- Email: [email protected]
Cryopreservation of heat-shocked canine adipose-derived mesenchymal stromal cells with 10% dimethyl sulfoxide and 40% serum results in better viability, proliferation, anti-oxidation, and in-vitro differentiation
Cryobiology xxx (xxxx) xxx
Contents lists available at ScienceDirect
Cryobiology journal homepage: http://www.elsevier.com/locate/cryo
Cryopreservation of heat-shocked canine adipose-derived mesenchymal stromal cells with 10% dimethyl sulfoxide and 40% serum results in better viability, proliferation, anti-oxidation, and in-vitro differentiation Muhammad Afan Shahid, Wan Hee Kim, Oh-Kyeong Kweon * Research Institute for Veterinary Science and College of Veterinary Medicine Building 85, Room 623, Seoul National University, Gwanak-gu, Gwanak-ro 1, Seoul, 08826, South Korea
A R T I C L E I N F O
A B S T R A C T
Keywords: Mesenchymal stromal cells Heat shock treatment Hypoxia Cryopreservation Anti-oxidation In vitro differentiation
Cryopreserved canine adipose-derived mesenchymal stromal cells (Ad-MSCs) can be used instantly in dogs for clinical uses. However, cryopreservation results in a reduction of the cellular viability, proliferation, and antioxidation of post-thawed Ad-MSCs. Therefore, there is a need for in-vitro procedure to improve post-thawed Ad-MSCs’ viability, proliferation, anti-oxidation, and differentiation capacity. In this study, fresh-Ad-MSCs were activated with heat shock, hypoxia (5% O2), or hypoxia (5% O2) þ heat shock treatments. The results showed that compared to the other treatments, heat shock significantly improved the proliferation rate, antioxidation, heat shock proteins and growth factors expressions of canine-fresh-Ad-MSCs. Consequently, freshAd-MSCs were heat-shocked and then cryopreserved with different combinations of dimethyl sulfoxide (Me2SO) and fetal bovine serum (FBS) to determine the combination that could effectively preserve the cellular viability, proliferation, anti-oxidation and differentiation capacity of Ad-MSCs after cryopreservation. We found that C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS presented significantly (p < 0.05) improved cellular viability, proliferation rate, anti-oxidant capacity, and differentiation potential as compared to C-HSTAd-MSCs cryopreserved with 1% Me2SO þ 10% FBS or 1% Me2SO alone or control. We concluded, heat shock treatment is much better to enhance the characteristics of fresh-Ad-MSCs than other treatments, moreover, CHST-Ad-MSCs in 10% Me2SO þ 40% FBS showed better results compared to other cryopreserved groups. However, future work is required to optimize the expression of heat shock proteins, which would further improve the characteristics of fresh- and cryopreserved-HST-Ad-MSCs and reduce the dependency on Me2SO and FBS.
1. Introduction Adipose-derived mesenchymal stem cells are a well-established resource for tissue engineering and regenerative medicine applications for diabetes, spinal cord injury, stroke and myocardial infarction [26]. Various studies already suggested that, stem cells can be used in cell-based therapies to treat diseases of the bone [3], heart [30], kidney [9], and nervous system [22]. Among various types of stem cells, mesenchymal stem cells have been reported to be an effective source for these therapies because they are self-renewing, multipotent and possess
the ability to secrete cytokines and chemokines [13,42]. Moreover, Ad-MSCs were found to have several advantages over other stem cells in regard of their abundance, easy access with minimal invasion and yields a great number of cells on isolation [14]. Previously it was reported that stem cells could repair effected tissue by replacing damaged cells [16]. Furthermore, stem cells may indirectly repair the tissue by regulation of inflammatory and growth factors [7,18]. However, long-term culture of stem cells has raised biosafety concerns, such as the occurrence of chromosomal aberrations and spontaneous malignant transformations [11,31]. Henceforth, it is necessary to be able to stably store stem cells
Abbreviations: MSCs, Mesenchymal stem cells; Ad-MSCs, Adipose-derived mesenchymal stromal cells; HSP, Heat shock protein; HST-Ad-MSCs, Heat shock treatedAdipose-derived mesenchymal stromal cells; F-HST-Ad-MSCs, Fresh-Heat shock treated-Adipose-derived mesenchymal stromal cells; C-HST-Ad-MSCs, CryopreservedHeat shock treated-Adipose-derived mesenchymal stromal cells; HT-Ad-MSCs, Hypoxia-treated-Adipose-derived mesenchymal stromal cells; HT þ HST-Ad-MSCs, Hypoxia treatment and heat shock treated-Adipose-derived mesenchymal stromal cells. * Corresponding author. Department of Veterinary Surgery, College of Veterinary Medicine building 85, Seoul National University, Gwanak-gu, Gwanak-ro 1, Seoul, 08826, South Korea. E-mail addresses: [email protected] (M.A. Shahid), [email protected] (W.H. Kim), [email protected] (O.-K. Kweon). https://doi.org/10.1016/j.cryobiol.2019.11.040 Received 28 August 2019; Received in revised form 17 November 2019; Accepted 22 November 2019 Available online 28 November 2019 0011-2240/© 2019 Published by Elsevier Inc.
Please cite this article as: Muhammad Afan Shahid, Cryobiology, https://doi.org/10.1016/j.cryobiol.2019.11.040
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
for future use. Cryopreservation between 80 � C to 196 � C is the most commonly used method to store stem cells to halt cellular metabolism [4]. Although convenient, cryopreservation for stem cell storage also reduces post-thaw cell viability (75–85%) as a result of cryoinjury [37]. Freezing and thawing involve sharp thermal, environmental and chemical changes that may reduce stem cells viability and total anti-oxidation capacity of Ad-MSCs [17,20]. In order to reduce cryoinjuries of cells as a result of cryopreservation, cryoprotectants were introduced in cryogenic media. Dimethyl sulfoxide (Me2SO) is the most widely used stem-cell cryoprotective agent [36,37]. Whereas, cryoprotectants also reported to have toxic effects against stem cells which is one of the main cause of the low survivability of cryopreserved cells [15]. If properly preserved, autologous and allogeneic stem cells can be used for clinical purposes, either directly from fresh culture, or the following cryopreservation. To overcome this problem, substantial research has been undertaken in the last decade to investigate and optimize stem cell cryopreservation protocols [35], and various treatments have been applied to stem cells to reduce the adverse effects of freezing, thawing and toxic effects of cryoprotectants. For example, hypoxia-pretreatment enhances the post-thaw viability and proliferation rates of cryopreserved stem cells [34]. Moreover, heat shock treatment of stem cells with minimal cryo protectant and without serum, enhances their post-thaw viability and stemness [36], likely because increased levels of heat shock proteins can mitigate stress-related damage [5]. Although hypoxia and heat shock treatments both contributed to increase viability and proliferation of cryopreserved stem cells, nevertheless, the impacts of these treatments on anti-oxidation capacity and growth factors production of canine Ad-MSCs are still unclear. In addition to that, comparative and syner gistic effects of hypoxia and heat shock treatment on Ad-MSCs need to be analyzed. Therefore, we compared the individual treatments and assessed the synergism between these two treatments on canine Ad-MSCs characteristics. Our aim is to investigate, the best treatment with minimum compositions of dimethyl sulfoxide (Me2SO) and fetal bovine serum (FBS) that can preserve stemness, cell viability, prolifer ation rate, anti-oxidant capacity and in vitro differentiation of canine Ad-MSCs even after cryopreservation. Therefore, fresh-Ad-MSCs were subjected to following treatments to assess which treatment can improve fresh-Ad-MSCs characteristics: heat shock treatment (HST), hypoxia treatment (HT), and hypoxia plus heat shock (HT þ HST) treatment. Then depending on the results, we will pretreat Ad-MSCs and cryopre serve them with different compositions of Me2SO and FBS to evaluate the minimum cryoprotectants and serum required to cryopreserved pretreated Ad-MSCs.
10000 U/mL, GIBCO). Cells were washed with dPBS, after 24 h, to remove cell debris. Fresh medium was then introduced and changed after every 48 h until 80–90% confluence. Confluent cells were either sub-cultured or cryopreserved. The third passage of Ad-MSCs was used for subsequent experimentations. 2.2. Allocation of Ad-MSCs into groups The Ad-MSCs were divided into 4 treatment groups: (1) Control AdMSCs, Ad-MSCs were cultured with 20% O2 and 5% CO2 at 37 � C until 90% confluence; (2) HT-Ad-MSCs, Ad-MSCs were cultured with 5% O2 and 5% CO2 at 37 � C until 90% confluence [1]; (3) HST-Ad-MSCs, Ad-MSCs were cultured with 20% O2 and 5% CO2 at 37 � C until 90% confluence and then the culture plates were incubated for 1 h at 43 � C, with 20% O2 and 5% CO2. After 1 h of heat shock treatment, the culture plates were returned to the 37 � C cell culture incubator and incubated for an additional 3 h before further experimentation [36]; and (4) HT þ HST-Ad-MSCs, Ad-MSCs were first cultured until 90% confluence under hypoxic conditions (5% oxygen). During hypoxia, the cells were sub jected to heat shock treatment for 1 h at 43 � C followed by a 3 h incu bation with 5% O2 at 37 � C. 2.3. Cryopreservation Because F-HST-Ad-MSC group showed the best overall results among all fresh groups, we selected this group for the subsequent cryopreser vation experiments. The Ad-MSCs and F-HST-Ad-MSCs were harvested at 90% confluence with 0.05% trypsin-EDTA (Sigma-Aldrich), then centrifuged at 2500 rpm for 5 min at 4 � C. After discarding supernatant, 1 � 107 cells from each group were re-suspended in three different combinations of cryogenic media (vol/vol %): (1) 10% Me2SO þ 40% FBS; (2) 1% Me2SO þ 10% FBS; and (3) 1% Me2SO only. The cells were transferred to cryovials (1.2 mL, Sigma-Aldrich), and then kept at 4 � C for 10 min. After that cryopreservation was carried out in freezing container (NALGENE Cryo 1 � C Freezing Container; Sigma-Aldrich, USA) using a cooling rate of 1 � C/min. First, cryovials were at 80 C for 24 h in Ultra-low temperature freezer (Thermo Fisher Scientific TSE series) and then kept at 150 � C (Ultra-low temperature freezer, SANYO Electric Biomedical, Osaka, Japan) for 1 week. Thawing was carried out in water bath at 37 � C and cells were always washed thrice with DMEM (GIBCO) before further experimentation. 2.4. Cell morphology In the fresh culture groups, the morphology of third passage AdMSCs was observed at 4th day of seeding after the respective treat ments. The morphology of the post-thaw Ad-MSCs was assessed on the 4th day of seeding. Ad-MSCs were seeded in six-well plates at 1 � 105 cells per well. Cell morphology was observed with an EVOS XL Core cell imaging system (Thermo Fisher Scientific, Waltham, Massachusetts, USA).
2. Material and methods 2.1. Isolation of mesenchymal stromal cells Canine adipose-derived mesenchymal stromal cells (Ad-MSCs) were isolated according to the method of Kisiel et al. [21]. We previously reported on the characterization and differentiation of Ad-MSCs isolated through this method [19]. Aseptically, gluteal subcutaneous adipose tissue was collected from healthy male dogs aged 1–1.5 years. Institute of Animal Care and Use Committee of Seoul National University (SNU-160720-13) approved all animal experiments. Furthermore, all these experiments were in accordance with the National Institutes of Health guide for the care and use of Laboratory Animals (NIH Publica tions No. 8023, revised 1978). Aseptically minced adipose tissue was then incubated with collagenase type 1A (1 mg/mL, Sigma-Aldrich, St. Louis, MO, USA) for 2 h at 37 � C. Later on, the suspension was filtered through a 100 μm mesh and centrifuged at 980�g for 10 min. After that pellet was re-suspended in the culture medium. Cells were further cultured in low glucose DMEM (GIBCO BRL, Grand Island, NY, USA) supplemented with 10% FBS and 1% penicillin and streptomycin (PS,
2.5. Trypan blue exclusion and MTS assays The viability of fresh-Ad-MSCs before cryopreservation. After cryo preservation, 1 � 104 cryopreserved-Ad-MSCs from each group were cultured up to 24hr in 6-well plate. Then their viability was determined by the trypan blue exclusion assay (Gibco) using a Countess II FL automated cell counter (Thermo Fisher Scientific). The proliferation rates of freshly cultured (after respective treatments) and cryopreservedAd-MSCs were determined by the MTS cell proliferation assay, following the manufacturer’s guidelines (Bio-vision, Milpitas, CA, USA). Approx imately 5 � 103 cells were seeded per well of 96-well plates and pro liferation rates were evaluated at 6, 24, 48, and 72 h after seeding. A 20 μL aliquot of MTS reagent was added to each well and incubated for 2 h. Then the absorbance was measured at 490 nm using the Epoch Gen 5.2 2
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
type reader (Bio Tek, Winooski, VT, USA).
cetylpyridinium chloride followed by measuring of absorbance at 540 nm. Further, the gene expression of specific markers for each differenti ation was determined using RT-qPCR to compare the differentiation potential of control Ad-MSCs and C-HST-Ad-MSCs in each group.
