Crystal structure and characterization of a novel l -serine ammonia-lyase from Rhizomucor miehei

Biochemical and Biophysical Research Communications 466 (2015) 431e437

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Crystal structure and characterization of a novel L-serine ammonia-lyase from Rhizomucor miehei Zhen Qin a, Qiaojuan Yan b, Qingjun Ma c, Zhengqiang Jiang a, * a

College of Food Science and Nutritional Engineering, Beijing Advanced Innovation Center of Food Nutrition and Human Health, China Agricultural University, Beijing 100083, China b College of Engineering, China Agricultural University, Beijing 100083, China c Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 August 2015 Accepted 8 September 2015 Available online 11 September 2015

ammonia-lyase, as a member of the b-family of pyridoxal-50 -phosphate (PLP) dependent enzymes, catalyzes the conversion of L-serine (L-threonine) to pyruvate (a-ketobutyrate) and ammonia. The crystal structure of L-serine ammonia-lyase from Rhizomucor miehei (RmSDH) was solved at 1.76 Å resolution by X-ray diffraction method. The overall structure of RmSDH had the characteristic b-family PLP dependent enzyme fold. It consisted of two distinct domains, both of which show the typical open twisted a/b structure. A PLP cofactor was located in the crevice between the two domains, which was attached to Lys52 by a Schiff-base linkage. Unique residue substitutions (Gly78, Pro79, Ser146, Ser147 and Thr312) were discovered at the catalytic site of RmSDH by comparison of structures of RmSDH and other reported eukaryotic L-serine ammonia-lyases. Optimal pH and temperature of the purified RmSDH were 7.5 and 40  C, respectively. It was stable in the pH range of 7.0e9.0 and at temperatures below 40  C. This is the first crystal structure of a fungal L-serine ammonia-lyase. It will be useful to study the catalytic mechanism of b-elimination enzymes and will provide a basis for further enzyme engineering. © 2015 Elsevier Inc. All rights reserved.

Keywords: Crystal structure L-Serine ammonia-lyase Serine dehydratase b-Elimination enzymes Rhizomucor miehei Pyridoxal-50 -phosphate

L-serine

1. Introduction L-Serine ammonia-lyase (SDH, EC 4.3.1.17, former name: L-serine dehydratase or L-serine deaminase) catalyzes the conversion of Lserine (L-threonine) to pyruvate (a-ketobutyrate) and ammonia [1], which is a pyridoxal-50 -phosphate (PLP)-dependent enzyme in eukaryotes. Formation of pyruvate by SDH is a two-step reaction: the hydroxyl group of L-serine is cleaved to produce aminoacrylate, which is then deaminated by non-enzymatic hydrolysis to produce pyruvate [2]. SDH has been found to play an important role in gluconeogenesis. The enzyme activity can be induced in starvation and during high-protein diets [3]. Furthermore, owing to its specific activity toward L-serine, SDH also has potential applications in the D-serine production for medical and other purpose [4]. Several crystal structures of SDHs have been determined, such as human SDH [5], human cancer cells SDH [6], rat SDH [7] and Legionella pneumophila SDH [8]. Moreover, some b-elimination

* Corresponding author. Present address: No. 17 Qinghua Donglu, Haidian district, Beijing 100083, China. E-mail address: [email protected] (Z. Jiang). http://dx.doi.org/10.1016/j.bbrc.2015.09.043 0006-291X/© 2015 Elsevier Inc. All rights reserved.

enzymes with SDH activity which include human serine racemase [9], Schizosaccharomyces pombe serine racemase [10], Salmonella typhimurium threonine deaminase [11], Solanum lycopersicum threonine deaminase [12] and Escherichia coli threonine deaminase [13], have also been determined. SDHs from eukaryotes share structural fold similarity, which all belong to the b-elimination enzymes [14]. In this family of enzymes, each subunit is formed by two distinct domains, both having a typical open a/b architecture. The active sites of these enzymes often bind a PLP cofactor and are composed of residues between two domains [5e7]. However, no fungal SDH structure has been reported previously. The characterization of how eukaryotic SDHs differ from the other b-elimination enzymes remains not clear. Rhizomucor miehei CAU432 is a thermophilic fungus thriving at an optimal temperature of 50  C [15]. Taken together, gene cloning, heterologous expression, crystal structure and characterization of a L-serine ammonia-lyase from R. miehei CAU432 (RmSDH) are described in the present study. This is the first three-dimensional structural view of a fungal SDH. Structural information of RmSDH allows a better understanding of the catalytic mechanism of fungal SDH, which is important for rational design of more robust biocatalysts. Enzymatic property suggested that RmSDH is a potential

432

Z. Qin et al. / Biochemical and Biophysical Research Communications 466 (2015) 431e437

candidate for the industrial application of splitting D/L-serine.

