeh, C.-F. Chan, S.-I. Liaw, High-efficiency vitrification protocols for cryopreservation of in vitro grown shoot tips of transgenic papaya lines, Plant Cell Tiss. Organ Cult. 98 (2009) 157–164, http://dx.doi.org/10.1007/ s11240-009-9548-4. [55] D. Uddenberg, S. Valladares, M. Abrahamsson, J.F. Sundström, A. SundåsLarsson, S. von Arnold, Embryogenic potential and expression of embryogenesis-related genes in conifers are affected by treatment with a histone deacetylase inhibitor, Planta 234 (2011) 527–539, http://dx.doi.org/ 10.1007/s00425-011-1418-8. [56] S. Valladares, M. Toribio, C. Celestino, A.M. Vieitez, Cryopreservation of embryogenic cultures from mature Quercus suber trees using vitrification, CryoLetters 25 (2004) 177–186. [57] W.A. Vendrame, C.P. Holliday, P.M. Montello, D.R. Smith, S.A. Merkle, Cryopreservation of yellow-poplar and sweetgum embryogenic cultures, New Forest. 21 (2001) 283–292. [58] N. Vidal, A.M. Vieitez, M.R. Fernández, B. Cuenca, A. Ballester, Establishment of cryopreserved gene banks of European chestnut and cork oak, Eur. J. Forest Res. 129 (2010) 635–643, http://dx.doi.org/10.1007/s10342-010-0364-5. [59] A.M. Vieitez, E. Corredoira, M.T. Martínez, M.C. San José, M.C. Sánchez, S. Valladares, et al., Application of biotechnological tools to Quercus improvement, Eur. J. Forest Res. 131 (2012) 519–539, http://dx.doi.org/ 10.1007/s10342-011-0526-0. [60] M. Viejo, R. Rodriguez, L. Valledor, M. Pérez, M.J. Cañal, R. Hasbún, DNA methylation during sexual embryogenesis and implications on the induction of somatic embryogenesis in Castanea sativa Miller, Sex. Plant Reprod. 23 (2010) 315–323, http://dx.doi.org/10.1007/s00497-010-0145-9. [61] E. Wilhelm, K. Hristoforoglu, S. Fluch, K. Burg, Detection of microsatellite instability during somatic embryogenesis of oak (Quercus robur L.), Plant Cell Rep. 23 (2005) 790–795, http://dx.doi.org/10.1007/s00299-004-0891-y. [62] B. Zevallos, I. Cejas, B. Valle, L. Yabor, C. Aragón, Short-term liquid nitrogen storage of wild tomato (Solanum lycopersicum Mill.) seeds modifies the levels of phenolics in 7 day-old seedlings, Sci. Hortic. 160 (2013) 264–267, http:// dx.doi.org/10.1016/j.scienta.2013.06.002.

Please cite this article in press as: A. Barra-Jiménez et al., Cryopreservation of embryogenic tissues from mature holm oak trees, Cryobiology (2015), http:// dx.doi.org/10.1016/j.cryobiol.2015.02.006