2.6. Evaluation of total anti-oxidation capacity The total antioxidant capacity (TAC) assay kit (CS0790, SigmaAldrich) was used, following the manufacturer’s instructions [38]. Approximately 1 � 107 cells from each group were centrifuged at 2500 rpm, washed twice in PBS, and re-suspended in the assay buffer of the kit. Cell lysates were prepared by four freeze-thaw cycles. The lysate mixtures were centrifuged at 15000�g for 10 min and the supernatants were transferred to a separate tube. The lysates were mixed in a 96-well plate with a 1X myoglobin working solution (Sigma-Aldrich), an ABTS working solution from the kit, and 3% hydrogen peroxide (Sigma-Al drich). The mixture was incubated at 25 � C for 5 min, and the reaction was stopped by adding stop solution from the kit to each well. The absorbance was read at 405 nm with an Epoch Gen 5.2 type reader (BioTek). The absorbance readings were transformed using a standard curve based on the soluble anti-oxidant Trolox. TAC is expressed as Trolox concentration (mM).
2.8. Real-time quantitative PCR (RT-qPCR) Total mRNA was extracted from all groups before and after cryo preservation. For RT-qPCR, mRNA was harvested using the Hybrid-R RNA extraction kit (GeneAll, Seoul, Republic of Korea) according to the manufacturer’s guidelines. Then cDNA was synthesized using the PrimeScript II first-strand cDNA synthesis kit (Takara, Otsu, Japan) DNA was amplified using the ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA, U.S.A.) after mixing with SYBR Premix Ex Taq (Takara, Otsu, Japan) and the specified forward and reverse primers (Table 1). The RT-qPCR conditions were as follows: initial denaturation at 95 � C for 3 min, followed by 40 cycles of dena turation at 95 � C (20 s), annealing at 59–61 � C (20 s), and extension at 72 � C (20 s). Gene expression levels were quantified using the 2-ΔΔCT method [24], with GAPDH as the reference gene.
2.7. In vitro differentiation
2.9. Statistical evaluation
Trilineage differentiation was performed after cryopreservation. Briefly, frozen-thawed heat-shocked Ad-MSCs, cryopreserved with different concentration of Me2SO and FBS, were plated in 6 well plates at a density of 1 � 104 and cultured up to 60–70% confluence. Adipogenic and chondrogenic induction was carried out for 14 days by using Canine Adipocyte Differentiation Medium (Cn811D-250, Cell Applications, San Diego, CA, USA) and Canine Chondrocyte Differentiation Medium (Cn411D-250, Cell Applications) respectively. Adipogenic and Chon drogenic samples were stained with Oil O Red (LL-0052, Lifeline, Oceanside, CA, USA) and Alcian blue (LL-0051, Lifeline) respectively. Quantitation of adipogenesis and chondrogenesis was carried out by eluting Oil O red with 100% isopropanol and Alcian blue by 6 M gua nidine HCl respectively. Then absorption was measured at 510 nm for an adipogenic sample and at 650 nm for chondrogenic samples by Epoch Gen 5.2 type reader (BioTek). Osteogenic differentiation was carried out using DMEM (high glucose) supplemented with 10% FBS, 1% PS, 10 mM β-glycer ophosphate (Sigma-Aldrich), 0.1 μM dexamethasone (Sigma-Aldrich) and 50 μM 1-ascorbic acid-2-phosphate (Sigma-Aldrich) for 21 days. The cells were refed every 3 days during the incubation period. The cells were fixed in 70% ice-cold ethanol and stained with 2% Alizarin red solution. Quantitation was performed by eluting the stain with 10%
All data are expressed as means � SD. GraphPad Prism software (version 5) was used for analysis. The Kruskal–Wallis test with Man n–Whitney post-hoc test was applied to assess differences between the groups. A P-value < 0.05 indicates a significant difference between the groups. Every experiment was carried out thrice. 3. Results 3.1. Comparison of fresh-Ad-MSCs treated with HST, HT, and HT þ HST 3.1.1. Morphology, viability, and proliferation of fresh-Ad-MSCs Images of the fresh cultures from all the groups were acquired after the respective treatments on the 4th day of seeding. All cells from the fresh culture Ad-MSC groups were adhered to plates and morphologi cally similar to fibroblast (Fig. 1A). The cell viability values for control Ad-MSCs, HT-Ad-MSCs, F-HST-Ad-MSCs, and HT þ HST-Ad-MSCs were 90.6% � 0.6%, 92% � 0.6%, 91% � 0.5%, and 90.7% � 0.4%, respectively. There was no significant (p > 0.05) difference between groups (Fig. 2A). The proliferation rates of HT-Ad-MSCs and F-HST-AdMSCs were significantly higher than the control and HT þ HST-Ad-MSC
Table 1 RT-qPCR primers used to detect mRNA in canine Ad-MSCs. Target gene
Primer sequence
SOX-2
Forward: 50 -AACCCCAAGATGCACAACTC-30 Reverse: 50 CGGGGCCGGTATTTATAATC-30 Forward: 5 0 -GAATAACCCGAATTGGAGCAG-30 Reverse: 50 AGCGATTCCTCTTCACAGTTG-30 Forward: 50 -GTCACCACTCTGGGCTCTCC-30 Reverse: 50 TCCCCGAAACTCCCTGCCTC-30 Forward: 50 -ACATCAGCCAGAACAAGCGA-30 Reverse: 50 GAAGTCGATGCCCTCGAACA-30 Forward: 50 -TAACTGGCAAGCACGAAGAG-30 Reverse: 5’ -TCGAAGGTGACGGGAATAGT-30 Forward: 50 -CCAGTGCCACGAAGTTCAA-30 Reverse: 5’ -TCTTGTGCTCTGCTGCCAAC-30 Forward: 50 -AGTGGGCCTGTTGTGGTATC-30 Reverse: 50 AGTCACATTGCCCAGGTCTC-30 Forward: 50 -CATTGCCCTCAATGACCACT-30 Reverse: 5’ -TCCTTGGAGGCCATGTAGAC-30
NANOG OCT-4 HSP-70 HSP-27 HO-1 SOD-1 GAPDH
VEGF
Forward: 50 -CTATGGCAGGAGGAGAGCAC-30
HGF
Forward: 50 -ATGGGGAATGAGAATGCAG-30 Reverse: 50 GACAAAAATGCCAGGACGAT-30 Forward: 50 - ATCAGTGTAAACGGGGATGTG -30 Reverse:50 GACTTTTCTGTCATCCGCAGTA -3’ [33] Forward: 50 - ACACGATGC TGGCGTCCTTGATG -30 Reverse:50 - TGGCTCC ATGAAGTCACCAAAGG -3’ [33] Forward: 50 - AGTAACAGGAATGCCGATGTC -30 Reverse:50 TCTTGGGTCATAATGCTGTTG -3’ [33] Forward: 50 -CACTCCTCCTCCGGCATGAAC-30 Reverse:50 TATGTTGGAGATGACGTCGCTG-30 Forward: 50 -GATGATGGAGACGTAGTGGATA-30 Reverse:50 TGGAATGTCAGTGGGAAAATC-30 Forward: 50 -TCGTGGAGCATGACAAAGAG-30 Reverse:50 -GCTC C C GAATGTAGTC C TTG-30
FABP4 PPARγ2 Col 10A SOX 9 OPN BMP 7
SOX 2; SRY (sex determining region Y)-box 2, OCT4; octamer-binding transcription factor 4, HSP 70; heat shock protein 70, HSP 27; heat shock protein 27, HO 1; hemeoxygenase 1, SOD 1; superoxide dismutase 1, COX 2; cyclooxygenase 2, IL6; Interleukin 6, IL10; Interleukin 10, VEGF; vascular endothelial growth factor, HGF; hepatocyte growth factor. 3
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 1. Morphology of fresh- and cryopreserved-Ad-MSCs. (A) Fresh-Ad-MSCs cultures from all groups after the respective treatments, showing fibroblast-like cell morphology (�40 magnification). (B) The cells from all the cryopreserved groups showed fibroblast-like morphology. C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS showed the highest rate of proliferation among all the HST groups as well as control Ad-MSCs after cryopreservation (�40 magnification).
groups at 72 h after seeding (Fig. 2B).
3.2. Comparison of cryopreserved groups with different combinations of Me2SO and FBS
3.1.2. Anti-oxidation capacity of fresh-Ad-MSCs Among the fresh cultures, F-HST-Ad-MSCs showed significantly (p < 0.05) higher antioxidant capacity than the other groups (Fig. 2C).
3.2.1. Morphology, viability, and proliferation of cryopreserved HST-AdMSCs All post-thawed HST groups showed significantly (p < 0.05) higher growth than their respective control groups (Fig. 1B). All the cells from post-thaw Ad-MSCs groups remained plastic-adherent and showed fibroblast-like morphology. Cellular viability of cryopreserved cells after 24hr of re-culture of control Ad-MSCs and C-HST-Ad-MSCs cry opreserved with 1% Me2SO, 1% Me2SO þ 10% FBS, and 10% Me2SO þ 40% FBS cryogenic media were 40% � 2% and 83% � 1.2%; 75% � 0.9% and 91% � 0.6%; and 85% � 1.4% and 96% � 0.7%, respectively. All of the C-HST-Ad-MSCs groups showed significantly (p < 0.05) higher post-thaw cell viability compared to their respective control groups stored under similar cryogenic conditions (Fig. 2D). Moreover, C-HSTAd-MSCs stored with 10% Me2SO þ 40% FBS showed the highest (p < 0.05) cell viability among all cryopreserved groups. At 72 h after seed ing, the proliferation rates of all C-HST-Ad-MSCs groups stored with different cryogenic media were significantly (p < 0.05) higher compared to their respective control Ad-MSCs groups stored under similar cryo genic conditions (Fig. 2E). Moreover, at 24–72 h after seeding, the proliferation rate of the C-HST-Ad-MSCs group stored with 10% Me2SO þ 40% FBS was significantly (p ˂ 0.05) higher compared to the other HST groups (Fig. 2D).
3.1.3. Fresh-Ad-MSCs mRNA expressions The mRNA expression level of SRY (sex-determining region Y)-box 2 (SOX2) and NANOG in the freshly cultured F-HST-Ad-MSCs group was significantly (p < 0.05) higher compared to the other groups (Fig. 3A and B). The octamer-binding transcription factor 4 (OCT-4) mRNA level was significantly (p < 0.05) higher in both the F-HST-Ad-MSCs and HTAd-MSCs groups compared to the other groups (Fig. 3C). Moreover, heat shock protein 27 (HSP-27) and 70 (HSP-70) were expressed at signifi cantly (p < 0.05) higher levels in the F-HST-Ad-MSCs (Fig. 4A and B). The HST- and HT þ HST-treated Ad-MSC groups showed signifi cantly (p < 0.05) higher heme oxygenase 1 (HO-1) and copper/zincsuperoxide dismutase (SOD-1) mRNA expression levels than the con trol and HT-treated Ad-MSC groups (Fig. 4C, D). The mRNA expression levels of vascular endothelial growth factor (VEGF) and hepatocyte growth factor (HGF) in fresh-HT- and F-HST- AdMSCs groups were significantly (p < 0.05) higher compared to the control and HT þ HST groups (Fig. 5A and B).
3.2.2. Anti-oxidation capacity of cryopreserved HST-Ad-MSCs C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS exhibited significantly (p < 0.05) higher anti-oxidant capacity not only among all 4
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 2. Viability, proliferation rates and anti-oxidation capacity of fresh and cryopreserved Ad-MSCs. (A) There was no significant difference in viability among fresh groups (B) Proliferation rates with F-HST-Ad-MSCs and fresh-HT treatments were both significantly higher than in the other groups. (C) The F-HST-Ad-MSC group showed significant anti-oxidant capacity than other groups. *p < 0.05 vs control; ^ p < 0.05 vs the HT group; #p < 0.05 vs the HT þ HST group. (D) All C-HST-AdMSCs groups stored under different cryogenic conditions showed significantly higher cell viability compared to the respective control groups. (E) C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS showed significantly higher anti-oxidation capacity compared to other C-HST-Ad-MSCs and control groups. (F) Proliferation rates of all C-HST-Ad-MSCs stored under different cryogenic conditions were significantly higher than their respective control groups at 72 h after seeding.; * denotes p < 0.05 among control groups or HST groups. ^denotes p < 0.05 between the control and HST-treated groups stored with similar cryogenic media. a denotes p < 0.05 between the control and HST groups at 72 h after seeding.
the HST groups stored with different cryogenic conditions but also compared to the control Ad-MSC groups (Fig. 2F).