2.3. Data collection, structure determination, refinement and analysis

2. Materials and methods 2.1. Cloning, expression and purification The genome of R. miehei CAU432 was reported to explore the thermostable enzyme repertoire in our previous study [15]. In this study, we identified a novel SDH gene (RmSDH) from the genome of R. miehei CAU432. The gene sequence was deposited in the GenBank nucleotide sequence database with accession No. KR856181. The coding region for the RmSDH gene was amplified by PCR from the cDNA of R. miehei CAU432 using the primers RmSDH-up (50 ATTCCGGAATTCATGGACGATTCCTCAGACG30 ) and RmSDH-down (50 AAATATGCGGCCGCTTAAGAGCTATGTACATCAACG30 ). The restriction endonuclease sites underlined were incorporated in the forward (EcoRI) and reverse (NotI) primers, respectively. For protein crystal screening, the PCR product was subcloned into pET28a(þ) vector and transformed into E. coli strain Rosetta (DE3). Seed culture of the recombinant strain harboring RmSDH in pET-28a(þ) vector was prepared in Luria Bertani (LB) medium containing 50 mg/mL of kanamycin at 37  C in a rotary shaker with a rotation speed of 200 rpm for 4 h. When the absorbance at 600 nm of culture broth reached 0.6e0.8, the recombinant protein was induced by 1 mM IPTG (isopropyl b-D-thiogalactopyranoside). After the cultures were further grown at 30  C for 12 h, the cells were harvested by centrifugation at 10, 000 g for 10 min at 4  C. The recombinant protein was purified by nickel(II) affinity chromatography after eluted with 50 mM TriseHCl buffer pH 8.0 containing 500 mM NaCl and different levels of imidazole following our previous study [16]. The protein was further purified by gel filtration on a Sephacryl S-100 HR column in the buffer containing 20 mM TriseHCl pH 8.0 and 100 mM NaCl. The purified protein fractions were then combined and concentrated for crystallization. The purified PCR product was further cloned into the vector pPIC9K between EcoRI and NotI sites to yield the recombinant plasmid pPIC9K-RmSDH, which was linearized with restriction endonuclease SacI. Pichia pastoris GS115 competent cells were then transformed by electroporation with the linearized plasmid pPIC9K-RmSDH. Hisþ transformants were recovered on minimal dextrose (MD) agar plates (1.34% YNB (yeast nitrogen base without amino acids), 2% glucose, 4  105% biotin, 1.5% agar, w/v). High cell-density fermentation of P. pastoris was carried out as described previously [17]. Fed-batch fermentation was continued for 5 days. Cultured samples were centrifuged at 10,000  g for 10 min at 4  C. The supernatant was then dialyzed in 20 mM TriseHCl buffer pH 8.0 at 4  C overnight. The dialyzed sample was loaded onto a QSepharose Fast Flow (QSFF, 1  10 cm) column which was equilibrated with 20 mM TriseHCl buffer pH 8.0. The bound proteins were eluted with a linear gradient of 0e100 mM NaCl in the equilibration buffer at a flow rate of 1.0 ml/min. Fractions were collected and was checked by SDS-PAGE. 2.2. Crystallization The RmSDH (expressed in E. coli) was concentrated to 15 mg/mL in 20 mM TriseHCl buffer pH 8.0, 100 mM NaCl, 10% (v/v) glycerol, 25 mM PLP and 2 mM dithiothreitol. Crystallization experiments were performed in a 48-well plate by the sitting-drop vapor diffusion method at 20  C, with each sitting-drop prepared by mixing 1 mL protein solution and 1 mL reservoir solution. Crystals of RmSDH were obtained with the reservoir solution containing 0.2 M KCl, 35% pentaerythritol propoxylate (5/4 PO/OH), and 50 mM HEPES pH 7.5. Crystals were observed to have formed about 20 days later.

For X-ray diffraction experiments, each crystal was picked up from the crystallization drop using a nylon loop (Hampton Research) and flash frozen in liquid nitrogen without cryoprotectant solution. X-ray diffraction data of the RmSDH crystal were collected at beamline BL17U at Shanghai Synchrotron Research Facility (SSRF). All diffraction data were indexed, integrated and scaled using the program HKL-2000 [18]. The structure of RmSDH was determined by molecular replacement using the coordinates of human SDH (1P5J) as the search model, according to their protein sequence alignments. The structure models were built and refined by using the Phenix suite [19] and the Coot program [20] alternately. Data-collection and refinement statistics were given in Table 1. Structure homologs of RmSDH were identified at DALI server [21]. Structural superposition and RMSD calculation were performed using LSQMAN program [22]. Secondary structure elements were identified by DSSP [23]. The figures were created with €dinger LLC). The sequence alignment were PyMOL (v.1.3; Schro created with ClustalW [24] and ESPript [25]. 2.4. Enzyme assay SDH activity assay was performed in a reaction mixture comprising 20 mM TriseHCl pH 7.5, 50 mM L-serine, 25 mM PLP and diluted enzyme at 40  C for 30 min. The yield of pyruvate was measured with the 2,4-dinitrophenylhydrazine method as described previously [10,26]. One unit of enzyme activity was defined as the amount of enzyme required to generate 1 mmol