C-HST-Ad-MSCs group cryopreserved with 10% Me2SO þ 40% FBS showed significantly (p < 0.05) higher mRNA expression levels of HSP27 and HSP-70 compared to the other C-HST-Ad-MSCs and control groups (Fig. 4 E, F). In post-thaw cultures, HO-1 and SOD-1 mRNA expression levels in CHST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS were signif icantly (p < 0.05) as compare to all cryopreserved groups (Fig. 4 G, H). VEGF mRNA in all C-HST-Ad-MSCs groups cryopreserved under different conditions was significantly (p < 0.05) higher compared to their respective control Ad-MSC groups (Fig. 5C). Moreover, the mRNA expression levels of HGF were significantly (p < 0.05) higher in C-HST-
3.2.3. Cryopreserved HST-Ad-MSCs mRNA expressions SOX-2 and NANOG mRNA expression levels in the C-HST-Ad-MSCs group cryopreserved with 10% Me2SO þ 40% FBS were the highest (p < 0.05) among all the HST groups as well as the control groups (Fig. 3 D, E). However, the mRNA expression level of OCT-4 in the C-HST-AdMSCs group cryopreserved with 10% Me2SO þ 40% FBS was signifi cantly (p < 0.05) higher only compared to its respective control group (Fig. 3F). 5
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 3. Stemness genes expression of fresh and cryopreserved Ad-MSCs. (A) F-HST-Ad-MSCs had significantly higher SOX-2 and (B) NANOG compared to other groups (C) F-HST-Ad-MSCs had significantly higher OCT-4 mRNA expression levels compared to control and HT þ HST groups. *denotes p < 0.05 compared to control, ^denotes p < 0.05 compared to HT, #denotes p < 0.05 compared to HT þ HST. (D) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly higher levels of SOX-2 and (E) NANOG compared to other groups (F) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly higher levels of OCT-4 expression only when compared to the respective control. *denotes p < 0.05 among control groups or HST groups. ^denotes p < 0.05 between the control and HST-treated groups stored with similar cryogenic media.
Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS compared to other HST groups and the control Ad-MSC group stored under similar cryo genic conditions (Fig. 5D).
cryopreserved control and HST groups remained plastic adherent and maintained fibroblast-like morphology. There was not any significant (P > 0.05) difference among cellular viabilities of fresh-Ad-MSCs groups on the 4th day of seeding. Which indicated that none of the treatments i.e. Control, HT, HST, and HT þ HST was detrimental to cells (Fig. 2A). However, after 72 h of seeding, proliferation rates of fresh-HT-Ad-MSCs and fresh-HST-Ad-MSCs were significantly enhanced as compared to control-Ad-MSCs and HT þ HSTAd-MSCs (Fig. 2B). Although in a fresh culture, HT or HST individually enhanced the cellular proliferation rate as compared to control group, however, contrary to our expectation HT together with HST (fresh-HT þ HST-Ad-MSCs) did not show significant improvement in cell prolifera tion rate as compared to control group (Fig. 2B). Which means HT and HST did not have synergistic effects. In fresh culture, F-HST-Ad-MSCs proliferated more slowly compared to the HT group, likely due to cell death resulting from heat shock treatment, as already has been sug gested [28]. Omori et al. [28] showed that HST treatment (at 43 � C) markedly affected stem cell proliferation until the fourth day after the initial heat shock treatment. In our study, however, cell death initially occurred because of the HST treatment that temporarily reduced F-HST-Ad-MSCs growth; however, growth started increasing after 48 h and became significantly higher at 72 h compared to control and HT þ HST groups. This difference in results between the studies was likely due to differences in susceptibility to heat shock between the neural stem
3.2.4. Tri-lineage differentiation of cryopreserved HST-Ad-MSCs Histochemical staining with Alizarin red stain for osteogenesis (Fig. 6A) or Oil O red for adipogenesis (Fig. 6B) and RT-qPCR analyses (Fig. 7 A, B) for the expression of osteogenic and adipogenic genes indicated that the C-HST-Ad-MSCs cryopreserved with 10% Me2SO and 40% FBS showed significantly (P < 0.05) better differentiation as compared to control and other C-HST-Ad-MSCs groups. Alcian blue staining for chondrogenesis (Fig. 6C) and RT-qPCR analyses for chon drogenic genes indicated that there were no significant differences among all cryopreserved groups as compared to control (Fig. 7C). 4. Discussion Morphology of fresh-Ad-MSCs did not change after HT or HST treatment, which is in line with other studies [28,34]. In addition, our results showed that HT þ HST treatments together also did not affect the characteristic morphology of fresh-Ad-MSCs (Fig. 1A). Our results were also consistent with studies reported that cryopreservation did not alter Ad-MSCs morphology [20] (Fig. 1B). The cells from all fresh-Ad-MSCs groups that underwent their respective treatments as well as from all 6
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 4. Heat shock proteins gene expression of fresh and cryopreserved Ad-MSCs. (A) F-HST group had significantly higher mRNA levels of HSP-27 and (B) HSP-70 compared to the other groups. (C) The F-HST-Ad-MSC groups had significantly higher HO-1 and (D) SOD-1 mRNA expression than the control. *denotes p < 0.05 compared to control, ^denotes p < 0.05 compared to HT, #denotes p < 0.05 compared to HT þ HST. (E) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly higher mRNA levels of HSP-27 and (F) HSP-70 compared to all the other groups. (G) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly higher HO-1 and (H) SOD-1 mRNA expression levels compared to all the other cryopreserved groups. *denotes p < 0.05 among control groups or HST groups. ^denotes p < 0.05 between the control and HST groups stored with similar cryogenic media.
cells used by Omori et al. (2014) and the Ad-MSCs used in our study. Previously, Shaik et al. [36] reported that the heat shock enhanced stem cells post-thaw viability and differentiation potential in FBS-free cryopreserved media with 1% Me2SO as compared to control. Howev er, our study showed that post-thaw viability and differentiation po tentials were enhanced in C-HST-Ad-MSCs stored with 10% Me2SO and 40% FBS as compared to control groups as well as other C-HST-Ad-MSCs groups (Figs. 2D and 7A, B). This could be due to the difference in cryopreservation protocol, as in Shaik et al. [36] study cryopreservation was carried out without FBS while in this study we used FBS for cryo preservation. From this, we can extract that heat shock treated cells cryopreserved in the presence of FBS could have significantly better post-thaw viability and differentiation potential as compared to C-HST-Ad-MSCs stored without FBS. All of C-HST-Ad-MSCs had signif icantly better proliferation rate as compared to their respective control
Ad-MSCs cryopreserved with similar cryogenic conditions after 72 h of seeding. Among C-HST-Ad-MSCs groups, C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly enhanced prolifera tion rate than other C-HST-Ad-MSCs groups (Fig. 2E). Therefore, cryo preservation of pre-heat shocked Ad-MSCs in 10% Me2SO þ 40% FBS can retain better post-thaw cellular viability, cellular differentiation, and proliferation rate of Ad-MSCs. In the fresh and post-thaw cultures, the higher levels of cellular viability and proliferation rate in HST-Ad-MSCs may have resulted from high expression of heat shock proteins (HSP-27, HSP-70, HO-1) and growth factors (VEGF, HGF). RT-qPCR results showed that there was significant up-regulation of heat shock proteins and growth factors at the genetic level in fresh HST-Ad-MSCs as compared to the control group. Moreover, the C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS showed the highest expression levels of HSP-27, HSP-70, HO-1 as 7
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 5. Growth genes expression of fresh and cryopreserved Ad-MSCs. (A) Fresh HT-Ad-MSCs and F-HST-Ad-MSCs groups showed significantly higher mRNA expression of VEGF and (B) HGF compared to the other groups. *denotes p < 0.05 compared to control, ^denotes p < 0.05 compared to HT, #denotes p < 0.05 compared to HT þ HST. (C) All C-HST-Ad-MSCs groups cryopreserved had a significantly higher level of VEGF expression compared to their respective control groups stored under similar cryogenic conditions. (D) HGF mRNA levels were significantly higher in C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS compared to the other C-HST-Ad-MSCs and control groups. *denotes p < 0.05 among control groups or HST groups. ^denotes p < 0.05 between control and HST groups stored with similar cryogenic media.
Fig. 6. Comparison of trilineage differentiation of C-HST-Ad-MSCs groups with control. (A) Lipids droplets were positively stained by Oil Red O (B) Calcium de positions were positively stained red with Alizarin Red Stain. (C) Alcian Blue staining for detection of proteoglycan formation during chondrogenesis differentiation. All the images were obtained at a magnification of 100X, scale bar ¼ 100 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
well as VEGF and HGF; consequently, this group also showed the highest cell viability and proliferation as compared to control. This increase could be because of heat shock proteins protective effect, as heat shock
proteins are reported to be involved in inhibiting the apoptosis pathway, reducing oxidative stress, and the repairing of misfolded proteins [5,29]. HSP-27 promotes the recovery process in cells [12], while HSP-70 has 8
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 7. Differentiation gene expression of cryopreserved Ad-MSCs. (A) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS significantly enhanced the adipogenic genes as compared to other groups (B) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS significantly enhanced the osteogenic genes (C) All cryopreserved groups showed no significant difference among chondrogenic gene expression. *denotes p < 0.05 compared to control, ^denotes p < 0.05 compared to 1%Me2SO, #denotes p < 0.05 compared to 1% Me2SO þ 10% FBS.
anti-apoptotic and cytoprotective effects [5,25]. Similarly, VEGF plays a crucial role in promoting cell growth [10] and HGF reduces apoptosis and induces cell proliferation [40]. Therefore, we can propose that heat shock treatment not only improves the viability and proliferation of F-HST-Ad-MSCs by up-regulating the genetic expressions of heat shock proteins and growth factors but also help to preserve it well even after cryopreservation. However, further experimentations are required to optimize the heat shock proteins expression which in return reduce dependency on FBS and Me2SO for cryopreservation. The total anti-oxidation capacity was significantly higher in the FHST-Ad-MSCs compared to the other groups (Fig. 2C). Moreover, C-HSTAd-MSCs cryopreserved with 10% Me2SO þ 40% FBS also presented significantly increased anti-oxidant capacity compared to all other cry opreserved groups (Fig. 2F). These findings were also supported by our RT-qPCR results showing that F-HST-Ad-MSCs had significantly high levels of HO-1 as compare to control (Fig. 4C). In addition, increase in anti-oxidation capacity of C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS, could be due to high expressions of HO-1 and SOD-1 as compare to control (Fig. 4F and G). Heme-oxygenase 1 (HO-1), also known as HSP-32, is an anti-oxidative enzyme, the upregulation of which enhances cell survival under oxidative stress [8]. SOD-1 is another anti-oxidant enzyme that specifically counteracts superoxide anions, and stem cells overexpressing SOD-1 perform better under stress conditions [39]. Hence, the upregulation of these two genes could be responsible for the significantly better anti-oxidation capacity of HST-Ad-MSCs in fresh or cryopreserved cultures. Previously, stem cells anti-oxidant capacity is known to be upregulated by overexpression of HO-1 via transfection by lentivirus [20]or adenovirus [6] or by the overexpression of SOD-1 [39], which are substantially more compli cated events. However, in this study, we came up with a simple and
feasible method of enhancing Ad-MSCs anti-oxidant capacity via heat shock treatment. So that Ad-MSCs conveniently can be used in in-vivo treatments with better anti-oxidation capacities. Several studies have shown that SOX-2, OCT-4, and NANOG play central roles in the stemness of stem cells [2,27,32], inducing pluripo tency when upregulated [23,41]. In the current study, in a fresh culture, HST treatment significantly increased the stemness levels (SOX-2, NANOG, OCT-4) of fresh Ad-MSCs compared to the other groups (Fig. 3A, B, C). Moreover, C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS presented significantly higher stemness levels (SOX-2, NANOG) compared to the control and other C-HST-Ad-MSCs groups (Fig. 3 D, E). Therefore, C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly better adipogenic and osteo genic differentiation as compared to control and other C-HST-Ad-MSCs treated groups. However, no significant difference was found in chon drogenesis among all cryopreserved groups compared to control. Further experimentations are required to explain why in C-HST-Ad-MSCs groups chondrogenesis was not affected either by heat shock treatment or by different cryogenic media. 5. Conclusion Cryopreserved Ad-MSCs are more convenient to use than fresh cells, but cryopreservation also has some disadvantages. We showed, how heat shock can be used to overcome the drawbacks of cryopreservation in terms of viability, proliferation, anti-oxidation capacity, and in-vitro differentiation. In the present study, heat shock improved the charac teristics of canine Ad-MSCs to a greater extent than other groups. The importance of our research is in the integration of cryopreservation with heat shock treatment, which opens the possibility of generating cells 9
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
that can be used immediately in a clinical setting. However, further studies are required to optimize the expression of heat shock proteins in a way to reduce the dependence of cryoprotectants and animal serum in cryopreservation.
[18] M. Kassem, B.M. Abdallah, Human bone-marrow-derived mesenchymal stem cells: biological characteristics and potential role in therapy of degenerative diseases, Cell Tissue Res. 331 (2008) 157–163, https://doi.org/10.1007/s00441-007-05090. [19] I.U. Khan, Y. Yoon, W.H. Kim, O.K. Kweon, Gelatin positively regulates the immunosuppressive capabilities of adipose-derived mesenchymal stem cells, Turk. J. Biol. 41 (2017) 969–978, https://doi.org/10.3906/biy-1706-45. [20] M. Kim, Y. Kim, S. Lee, M. Kuk, A.Y. Kim, W. Kim, O.-K. Kweon, Comparison of viability and antioxidant capacity between canine adipose-derived mesenchymal stem cells and heme oxygenase-1-overexpressed cells after freeze-thawing, J. Vet. Med. Sci. 78 (2016) 619–625, https://doi.org/10.1292/jvms.15-0361. [21] A.H. Kisiel, L.A. McDuffee, E. Masaoud, T.R. Bailey, B.P. Esparza Gonzalez, R. Nino-Fong, Isolation, characterization, and in vitro proliferation of canine mesenchymal stem cells derived from bone marrow, adipose tissue, muscle, and periosteum, Am. J. Vet. Res. 73 (2012) 1305–1317, https://doi.org/10.2460/ ajvr.73.8.1305. [22] S. Leu, Y.C. Lin, C.M. Yuen, C.H. Yen, Y.H. Kao, C.K. Sun, H.K. Yip, Adiposederived mesenchymal stem cells markedly attenuate brain infarct size and improve neurological function in rats, J. Transl. Med. 8 (2010) 63, https://doi.org/ 10.1186/1479-5876-8-63. [23] T.M. Liu, Y.N. Wu, X.M. Guo, J.H. Hui, E.H. Lee, B. Lim, Effects of ectopic Nanog and Oct4 overexpression on mesenchymal stem cells, Stem Cells Dev. 18 (2009) 1013–1022, https://doi.org/10.1089/scd.2008.0335. [24] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2 ΔΔCT method, Methods 25 (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. [25] M.P. Mayer, B. Bukau, Hsp70 chaperones: cellular functions and molecular mechanism, Cell. Mol. Life Sci. 62 (2005) 670–684, https://doi.org/10.1007/ s00018-004-4464-6. [26] M. Mimeault, R. Hauke, S.K. Batra, Stem cells: a revolution in therapeutics—recent advances in stem cell biology and their therapeutic applications in regenerative medicine and cancer therapies, Clin. Pharmacol. Ther. 82 (2007) 252–264, https:// doi.org/10.1038/sj.clpt.6100301. [27] K. Mitsui, Y. Tokuzawa, H. Itoh, K. Segawa, M. Murakami, K. Takahashi, M. Maruyama, M. Maeda, S. Yamanaka, The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells, Cell 113 (2003) 631–642, https://doi.org/10.1016/s0092-8674(03)00393-3. [28] H. Omori, M. Otsu, A. Suzuki, T. Nakayama, K. Akama, M. Watanabe, N. Inoue, Effects of heat shock on survival, proliferation and differentiation of mouse neural stem cells, Neurosci. Res. 79 (2014) 13–21, https://doi.org/10.1016/j. neures.2013.11.005. [29] D.A. Parsell, S. Lindquist, The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins, Annu. Rev. Genet. 27 (1993) 437–496, https://doi.org/10.1146/annurev.ge.27.120193.002253. [30] A.A. Qayyum, M. Haack-Sorensen, A.B. Mathiasen, E. Jorgensen, A. Ekblond, J. Kastrup, Adipose-derived mesenchymal stromal cells for chronic myocardial ischemia (MyStromalCell Trial): study design, Regen. Med. 7 (2012) 421–428, https://doi.org/10.2217/rme.12.17. [31] M. Roemeling-van Rhijn, A. de Klein, H. Douben, Q. Pan, L.J. van der Laan, J. N. Ijzermans, M.G. Betjes, C.C. Baan, W. Weimar, M.J. Hoogduijn, Culture expansion induces non-tumorigenic aneuploidy in adipose tissue-derived mesenchymal stromal cells, Cytotherapy 15 (2013) 1352–1361, https://doi.org/ 10.1016/j.jcyt.2013.07.004. [32] M.H. Rosner, M.A. Vigano, K. Ozato, P.M. Timmons, F. Poirier, P.W. Rigby, L. M. Staudt, A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo, Nature 345 (1990) 686–692, https://doi.org/10.1038/ 345686a0. [33] K.A. Russell, N.H. Chow, D. Dukoff, T.W. Gibson, J. LaMarre, D.H. Betts, T.G. Koch, Characterization and immunomodulatory effects of canine adipose tissue- and bone marrow-derived mesenchymal stromal cells, PLoS One 11 (2016), e0167442, https://doi.org/10.1371/journal.pone.0167442. [34] W.K.Z.W. Safwani, J.R. Choi, K.W. Yong, I. Ting, N.A.M. Adenan, B. PingguanMurphy, Hypoxia enhances the viability, growth and chondrogenic potential of cryopreserved human adipose-derived stem cells, Cryobiology 75 (2017) 91–99, https://doi.org/10.1016/j.cryobiol.2017.01.006. [35] S. Shaik, R. Devireddy, Cryopreservation protocols for human adipose tissue derived adult stem cells, Methods Mol. Biol. 1773 (2018) 231–259, https://doi. org/10.1007/978-1-4939-7799-4_19. [36] S. Shaik, D. Hayes, J. Gimble, R. Devireddy, Inducing heat shock proteins enhances the stemness of frozen–thawed adipose tissue-derived stem cells, Stem Cells Dev. 26 (2017) 608–616, https://doi.org/10.1089/scd.2016.0289. [37] S. Thirumala, J.M. Gimble, R.V. Devireddy, Evaluation of methylcellulose and dimethyl sulfoxide as the cryoprotectants in a serum-free freezing media for cryopreservation of adipose-derived adult stem cells, Stem Cells Dev. 19 (2010) 513–522, https://doi.org/10.1089/scd.2009.0173. [38] M.E. Tome, A.F. Baker, G. Powis, C.M. Payne, M.M. Briehl, Catalase-overexpressing thymocytes are resistant to glucocorticoid-induced apoptosis and exhibit increased net tumor growth, Cancer Res. 61 (2001) 2766–2773. Published March 2001. [39] T. Wakai, H. Sakata, P. Narasimhan, H. Yoshioka, H. Kinouchi, P.H. Chan, Transplantation of neural stem cells that overexpress SOD1 enhances amelioration of intracerebral hemorrhage in mice, J. Cereb. Blood Flow Metab. 34 (2014) 441–449, https://doi.org/10.1038/jcbfm.2013.215. [40] H. Wang, R. Zheng, Q. Chen, J. Shao, J. Yu, S. Hu, Mesenchymal stem cells microvesicles stabilize endothelial barrier function partly mediated by hepatocyte
Funding This work was carried out with the support of the “Cooperative Research Program of Center for Companion Animal Research (Project No. PJ013957)” Rural Development Administration, Republic of Korea. Declarations of competing interest Authors declare that they have no conflict of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.cryobiol.2019.11.040. References [1] N.E. Ahmed, M. Murakami, S. Kaneko, M. Nakashima, The effects of hypoxia on the stemness properties of human dental pulp stem cells (DPSCs), Sci. Rep. 6 (2016) 35476, https://doi.org/10.1038/srep35476. [2] A.A. Avilion, S.K. Nicolis, L.H. Pevny, L. Perez, N. Vivian, R. Lovell-Badge, Multipotent cell lineages in early mouse development depend on SOX2 function, Genes Dev. 17 (2003) 126–140, https://doi.org/10.1101/gad.224503. [3] M. Barba, C. Cicione, C. Bernardini, F. Michetti, W. Lattanzi, Adipose-derived mesenchymal cells for bone regereneration: state of the art, 2013, BioMed Res. Int. (2013), https://doi.org/10.1155/2013/416391, 416391. [4] J.G. Baust, D. Gao, J.M. Baust, Cryopreservation: an emerging paradigm change, Organogenesis 5 (2009) 90–96, https://doi.org/10.4161/org.5.3.10021. [5] H.M. Beere, Death versus survival: functional interaction between the apoptotic and stress-inducible heat shock protein pathways, J. Clin. Investig. 115 (2005) 2633–2639, https://doi.org/10.1172/JCI26471. [6] Y. Cao, B.J. Wu, W.P. Zheng, M.L. Yin, T. Liu, H.L. Song, Effect of heme oxygenase1 transduced bone marrow mesenchymal stem cells on damaged intestinal epithelial cells in vitro, Cell Biol. Int. 41 (2017) 726–738, https://doi.org/ 10.1002/cbin.10749. [7] L. Chen, E.E. Tredget, P.Y. Wu, Y. Wu, Paracrine factors of mesenchymal stem cells recruit macrophages and endothelial lineage cells and enhance wound healing, PLoS One 3 (2008), e1886, https://doi.org/10.1371/journal.pone.0001886. [8] P.A. Dennery, Regulation and role of heme oxygenase in oxidative injury, Curr. Top. Cell. Regul. 36 (2000) 181–199, https://doi.org/10.1016/s0070-2137(01) 80008-x. [9] C. Donizetti-Oliveira, P. Semedo, M. Burgos-Silva, M.A. Cenedeze, D.M. Malheiros, M.A. Reis, A. Pacheco-Silva, N.O. Camara, Adipose tissue-derived stem cell treatment prevents renal disease progression, Cell Transplant. 21 (2012) 1727–1741, https://doi.org/10.3727/096368911X623925. [10] C.K. Enestvedt, L. Hosack, S.R. Winn, B.S. Diggs, B. Uchida, R.W. O’Rourke, B. A. Jobe, VEGF gene therapy augments localized angiogenesis and promotes anastomotic wound healing: a pilot study in a clinically relevant animal model, J. Gastrointest. Surg. 12 (2008) 1762–1770, https://doi.org/10.1007/s11605-0080635-3, discussion 1771-2. [11] K. Froelich, J. Mickler, G. Steusloff, A. Technau, M. Ramos Tirado, A. Scherzed, S. Hackenberg, A. Radeloff, R. Hagen, N. Kleinsasser, Chromosomal aberrations and deoxyribonucleic acid single-strand breaks in adipose-derived stem cells during long-term expansion in vitro, Cytotherapy 15 (2013) 767–781, https://doi. org/10.1016/j.jcyt.2012.12.009. [12] M. Ghayour-Mobarhan, H. Saber, G.A. Ferns, The potential role of heat shock protein 27 in cardiovascular disease, Clin. Chim. Acta 413 (2012) 15–24, https:// doi.org/10.1016/j.cca.2011.04.005. [13] J.M. Gimble, A.J. Katz, B.A. Bunnell, Adipose-derived stem cells for regenerative medicine, Circ. Res. 100 (2007) 1249–1260, https://doi.org/10.1161/01. RES.0000265074.83288.09. [14] C.T. Gomillion, K.J. Burg, Stem cells and adipose tissue engineering, Biomaterials 27 (2006) 6052–6063, https://doi.org/10.1016/j.biomaterials.2006.07.033. [15] B.C. Heng, C.P. Ye, H. Liu, W.S. Toh, A.J. Rufaihah, Z. Yang, B.H. Bay, Z. Ge, H. W. Ouyang, E.H. Lee, Loss of viability during freeze–thaw of intact and adherent human embryonic stem cells with conventional slow-cooling protocols is predominantly due to apoptosis rather than cellular necrosis, J. Biomed. Sci. 13 (2006) 433–445, https://doi.org/10.1007/s11373-005-9051-9. [16] S. Huang, L. Xu, Y. Zhang, Y. Sun, G. Li, Systemic and local administration of allogeneic bone marrow-derived mesenchymal stem cells promotes fracture healing in rats, Cell Transplant. 24 (2015) 2643–2655, https://doi.org/10.3727/ 096368915X687219. [17] M.T.J.O.M. Karlsson, Principles of Tissue Engineering, second ed., 2000.
10
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
growth factor (HGF), Stem Cell Res. Ther. 8 (2017) 211, https://doi.org/10.1186/ s13287-017-0662-7. [41] D.S. Yoon, Y.H. Kim, H.S. Jung, S. Paik, J.W. Lee, Importance of Sox2 in maintenance of cell proliferation and multipotency of mesenchymal stem cells in
low-density culture, Cell Prolif 44 (2011) 428–440, https://doi.org/10.1111/ j.1365-2184.2011.00770.x. [42] P. Zuk, Adipose-derived stem cells in tissue regeneration: a review, ISRN stem cells (2013), https://doi.org/10.1155/2013/713959, 2013.
11
Contents lists available at ScienceDirect
Cryobiology journal homepage: http://www.elsevier.com/locate/cryo
Cryopreservation of heat-shocked canine adipose-derived mesenchymal stromal cells with 10% dimethyl sulfoxide and 40% serum results in better viability, proliferation, anti-oxidation, and in-vitro differentiation Muhammad Afan Shahid, Wan Hee Kim, Oh-Kyeong Kweon * Research Institute for Veterinary Science and College of Veterinary Medicine Building 85, Room 623, Seoul National University, Gwanak-gu, Gwanak-ro 1, Seoul, 08826, South Korea
A R T I C L E I N F O
A B S T R A C T
Keywords: Mesenchymal stromal cells Heat shock treatment Hypoxia Cryopreservation Anti-oxidation In vitro differentiation
Cryopreserved canine adipose-derived mesenchymal stromal cells (Ad-MSCs) can be used instantly in dogs for clinical uses. However, cryopreservation results in a reduction of the cellular viability, proliferation, and antioxidation of post-thawed Ad-MSCs. Therefore, there is a need for in-vitro procedure to improve post-thawed Ad-MSCs’ viability, proliferation, anti-oxidation, and differentiation capacity. In this study, fresh-Ad-MSCs were activated with heat shock, hypoxia (5% O2), or hypoxia (5% O2) þ heat shock treatments. The results showed that compared to the other treatments, heat shock significantly improved the proliferation rate, antioxidation, heat shock proteins and growth factors expressions of canine-fresh-Ad-MSCs. Consequently, freshAd-MSCs were heat-shocked and then cryopreserved with different combinations of dimethyl sulfoxide (Me2SO) and fetal bovine serum (FBS) to determine the combination that could effectively preserve the cellular viability, proliferation, anti-oxidation and differentiation capacity of Ad-MSCs after cryopreservation. We found that C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS presented significantly (p < 0.05) improved cellular viability, proliferation rate, anti-oxidant capacity, and differentiation potential as compared to C-HSTAd-MSCs cryopreserved with 1% Me2SO þ 10% FBS or 1% Me2SO alone or control. We concluded, heat shock treatment is much better to enhance the characteristics of fresh-Ad-MSCs than other treatments, moreover, CHST-Ad-MSCs in 10% Me2SO þ 40% FBS showed better results compared to other cryopreserved groups. However, future work is required to optimize the expression of heat shock proteins, which would further improve the characteristics of fresh- and cryopreserved-HST-Ad-MSCs and reduce the dependency on Me2SO and FBS.
1. Introduction Adipose-derived mesenchymal stem cells are a well-established resource for tissue engineering and regenerative medicine applications for diabetes, spinal cord injury, stroke and myocardial infarction [26]. Various studies already suggested that, stem cells can be used in cell-based therapies to treat diseases of the bone [3], heart [30], kidney [9], and nervous system [22]. Among various types of stem cells, mesenchymal stem cells have been reported to be an effective source for these therapies because they are self-renewing, multipotent and possess
the ability to secrete cytokines and chemokines [13,42]. Moreover, Ad-MSCs were found to have several advantages over other stem cells in regard of their abundance, easy access with minimal invasion and yields a great number of cells on isolation [14]. Previously it was reported that stem cells could repair effected tissue by replacing damaged cells [16]. Furthermore, stem cells may indirectly repair the tissue by regulation of inflammatory and growth factors [7,18]. However, long-term culture of stem cells has raised biosafety concerns, such as the occurrence of chromosomal aberrations and spontaneous malignant transformations [11,31]. Henceforth, it is necessary to be able to stably store stem cells
Abbreviations: MSCs, Mesenchymal stem cells; Ad-MSCs, Adipose-derived mesenchymal stromal cells; HSP, Heat shock protein; HST-Ad-MSCs, Heat shock treatedAdipose-derived mesenchymal stromal cells; F-HST-Ad-MSCs, Fresh-Heat shock treated-Adipose-derived mesenchymal stromal cells; C-HST-Ad-MSCs, CryopreservedHeat shock treated-Adipose-derived mesenchymal stromal cells; HT-Ad-MSCs, Hypoxia-treated-Adipose-derived mesenchymal stromal cells; HT þ HST-Ad-MSCs, Hypoxia treatment and heat shock treated-Adipose-derived mesenchymal stromal cells. * Corresponding author. Department of Veterinary Surgery, College of Veterinary Medicine building 85, Seoul National University, Gwanak-gu, Gwanak-ro 1, Seoul, 08826, South Korea. E-mail addresses: [email protected] (M.A. Shahid), [email protected] (W.H. Kim), [email protected] (O.-K. Kweon). https://doi.org/10.1016/j.cryobiol.2019.11.040 Received 28 August 2019; Received in revised form 17 November 2019; Accepted 22 November 2019 Available online 28 November 2019 0011-2240/© 2019 Published by Elsevier Inc.
Please cite this article as: Muhammad Afan Shahid, Cryobiology, https://doi.org/10.1016/j.cryobiol.2019.11.040
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
for future use. Cryopreservation between 80 � C to 196 � C is the most commonly used method to store stem cells to halt cellular metabolism [4]. Although convenient, cryopreservation for stem cell storage also reduces post-thaw cell viability (75–85%) as a result of cryoinjury [37]. Freezing and thawing involve sharp thermal, environmental and chemical changes that may reduce stem cells viability and total anti-oxidation capacity of Ad-MSCs [17,20]. In order to reduce cryoinjuries of cells as a result of cryopreservation, cryoprotectants were introduced in cryogenic media. Dimethyl sulfoxide (Me2SO) is the most widely used stem-cell cryoprotective agent [36,37]. Whereas, cryoprotectants also reported to have toxic effects against stem cells which is one of the main cause of the low survivability of cryopreserved cells [15]. If properly preserved, autologous and allogeneic stem cells can be used for clinical purposes, either directly from fresh culture, or the following cryopreservation. To overcome this problem, substantial research has been undertaken in the last decade to investigate and optimize stem cell cryopreservation protocols [35], and various treatments have been applied to stem cells to reduce the adverse effects of freezing, thawing and toxic effects of cryoprotectants. For example, hypoxia-pretreatment enhances the post-thaw viability and proliferation rates of cryopreserved stem cells [34]. Moreover, heat shock treatment of stem cells with minimal cryo protectant and without serum, enhances their post-thaw viability and stemness [36], likely because increased levels of heat shock proteins can mitigate stress-related damage [5]. Although hypoxia and heat shock treatments both contributed to increase viability and proliferation of cryopreserved stem cells, nevertheless, the impacts of these treatments on anti-oxidation capacity and growth factors production of canine Ad-MSCs are still unclear. In addition to that, comparative and syner gistic effects of hypoxia and heat shock treatment on Ad-MSCs need to be analyzed. Therefore, we compared the individual treatments and assessed the synergism between these two treatments on canine Ad-MSCs characteristics. Our aim is to investigate, the best treatment with minimum compositions of dimethyl sulfoxide (Me2SO) and fetal bovine serum (FBS) that can preserve stemness, cell viability, prolifer ation rate, anti-oxidant capacity and in vitro differentiation of canine Ad-MSCs even after cryopreservation. Therefore, fresh-Ad-MSCs were subjected to following treatments to assess which treatment can improve fresh-Ad-MSCs characteristics: heat shock treatment (HST), hypoxia treatment (HT), and hypoxia plus heat shock (HT þ HST) treatment. Then depending on the results, we will pretreat Ad-MSCs and cryopre serve them with different compositions of Me2SO and FBS to evaluate the minimum cryoprotectants and serum required to cryopreserved pretreated Ad-MSCs.
10000 U/mL, GIBCO). Cells were washed with dPBS, after 24 h, to remove cell debris. Fresh medium was then introduced and changed after every 48 h until 80–90% confluence. Confluent cells were either sub-cultured or cryopreserved. The third passage of Ad-MSCs was used for subsequent experimentations. 2.2. Allocation of Ad-MSCs into groups The Ad-MSCs were divided into 4 treatment groups: (1) Control AdMSCs, Ad-MSCs were cultured with 20% O2 and 5% CO2 at 37 � C until 90% confluence; (2) HT-Ad-MSCs, Ad-MSCs were cultured with 5% O2 and 5% CO2 at 37 � C until 90% confluence [1]; (3) HST-Ad-MSCs, Ad-MSCs were cultured with 20% O2 and 5% CO2 at 37 � C until 90% confluence and then the culture plates were incubated for 1 h at 43 � C, with 20% O2 and 5% CO2. After 1 h of heat shock treatment, the culture plates were returned to the 37 � C cell culture incubator and incubated for an additional 3 h before further experimentation [36]; and (4) HT þ HST-Ad-MSCs, Ad-MSCs were first cultured until 90% confluence under hypoxic conditions (5% oxygen). During hypoxia, the cells were sub jected to heat shock treatment for 1 h at 43 � C followed by a 3 h incu bation with 5% O2 at 37 � C. 2.3. Cryopreservation Because F-HST-Ad-MSC group showed the best overall results among all fresh groups, we selected this group for the subsequent cryopreser vation experiments. The Ad-MSCs and F-HST-Ad-MSCs were harvested at 90% confluence with 0.05% trypsin-EDTA (Sigma-Aldrich), then centrifuged at 2500 rpm for 5 min at 4 � C. After discarding supernatant, 1 � 107 cells from each group were re-suspended in three different combinations of cryogenic media (vol/vol %): (1) 10% Me2SO þ 40% FBS; (2) 1% Me2SO þ 10% FBS; and (3) 1% Me2SO only. The cells were transferred to cryovials (1.2 mL, Sigma-Aldrich), and then kept at 4 � C for 10 min. After that cryopreservation was carried out in freezing container (NALGENE Cryo 1 � C Freezing Container; Sigma-Aldrich, USA) using a cooling rate of 1 � C/min. First, cryovials were at 80 C for 24 h in Ultra-low temperature freezer (Thermo Fisher Scientific TSE series) and then kept at 150 � C (Ultra-low temperature freezer, SANYO Electric Biomedical, Osaka, Japan) for 1 week. Thawing was carried out in water bath at 37 � C and cells were always washed thrice with DMEM (GIBCO) before further experimentation. 2.4. Cell morphology In the fresh culture groups, the morphology of third passage AdMSCs was observed at 4th day of seeding after the respective treat ments. The morphology of the post-thaw Ad-MSCs was assessed on the 4th day of seeding. Ad-MSCs were seeded in six-well plates at 1 � 105 cells per well. Cell morphology was observed with an EVOS XL Core cell imaging system (Thermo Fisher Scientific, Waltham, Massachusetts, USA).
2. Material and methods 2.1. Isolation of mesenchymal stromal cells Canine adipose-derived mesenchymal stromal cells (Ad-MSCs) were isolated according to the method of Kisiel et al. [21]. We previously reported on the characterization and differentiation of Ad-MSCs isolated through this method [19]. Aseptically, gluteal subcutaneous adipose tissue was collected from healthy male dogs aged 1–1.5 years. Institute of Animal Care and Use Committee of Seoul National University (SNU-160720-13) approved all animal experiments. Furthermore, all these experiments were in accordance with the National Institutes of Health guide for the care and use of Laboratory Animals (NIH Publica tions No. 8023, revised 1978). Aseptically minced adipose tissue was then incubated with collagenase type 1A (1 mg/mL, Sigma-Aldrich, St. Louis, MO, USA) for 2 h at 37 � C. Later on, the suspension was filtered through a 100 μm mesh and centrifuged at 980�g for 10 min. After that pellet was re-suspended in the culture medium. Cells were further cultured in low glucose DMEM (GIBCO BRL, Grand Island, NY, USA) supplemented with 10% FBS and 1% penicillin and streptomycin (PS,
2.5. Trypan blue exclusion and MTS assays The viability of fresh-Ad-MSCs before cryopreservation. After cryo preservation, 1 � 104 cryopreserved-Ad-MSCs from each group were cultured up to 24hr in 6-well plate. Then their viability was determined by the trypan blue exclusion assay (Gibco) using a Countess II FL automated cell counter (Thermo Fisher Scientific). The proliferation rates of freshly cultured (after respective treatments) and cryopreservedAd-MSCs were determined by the MTS cell proliferation assay, following the manufacturer’s guidelines (Bio-vision, Milpitas, CA, USA). Approx imately 5 � 103 cells were seeded per well of 96-well plates and pro liferation rates were evaluated at 6, 24, 48, and 72 h after seeding. A 20 μL aliquot of MTS reagent was added to each well and incubated for 2 h. Then the absorbance was measured at 490 nm using the Epoch Gen 5.2 2
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
type reader (Bio Tek, Winooski, VT, USA).
cetylpyridinium chloride followed by measuring of absorbance at 540 nm. Further, the gene expression of specific markers for each differenti ation was determined using RT-qPCR to compare the differentiation potential of control Ad-MSCs and C-HST-Ad-MSCs in each group.
2.6. Evaluation of total anti-oxidation capacity The total antioxidant capacity (TAC) assay kit (CS0790, SigmaAldrich) was used, following the manufacturer’s instructions [38]. Approximately 1 � 107 cells from each group were centrifuged at 2500 rpm, washed twice in PBS, and re-suspended in the assay buffer of the kit. Cell lysates were prepared by four freeze-thaw cycles. The lysate mixtures were centrifuged at 15000�g for 10 min and the supernatants were transferred to a separate tube. The lysates were mixed in a 96-well plate with a 1X myoglobin working solution (Sigma-Aldrich), an ABTS working solution from the kit, and 3% hydrogen peroxide (Sigma-Al drich). The mixture was incubated at 25 � C for 5 min, and the reaction was stopped by adding stop solution from the kit to each well. The absorbance was read at 405 nm with an Epoch Gen 5.2 type reader (BioTek). The absorbance readings were transformed using a standard curve based on the soluble anti-oxidant Trolox. TAC is expressed as Trolox concentration (mM).
2.8. Real-time quantitative PCR (RT-qPCR) Total mRNA was extracted from all groups before and after cryo preservation. For RT-qPCR, mRNA was harvested using the Hybrid-R RNA extraction kit (GeneAll, Seoul, Republic of Korea) according to the manufacturer’s guidelines. Then cDNA was synthesized using the PrimeScript II first-strand cDNA synthesis kit (Takara, Otsu, Japan) DNA was amplified using the ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA, U.S.A.) after mixing with SYBR Premix Ex Taq (Takara, Otsu, Japan) and the specified forward and reverse primers (Table 1). The RT-qPCR conditions were as follows: initial denaturation at 95 � C for 3 min, followed by 40 cycles of dena turation at 95 � C (20 s), annealing at 59–61 � C (20 s), and extension at 72 � C (20 s). Gene expression levels were quantified using the 2-ΔΔCT method [24], with GAPDH as the reference gene.
2.7. In vitro differentiation
2.9. Statistical evaluation
Trilineage differentiation was performed after cryopreservation. Briefly, frozen-thawed heat-shocked Ad-MSCs, cryopreserved with different concentration of Me2SO and FBS, were plated in 6 well plates at a density of 1 � 104 and cultured up to 60–70% confluence. Adipogenic and chondrogenic induction was carried out for 14 days by using Canine Adipocyte Differentiation Medium (Cn811D-250, Cell Applications, San Diego, CA, USA) and Canine Chondrocyte Differentiation Medium (Cn411D-250, Cell Applications) respectively. Adipogenic and Chon drogenic samples were stained with Oil O Red (LL-0052, Lifeline, Oceanside, CA, USA) and Alcian blue (LL-0051, Lifeline) respectively. Quantitation of adipogenesis and chondrogenesis was carried out by eluting Oil O red with 100% isopropanol and Alcian blue by 6 M gua nidine HCl respectively. Then absorption was measured at 510 nm for an adipogenic sample and at 650 nm for chondrogenic samples by Epoch Gen 5.2 type reader (BioTek). Osteogenic differentiation was carried out using DMEM (high glucose) supplemented with 10% FBS, 1% PS, 10 mM β-glycer ophosphate (Sigma-Aldrich), 0.1 μM dexamethasone (Sigma-Aldrich) and 50 μM 1-ascorbic acid-2-phosphate (Sigma-Aldrich) for 21 days. The cells were refed every 3 days during the incubation period. The cells were fixed in 70% ice-cold ethanol and stained with 2% Alizarin red solution. Quantitation was performed by eluting the stain with 10%
All data are expressed as means � SD. GraphPad Prism software (version 5) was used for analysis. The Kruskal–Wallis test with Man n–Whitney post-hoc test was applied to assess differences between the groups. A P-value < 0.05 indicates a significant difference between the groups. Every experiment was carried out thrice. 3. Results 3.1. Comparison of fresh-Ad-MSCs treated with HST, HT, and HT þ HST 3.1.1. Morphology, viability, and proliferation of fresh-Ad-MSCs Images of the fresh cultures from all the groups were acquired after the respective treatments on the 4th day of seeding. All cells from the fresh culture Ad-MSC groups were adhered to plates and morphologi cally similar to fibroblast (Fig. 1A). The cell viability values for control Ad-MSCs, HT-Ad-MSCs, F-HST-Ad-MSCs, and HT þ HST-Ad-MSCs were 90.6% � 0.6%, 92% � 0.6%, 91% � 0.5%, and 90.7% � 0.4%, respectively. There was no significant (p > 0.05) difference between groups (Fig. 2A). The proliferation rates of HT-Ad-MSCs and F-HST-AdMSCs were significantly higher than the control and HT þ HST-Ad-MSC
Table 1 RT-qPCR primers used to detect mRNA in canine Ad-MSCs. Target gene
Primer sequence
SOX-2
Forward: 50 -AACCCCAAGATGCACAACTC-30 Reverse: 50 CGGGGCCGGTATTTATAATC-30 Forward: 5 0 -GAATAACCCGAATTGGAGCAG-30 Reverse: 50 AGCGATTCCTCTTCACAGTTG-30 Forward: 50 -GTCACCACTCTGGGCTCTCC-30 Reverse: 50 TCCCCGAAACTCCCTGCCTC-30 Forward: 50 -ACATCAGCCAGAACAAGCGA-30 Reverse: 50 GAAGTCGATGCCCTCGAACA-30 Forward: 50 -TAACTGGCAAGCACGAAGAG-30 Reverse: 5’ -TCGAAGGTGACGGGAATAGT-30 Forward: 50 -CCAGTGCCACGAAGTTCAA-30 Reverse: 5’ -TCTTGTGCTCTGCTGCCAAC-30 Forward: 50 -AGTGGGCCTGTTGTGGTATC-30 Reverse: 50 AGTCACATTGCCCAGGTCTC-30 Forward: 50 -CATTGCCCTCAATGACCACT-30 Reverse: 5’ -TCCTTGGAGGCCATGTAGAC-30
NANOG OCT-4 HSP-70 HSP-27 HO-1 SOD-1 GAPDH
VEGF
Forward: 50 -CTATGGCAGGAGGAGAGCAC-30
HGF
Forward: 50 -ATGGGGAATGAGAATGCAG-30 Reverse: 50 GACAAAAATGCCAGGACGAT-30 Forward: 50 - ATCAGTGTAAACGGGGATGTG -30 Reverse:50 GACTTTTCTGTCATCCGCAGTA -3’ [33] Forward: 50 - ACACGATGC TGGCGTCCTTGATG -30 Reverse:50 - TGGCTCC ATGAAGTCACCAAAGG -3’ [33] Forward: 50 - AGTAACAGGAATGCCGATGTC -30 Reverse:50 TCTTGGGTCATAATGCTGTTG -3’ [33] Forward: 50 -CACTCCTCCTCCGGCATGAAC-30 Reverse:50 TATGTTGGAGATGACGTCGCTG-30 Forward: 50 -GATGATGGAGACGTAGTGGATA-30 Reverse:50 TGGAATGTCAGTGGGAAAATC-30 Forward: 50 -TCGTGGAGCATGACAAAGAG-30 Reverse:50 -GCTC C C GAATGTAGTC C TTG-30
FABP4 PPARγ2 Col 10A SOX 9 OPN BMP 7
SOX 2; SRY (sex determining region Y)-box 2, OCT4; octamer-binding transcription factor 4, HSP 70; heat shock protein 70, HSP 27; heat shock protein 27, HO 1; hemeoxygenase 1, SOD 1; superoxide dismutase 1, COX 2; cyclooxygenase 2, IL6; Interleukin 6, IL10; Interleukin 10, VEGF; vascular endothelial growth factor, HGF; hepatocyte growth factor. 3
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 1. Morphology of fresh- and cryopreserved-Ad-MSCs. (A) Fresh-Ad-MSCs cultures from all groups after the respective treatments, showing fibroblast-like cell morphology (�40 magnification). (B) The cells from all the cryopreserved groups showed fibroblast-like morphology. C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS showed the highest rate of proliferation among all the HST groups as well as control Ad-MSCs after cryopreservation (�40 magnification).
groups at 72 h after seeding (Fig. 2B).
3.2. Comparison of cryopreserved groups with different combinations of Me2SO and FBS
3.1.2. Anti-oxidation capacity of fresh-Ad-MSCs Among the fresh cultures, F-HST-Ad-MSCs showed significantly (p < 0.05) higher antioxidant capacity than the other groups (Fig. 2C).
3.2.1. Morphology, viability, and proliferation of cryopreserved HST-AdMSCs All post-thawed HST groups showed significantly (p < 0.05) higher growth than their respective control groups (Fig. 1B). All the cells from post-thaw Ad-MSCs groups remained plastic-adherent and showed fibroblast-like morphology. Cellular viability of cryopreserved cells after 24hr of re-culture of control Ad-MSCs and C-HST-Ad-MSCs cry opreserved with 1% Me2SO, 1% Me2SO þ 10% FBS, and 10% Me2SO þ 40% FBS cryogenic media were 40% � 2% and 83% � 1.2%; 75% � 0.9% and 91% � 0.6%; and 85% � 1.4% and 96% � 0.7%, respectively. All of the C-HST-Ad-MSCs groups showed significantly (p < 0.05) higher post-thaw cell viability compared to their respective control groups stored under similar cryogenic conditions (Fig. 2D). Moreover, C-HSTAd-MSCs stored with 10% Me2SO þ 40% FBS showed the highest (p < 0.05) cell viability among all cryopreserved groups. At 72 h after seed ing, the proliferation rates of all C-HST-Ad-MSCs groups stored with different cryogenic media were significantly (p < 0.05) higher compared to their respective control Ad-MSCs groups stored under similar cryo genic conditions (Fig. 2E). Moreover, at 24–72 h after seeding, the proliferation rate of the C-HST-Ad-MSCs group stored with 10% Me2SO þ 40% FBS was significantly (p ˂ 0.05) higher compared to the other HST groups (Fig. 2D).
3.1.3. Fresh-Ad-MSCs mRNA expressions The mRNA expression level of SRY (sex-determining region Y)-box 2 (SOX2) and NANOG in the freshly cultured F-HST-Ad-MSCs group was significantly (p < 0.05) higher compared to the other groups (Fig. 3A and B). The octamer-binding transcription factor 4 (OCT-4) mRNA level was significantly (p < 0.05) higher in both the F-HST-Ad-MSCs and HTAd-MSCs groups compared to the other groups (Fig. 3C). Moreover, heat shock protein 27 (HSP-27) and 70 (HSP-70) were expressed at signifi cantly (p < 0.05) higher levels in the F-HST-Ad-MSCs (Fig. 4A and B). The HST- and HT þ HST-treated Ad-MSC groups showed signifi cantly (p < 0.05) higher heme oxygenase 1 (HO-1) and copper/zincsuperoxide dismutase (SOD-1) mRNA expression levels than the con trol and HT-treated Ad-MSC groups (Fig. 4C, D). The mRNA expression levels of vascular endothelial growth factor (VEGF) and hepatocyte growth factor (HGF) in fresh-HT- and F-HST- AdMSCs groups were significantly (p < 0.05) higher compared to the control and HT þ HST groups (Fig. 5A and B).
3.2.2. Anti-oxidation capacity of cryopreserved HST-Ad-MSCs C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS exhibited significantly (p < 0.05) higher anti-oxidant capacity not only among all 4
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 2. Viability, proliferation rates and anti-oxidation capacity of fresh and cryopreserved Ad-MSCs. (A) There was no significant difference in viability among fresh groups (B) Proliferation rates with F-HST-Ad-MSCs and fresh-HT treatments were both significantly higher than in the other groups. (C) The F-HST-Ad-MSC group showed significant anti-oxidant capacity than other groups. *p < 0.05 vs control; ^ p < 0.05 vs the HT group; #p < 0.05 vs the HT þ HST group. (D) All C-HST-AdMSCs groups stored under different cryogenic conditions showed significantly higher cell viability compared to the respective control groups. (E) C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS showed significantly higher anti-oxidation capacity compared to other C-HST-Ad-MSCs and control groups. (F) Proliferation rates of all C-HST-Ad-MSCs stored under different cryogenic conditions were significantly higher than their respective control groups at 72 h after seeding.; * denotes p < 0.05 among control groups or HST groups. ^denotes p < 0.05 between the control and HST-treated groups stored with similar cryogenic media. a denotes p < 0.05 between the control and HST groups at 72 h after seeding.
the HST groups stored with different cryogenic conditions but also compared to the control Ad-MSC groups (Fig. 2F).
C-HST-Ad-MSCs group cryopreserved with 10% Me2SO þ 40% FBS showed significantly (p < 0.05) higher mRNA expression levels of HSP27 and HSP-70 compared to the other C-HST-Ad-MSCs and control groups (Fig. 4 E, F). In post-thaw cultures, HO-1 and SOD-1 mRNA expression levels in CHST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS were signif icantly (p < 0.05) as compare to all cryopreserved groups (Fig. 4 G, H). VEGF mRNA in all C-HST-Ad-MSCs groups cryopreserved under different conditions was significantly (p < 0.05) higher compared to their respective control Ad-MSC groups (Fig. 5C). Moreover, the mRNA expression levels of HGF were significantly (p < 0.05) higher in C-HST-
3.2.3. Cryopreserved HST-Ad-MSCs mRNA expressions SOX-2 and NANOG mRNA expression levels in the C-HST-Ad-MSCs group cryopreserved with 10% Me2SO þ 40% FBS were the highest (p < 0.05) among all the HST groups as well as the control groups (Fig. 3 D, E). However, the mRNA expression level of OCT-4 in the C-HST-AdMSCs group cryopreserved with 10% Me2SO þ 40% FBS was signifi cantly (p < 0.05) higher only compared to its respective control group (Fig. 3F). 5
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 3. Stemness genes expression of fresh and cryopreserved Ad-MSCs. (A) F-HST-Ad-MSCs had significantly higher SOX-2 and (B) NANOG compared to other groups (C) F-HST-Ad-MSCs had significantly higher OCT-4 mRNA expression levels compared to control and HT þ HST groups. *denotes p < 0.05 compared to control, ^denotes p < 0.05 compared to HT, #denotes p < 0.05 compared to HT þ HST. (D) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly higher levels of SOX-2 and (E) NANOG compared to other groups (F) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly higher levels of OCT-4 expression only when compared to the respective control. *denotes p < 0.05 among control groups or HST groups. ^denotes p < 0.05 between the control and HST-treated groups stored with similar cryogenic media.
Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS compared to other HST groups and the control Ad-MSC group stored under similar cryo genic conditions (Fig. 5D).
cryopreserved control and HST groups remained plastic adherent and maintained fibroblast-like morphology. There was not any significant (P > 0.05) difference among cellular viabilities of fresh-Ad-MSCs groups on the 4th day of seeding. Which indicated that none of the treatments i.e. Control, HT, HST, and HT þ HST was detrimental to cells (Fig. 2A). However, after 72 h of seeding, proliferation rates of fresh-HT-Ad-MSCs and fresh-HST-Ad-MSCs were significantly enhanced as compared to control-Ad-MSCs and HT þ HSTAd-MSCs (Fig. 2B). Although in a fresh culture, HT or HST individually enhanced the cellular proliferation rate as compared to control group, however, contrary to our expectation HT together with HST (fresh-HT þ HST-Ad-MSCs) did not show significant improvement in cell prolifera tion rate as compared to control group (Fig. 2B). Which means HT and HST did not have synergistic effects. In fresh culture, F-HST-Ad-MSCs proliferated more slowly compared to the HT group, likely due to cell death resulting from heat shock treatment, as already has been sug gested [28]. Omori et al. [28] showed that HST treatment (at 43 � C) markedly affected stem cell proliferation until the fourth day after the initial heat shock treatment. In our study, however, cell death initially occurred because of the HST treatment that temporarily reduced F-HST-Ad-MSCs growth; however, growth started increasing after 48 h and became significantly higher at 72 h compared to control and HT þ HST groups. This difference in results between the studies was likely due to differences in susceptibility to heat shock between the neural stem
3.2.4. Tri-lineage differentiation of cryopreserved HST-Ad-MSCs Histochemical staining with Alizarin red stain for osteogenesis (Fig. 6A) or Oil O red for adipogenesis (Fig. 6B) and RT-qPCR analyses (Fig. 7 A, B) for the expression of osteogenic and adipogenic genes indicated that the C-HST-Ad-MSCs cryopreserved with 10% Me2SO and 40% FBS showed significantly (P < 0.05) better differentiation as compared to control and other C-HST-Ad-MSCs groups. Alcian blue staining for chondrogenesis (Fig. 6C) and RT-qPCR analyses for chon drogenic genes indicated that there were no significant differences among all cryopreserved groups as compared to control (Fig. 7C). 4. Discussion Morphology of fresh-Ad-MSCs did not change after HT or HST treatment, which is in line with other studies [28,34]. In addition, our results showed that HT þ HST treatments together also did not affect the characteristic morphology of fresh-Ad-MSCs (Fig. 1A). Our results were also consistent with studies reported that cryopreservation did not alter Ad-MSCs morphology [20] (Fig. 1B). The cells from all fresh-Ad-MSCs groups that underwent their respective treatments as well as from all 6
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 4. Heat shock proteins gene expression of fresh and cryopreserved Ad-MSCs. (A) F-HST group had significantly higher mRNA levels of HSP-27 and (B) HSP-70 compared to the other groups. (C) The F-HST-Ad-MSC groups had significantly higher HO-1 and (D) SOD-1 mRNA expression than the control. *denotes p < 0.05 compared to control, ^denotes p < 0.05 compared to HT, #denotes p < 0.05 compared to HT þ HST. (E) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly higher mRNA levels of HSP-27 and (F) HSP-70 compared to all the other groups. (G) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly higher HO-1 and (H) SOD-1 mRNA expression levels compared to all the other cryopreserved groups. *denotes p < 0.05 among control groups or HST groups. ^denotes p < 0.05 between the control and HST groups stored with similar cryogenic media.
cells used by Omori et al. (2014) and the Ad-MSCs used in our study. Previously, Shaik et al. [36] reported that the heat shock enhanced stem cells post-thaw viability and differentiation potential in FBS-free cryopreserved media with 1% Me2SO as compared to control. Howev er, our study showed that post-thaw viability and differentiation po tentials were enhanced in C-HST-Ad-MSCs stored with 10% Me2SO and 40% FBS as compared to control groups as well as other C-HST-Ad-MSCs groups (Figs. 2D and 7A, B). This could be due to the difference in cryopreservation protocol, as in Shaik et al. [36] study cryopreservation was carried out without FBS while in this study we used FBS for cryo preservation. From this, we can extract that heat shock treated cells cryopreserved in the presence of FBS could have significantly better post-thaw viability and differentiation potential as compared to C-HST-Ad-MSCs stored without FBS. All of C-HST-Ad-MSCs had signif icantly better proliferation rate as compared to their respective control
Ad-MSCs cryopreserved with similar cryogenic conditions after 72 h of seeding. Among C-HST-Ad-MSCs groups, C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly enhanced prolifera tion rate than other C-HST-Ad-MSCs groups (Fig. 2E). Therefore, cryo preservation of pre-heat shocked Ad-MSCs in 10% Me2SO þ 40% FBS can retain better post-thaw cellular viability, cellular differentiation, and proliferation rate of Ad-MSCs. In the fresh and post-thaw cultures, the higher levels of cellular viability and proliferation rate in HST-Ad-MSCs may have resulted from high expression of heat shock proteins (HSP-27, HSP-70, HO-1) and growth factors (VEGF, HGF). RT-qPCR results showed that there was significant up-regulation of heat shock proteins and growth factors at the genetic level in fresh HST-Ad-MSCs as compared to the control group. Moreover, the C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS showed the highest expression levels of HSP-27, HSP-70, HO-1 as 7
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 5. Growth genes expression of fresh and cryopreserved Ad-MSCs. (A) Fresh HT-Ad-MSCs and F-HST-Ad-MSCs groups showed significantly higher mRNA expression of VEGF and (B) HGF compared to the other groups. *denotes p < 0.05 compared to control, ^denotes p < 0.05 compared to HT, #denotes p < 0.05 compared to HT þ HST. (C) All C-HST-Ad-MSCs groups cryopreserved had a significantly higher level of VEGF expression compared to their respective control groups stored under similar cryogenic conditions. (D) HGF mRNA levels were significantly higher in C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS compared to the other C-HST-Ad-MSCs and control groups. *denotes p < 0.05 among control groups or HST groups. ^denotes p < 0.05 between control and HST groups stored with similar cryogenic media.
Fig. 6. Comparison of trilineage differentiation of C-HST-Ad-MSCs groups with control. (A) Lipids droplets were positively stained by Oil Red O (B) Calcium de positions were positively stained red with Alizarin Red Stain. (C) Alcian Blue staining for detection of proteoglycan formation during chondrogenesis differentiation. All the images were obtained at a magnification of 100X, scale bar ¼ 100 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
well as VEGF and HGF; consequently, this group also showed the highest cell viability and proliferation as compared to control. This increase could be because of heat shock proteins protective effect, as heat shock
proteins are reported to be involved in inhibiting the apoptosis pathway, reducing oxidative stress, and the repairing of misfolded proteins [5,29]. HSP-27 promotes the recovery process in cells [12], while HSP-70 has 8
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
Fig. 7. Differentiation gene expression of cryopreserved Ad-MSCs. (A) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS significantly enhanced the adipogenic genes as compared to other groups (B) C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS significantly enhanced the osteogenic genes (C) All cryopreserved groups showed no significant difference among chondrogenic gene expression. *denotes p < 0.05 compared to control, ^denotes p < 0.05 compared to 1%Me2SO, #denotes p < 0.05 compared to 1% Me2SO þ 10% FBS.
anti-apoptotic and cytoprotective effects [5,25]. Similarly, VEGF plays a crucial role in promoting cell growth [10] and HGF reduces apoptosis and induces cell proliferation [40]. Therefore, we can propose that heat shock treatment not only improves the viability and proliferation of F-HST-Ad-MSCs by up-regulating the genetic expressions of heat shock proteins and growth factors but also help to preserve it well even after cryopreservation. However, further experimentations are required to optimize the heat shock proteins expression which in return reduce dependency on FBS and Me2SO for cryopreservation. The total anti-oxidation capacity was significantly higher in the FHST-Ad-MSCs compared to the other groups (Fig. 2C). Moreover, C-HSTAd-MSCs cryopreserved with 10% Me2SO þ 40% FBS also presented significantly increased anti-oxidant capacity compared to all other cry opreserved groups (Fig. 2F). These findings were also supported by our RT-qPCR results showing that F-HST-Ad-MSCs had significantly high levels of HO-1 as compare to control (Fig. 4C). In addition, increase in anti-oxidation capacity of C-HST-Ad-MSCs stored with 10% Me2SO þ 40% FBS, could be due to high expressions of HO-1 and SOD-1 as compare to control (Fig. 4F and G). Heme-oxygenase 1 (HO-1), also known as HSP-32, is an anti-oxidative enzyme, the upregulation of which enhances cell survival under oxidative stress [8]. SOD-1 is another anti-oxidant enzyme that specifically counteracts superoxide anions, and stem cells overexpressing SOD-1 perform better under stress conditions [39]. Hence, the upregulation of these two genes could be responsible for the significantly better anti-oxidation capacity of HST-Ad-MSCs in fresh or cryopreserved cultures. Previously, stem cells anti-oxidant capacity is known to be upregulated by overexpression of HO-1 via transfection by lentivirus [20]or adenovirus [6] or by the overexpression of SOD-1 [39], which are substantially more compli cated events. However, in this study, we came up with a simple and
feasible method of enhancing Ad-MSCs anti-oxidant capacity via heat shock treatment. So that Ad-MSCs conveniently can be used in in-vivo treatments with better anti-oxidation capacities. Several studies have shown that SOX-2, OCT-4, and NANOG play central roles in the stemness of stem cells [2,27,32], inducing pluripo tency when upregulated [23,41]. In the current study, in a fresh culture, HST treatment significantly increased the stemness levels (SOX-2, NANOG, OCT-4) of fresh Ad-MSCs compared to the other groups (Fig. 3A, B, C). Moreover, C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS presented significantly higher stemness levels (SOX-2, NANOG) compared to the control and other C-HST-Ad-MSCs groups (Fig. 3 D, E). Therefore, C-HST-Ad-MSCs cryopreserved with 10% Me2SO þ 40% FBS showed significantly better adipogenic and osteo genic differentiation as compared to control and other C-HST-Ad-MSCs treated groups. However, no significant difference was found in chon drogenesis among all cryopreserved groups compared to control. Further experimentations are required to explain why in C-HST-Ad-MSCs groups chondrogenesis was not affected either by heat shock treatment or by different cryogenic media. 5. Conclusion Cryopreserved Ad-MSCs are more convenient to use than fresh cells, but cryopreservation also has some disadvantages. We showed, how heat shock can be used to overcome the drawbacks of cryopreservation in terms of viability, proliferation, anti-oxidation capacity, and in-vitro differentiation. In the present study, heat shock improved the charac teristics of canine Ad-MSCs to a greater extent than other groups. The importance of our research is in the integration of cryopreservation with heat shock treatment, which opens the possibility of generating cells 9
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
that can be used immediately in a clinical setting. However, further studies are required to optimize the expression of heat shock proteins in a way to reduce the dependence of cryoprotectants and animal serum in cryopreservation.
[18] M. Kassem, B.M. Abdallah, Human bone-marrow-derived mesenchymal stem cells: biological characteristics and potential role in therapy of degenerative diseases, Cell Tissue Res. 331 (2008) 157–163, https://doi.org/10.1007/s00441-007-05090. [19] I.U. Khan, Y. Yoon, W.H. Kim, O.K. Kweon, Gelatin positively regulates the immunosuppressive capabilities of adipose-derived mesenchymal stem cells, Turk. J. Biol. 41 (2017) 969–978, https://doi.org/10.3906/biy-1706-45. [20] M. Kim, Y. Kim, S. Lee, M. Kuk, A.Y. Kim, W. Kim, O.-K. Kweon, Comparison of viability and antioxidant capacity between canine adipose-derived mesenchymal stem cells and heme oxygenase-1-overexpressed cells after freeze-thawing, J. Vet. Med. Sci. 78 (2016) 619–625, https://doi.org/10.1292/jvms.15-0361. [21] A.H. Kisiel, L.A. McDuffee, E. Masaoud, T.R. Bailey, B.P. Esparza Gonzalez, R. Nino-Fong, Isolation, characterization, and in vitro proliferation of canine mesenchymal stem cells derived from bone marrow, adipose tissue, muscle, and periosteum, Am. J. Vet. Res. 73 (2012) 1305–1317, https://doi.org/10.2460/ ajvr.73.8.1305. [22] S. Leu, Y.C. Lin, C.M. Yuen, C.H. Yen, Y.H. Kao, C.K. Sun, H.K. Yip, Adiposederived mesenchymal stem cells markedly attenuate brain infarct size and improve neurological function in rats, J. Transl. Med. 8 (2010) 63, https://doi.org/ 10.1186/1479-5876-8-63. [23] T.M. Liu, Y.N. Wu, X.M. Guo, J.H. Hui, E.H. Lee, B. Lim, Effects of ectopic Nanog and Oct4 overexpression on mesenchymal stem cells, Stem Cells Dev. 18 (2009) 1013–1022, https://doi.org/10.1089/scd.2008.0335. [24] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2 ΔΔCT method, Methods 25 (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. [25] M.P. Mayer, B. Bukau, Hsp70 chaperones: cellular functions and molecular mechanism, Cell. Mol. Life Sci. 62 (2005) 670–684, https://doi.org/10.1007/ s00018-004-4464-6. [26] M. Mimeault, R. Hauke, S.K. Batra, Stem cells: a revolution in therapeutics—recent advances in stem cell biology and their therapeutic applications in regenerative medicine and cancer therapies, Clin. Pharmacol. Ther. 82 (2007) 252–264, https:// doi.org/10.1038/sj.clpt.6100301. [27] K. Mitsui, Y. Tokuzawa, H. Itoh, K. Segawa, M. Murakami, K. Takahashi, M. Maruyama, M. Maeda, S. Yamanaka, The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells, Cell 113 (2003) 631–642, https://doi.org/10.1016/s0092-8674(03)00393-3. [28] H. Omori, M. Otsu, A. Suzuki, T. Nakayama, K. Akama, M. Watanabe, N. Inoue, Effects of heat shock on survival, proliferation and differentiation of mouse neural stem cells, Neurosci. Res. 79 (2014) 13–21, https://doi.org/10.1016/j. neures.2013.11.005. [29] D.A. Parsell, S. Lindquist, The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins, Annu. Rev. Genet. 27 (1993) 437–496, https://doi.org/10.1146/annurev.ge.27.120193.002253. [30] A.A. Qayyum, M. Haack-Sorensen, A.B. Mathiasen, E. Jorgensen, A. Ekblond, J. Kastrup, Adipose-derived mesenchymal stromal cells for chronic myocardial ischemia (MyStromalCell Trial): study design, Regen. Med. 7 (2012) 421–428, https://doi.org/10.2217/rme.12.17. [31] M. Roemeling-van Rhijn, A. de Klein, H. Douben, Q. Pan, L.J. van der Laan, J. N. Ijzermans, M.G. Betjes, C.C. Baan, W. Weimar, M.J. Hoogduijn, Culture expansion induces non-tumorigenic aneuploidy in adipose tissue-derived mesenchymal stromal cells, Cytotherapy 15 (2013) 1352–1361, https://doi.org/ 10.1016/j.jcyt.2013.07.004. [32] M.H. Rosner, M.A. Vigano, K. Ozato, P.M. Timmons, F. Poirier, P.W. Rigby, L. M. Staudt, A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo, Nature 345 (1990) 686–692, https://doi.org/10.1038/ 345686a0. [33] K.A. Russell, N.H. Chow, D. Dukoff, T.W. Gibson, J. LaMarre, D.H. Betts, T.G. Koch, Characterization and immunomodulatory effects of canine adipose tissue- and bone marrow-derived mesenchymal stromal cells, PLoS One 11 (2016), e0167442, https://doi.org/10.1371/journal.pone.0167442. [34] W.K.Z.W. Safwani, J.R. Choi, K.W. Yong, I. Ting, N.A.M. Adenan, B. PingguanMurphy, Hypoxia enhances the viability, growth and chondrogenic potential of cryopreserved human adipose-derived stem cells, Cryobiology 75 (2017) 91–99, https://doi.org/10.1016/j.cryobiol.2017.01.006. [35] S. Shaik, R. Devireddy, Cryopreservation protocols for human adipose tissue derived adult stem cells, Methods Mol. Biol. 1773 (2018) 231–259, https://doi. org/10.1007/978-1-4939-7799-4_19. [36] S. Shaik, D. Hayes, J. Gimble, R. Devireddy, Inducing heat shock proteins enhances the stemness of frozen–thawed adipose tissue-derived stem cells, Stem Cells Dev. 26 (2017) 608–616, https://doi.org/10.1089/scd.2016.0289. [37] S. Thirumala, J.M. Gimble, R.V. Devireddy, Evaluation of methylcellulose and dimethyl sulfoxide as the cryoprotectants in a serum-free freezing media for cryopreservation of adipose-derived adult stem cells, Stem Cells Dev. 19 (2010) 513–522, https://doi.org/10.1089/scd.2009.0173. [38] M.E. Tome, A.F. Baker, G. Powis, C.M. Payne, M.M. Briehl, Catalase-overexpressing thymocytes are resistant to glucocorticoid-induced apoptosis and exhibit increased net tumor growth, Cancer Res. 61 (2001) 2766–2773. Published March 2001. [39] T. Wakai, H. Sakata, P. Narasimhan, H. Yoshioka, H. Kinouchi, P.H. Chan, Transplantation of neural stem cells that overexpress SOD1 enhances amelioration of intracerebral hemorrhage in mice, J. Cereb. Blood Flow Metab. 34 (2014) 441–449, https://doi.org/10.1038/jcbfm.2013.215. [40] H. Wang, R. Zheng, Q. Chen, J. Shao, J. Yu, S. Hu, Mesenchymal stem cells microvesicles stabilize endothelial barrier function partly mediated by hepatocyte
Funding This work was carried out with the support of the “Cooperative Research Program of Center for Companion Animal Research (Project No. PJ013957)” Rural Development Administration, Republic of Korea. Declarations of competing interest Authors declare that they have no conflict of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.cryobiol.2019.11.040. References [1] N.E. Ahmed, M. Murakami, S. Kaneko, M. Nakashima, The effects of hypoxia on the stemness properties of human dental pulp stem cells (DPSCs), Sci. Rep. 6 (2016) 35476, https://doi.org/10.1038/srep35476. [2] A.A. Avilion, S.K. Nicolis, L.H. Pevny, L. Perez, N. Vivian, R. Lovell-Badge, Multipotent cell lineages in early mouse development depend on SOX2 function, Genes Dev. 17 (2003) 126–140, https://doi.org/10.1101/gad.224503. [3] M. Barba, C. Cicione, C. Bernardini, F. Michetti, W. Lattanzi, Adipose-derived mesenchymal cells for bone regereneration: state of the art, 2013, BioMed Res. Int. (2013), https://doi.org/10.1155/2013/416391, 416391. [4] J.G. Baust, D. Gao, J.M. Baust, Cryopreservation: an emerging paradigm change, Organogenesis 5 (2009) 90–96, https://doi.org/10.4161/org.5.3.10021. [5] H.M. Beere, Death versus survival: functional interaction between the apoptotic and stress-inducible heat shock protein pathways, J. Clin. Investig. 115 (2005) 2633–2639, https://doi.org/10.1172/JCI26471. [6] Y. Cao, B.J. Wu, W.P. Zheng, M.L. Yin, T. Liu, H.L. Song, Effect of heme oxygenase1 transduced bone marrow mesenchymal stem cells on damaged intestinal epithelial cells in vitro, Cell Biol. Int. 41 (2017) 726–738, https://doi.org/ 10.1002/cbin.10749. [7] L. Chen, E.E. Tredget, P.Y. Wu, Y. Wu, Paracrine factors of mesenchymal stem cells recruit macrophages and endothelial lineage cells and enhance wound healing, PLoS One 3 (2008), e1886, https://doi.org/10.1371/journal.pone.0001886. [8] P.A. Dennery, Regulation and role of heme oxygenase in oxidative injury, Curr. Top. Cell. Regul. 36 (2000) 181–199, https://doi.org/10.1016/s0070-2137(01) 80008-x. [9] C. Donizetti-Oliveira, P. Semedo, M. Burgos-Silva, M.A. Cenedeze, D.M. Malheiros, M.A. Reis, A. Pacheco-Silva, N.O. Camara, Adipose tissue-derived stem cell treatment prevents renal disease progression, Cell Transplant. 21 (2012) 1727–1741, https://doi.org/10.3727/096368911X623925. [10] C.K. Enestvedt, L. Hosack, S.R. Winn, B.S. Diggs, B. Uchida, R.W. O’Rourke, B. A. Jobe, VEGF gene therapy augments localized angiogenesis and promotes anastomotic wound healing: a pilot study in a clinically relevant animal model, J. Gastrointest. Surg. 12 (2008) 1762–1770, https://doi.org/10.1007/s11605-0080635-3, discussion 1771-2. [11] K. Froelich, J. Mickler, G. Steusloff, A. Technau, M. Ramos Tirado, A. Scherzed, S. Hackenberg, A. Radeloff, R. Hagen, N. Kleinsasser, Chromosomal aberrations and deoxyribonucleic acid single-strand breaks in adipose-derived stem cells during long-term expansion in vitro, Cytotherapy 15 (2013) 767–781, https://doi. org/10.1016/j.jcyt.2012.12.009. [12] M. Ghayour-Mobarhan, H. Saber, G.A. Ferns, The potential role of heat shock protein 27 in cardiovascular disease, Clin. Chim. Acta 413 (2012) 15–24, https:// doi.org/10.1016/j.cca.2011.04.005. [13] J.M. Gimble, A.J. Katz, B.A. Bunnell, Adipose-derived stem cells for regenerative medicine, Circ. Res. 100 (2007) 1249–1260, https://doi.org/10.1161/01. RES.0000265074.83288.09. [14] C.T. Gomillion, K.J. Burg, Stem cells and adipose tissue engineering, Biomaterials 27 (2006) 6052–6063, https://doi.org/10.1016/j.biomaterials.2006.07.033. [15] B.C. Heng, C.P. Ye, H. Liu, W.S. Toh, A.J. Rufaihah, Z. Yang, B.H. Bay, Z. Ge, H. W. Ouyang, E.H. Lee, Loss of viability during freeze–thaw of intact and adherent human embryonic stem cells with conventional slow-cooling protocols is predominantly due to apoptosis rather than cellular necrosis, J. Biomed. Sci. 13 (2006) 433–445, https://doi.org/10.1007/s11373-005-9051-9. [16] S. Huang, L. Xu, Y. Zhang, Y. Sun, G. Li, Systemic and local administration of allogeneic bone marrow-derived mesenchymal stem cells promotes fracture healing in rats, Cell Transplant. 24 (2015) 2643–2655, https://doi.org/10.3727/ 096368915X687219. [17] M.T.J.O.M. Karlsson, Principles of Tissue Engineering, second ed., 2000.
10
M.A. Shahid et al.
Cryobiology xxx (xxxx) xxx
growth factor (HGF), Stem Cell Res. Ther. 8 (2017) 211, https://doi.org/10.1186/ s13287-017-0662-7. [41] D.S. Yoon, Y.H. Kim, H.S. Jung, S. Paik, J.W. Lee, Importance of Sox2 in maintenance of cell proliferation and multipotency of mesenchymal stem cells in
low-density culture, Cell Prolif 44 (2011) 428–440, https://doi.org/10.1111/ j.1365-2184.2011.00770.x. [42] P. Zuk, Adipose-derived stem cells in tissue regeneration: a review, ISRN stem cells (2013), https://doi.org/10.1155/2013/713959, 2013.
11