Table 1 X-ray data-collection and refinement statistics. RmSDH Data-collection statistics Radiation soure Wavelength (Å) Temperature of measurements (K) Resolution range (Å) Space group Unit cell parameters a, b, c (Å) Unique reflections Completeness (%) Rmergea (%) Mean I/sigma (I) Wilson B-factor (Å2) Refinement statistics Resolution range (Å) Rworkb Rfreeb No. residues No. water molecules No. ligands Number of atoms RMSD Bond lengths (Å) Bond angles ( ) Average B factors (Å2) Ramachandran favored (%) Ramachandran outliers (%) PDB code

SSRF-BL17U 0.9791 100 55.56e1.76 (1.82e1.76) C 2 2 21 a ¼ 73.0, b ¼ 72.9, c ¼ 111.1 29066 (2777) 97.46 (91.48) 7.9 (46.7) 45.31 (3.49) 26.81 1.76 17.37 (22.71) 20.77 (30.96) 316 156 15 2523 0.012 1.25 32.40 96 0 5C3U

*Values in parenthesis are from the last resolution shell. P P P P a Rmerge ¼ hkl ijIi (hkl)-〈I(hkl)〉j/ hkl i Ii (hkl), where Ii(hkl) is the ith observation of reflection hkl and 〈I(hkl)〉 is the weighted average intensity for all observations i of reflection hkl. P P b R ¼ hkl jjFoj  kjFcjj/ hkl jFoj. jFoj and jFcj are amplitudes of the observed and calculated structure factors, respectively; 95% and 5% of reflections were used for Rwork and Rfree, respectively.

Z. Qin et al. / Biochemical and Biophysical Research Communications 466 (2015) 431e437

433

Fig. 1. The overall structure of RmSDH. (A) Structural sequence alignments of SDHs. Identical residues are shown in white on a red background, and conservative residues are shown in red on a white background. Catalytic residue (Lys52) is marked by a red star. Residues involved in PLP binding are marked by dots. The sequences of RmSDH, human SDH (1P5J), rat SDH (1PWE) and Salmonella typhimurium threonine deaminase (2GN1) were aligned by ClustalW and the figure was produced in ESPript. (B) The overall structure of RmSDH is shown by ribbon and surface diagram. The small domain and large domain of RmSDH are colored by orange and blue, respectively. The PLP cofactor in the catalytic cleft is shown by sticks. (C) Topology diagram of RmSDH. Color code: purple, a-helix; cyan, b-strand; green, 310-helix. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

pyruvate per minute under the above conditions. Protein concentrations were measured by the Lowry method with bovine serum albumin (BSA) as the standard. Specific activity was expressed as units per milligram protein.

2.6. PDB accession code

2.5. Characterization of the recombinant RmSDH

3. Results and discussion

The optimal pH of the purified RmSDH (expressed in P. pastoris) was determined by measuring the enzyme activity in 50 mM buffers of pH range from 5.0 to 11.0: McIlvaine buffer (pH 5.0e7.5), phosphate buffer (pH 6.0e8.0), TriseHCl buffer (pH 7.0e9.5) and glycine-NaOH buffer (pH 9.0e11.0). For pH stability determination, residual activity was measured after incubation of the enzyme for 30 min in the aforementioned buffers. The optimal temperature was determined over the range 20e55  C in 50 mM TriseHCl buffer pH 7.5. Thermal stability of the purified enzyme was determined by measuring residual activity after incubation of the enzyme at 20e55  C for 30 min in 50 mM TriseHCl buffer pH 7.5. The SDH activity was determined under standard conditions.

3.1. Overall structure

The atomic coordinates and structure factors for the crystal structure of RmSDH have been deposited in the Protein Data Bank (PDB, http://www.pdb.org) under accession code 5C3U.

The crystal structure of RmSDH was determined at 1.76 Å resolution in space group C 2 2 21. The Rfactor of the model is 17.37% with an Rfree of 20.77%. The crystallographic asymmetric unit contains one protein molecule. The model of RmSDH comprises 315 (16e330) residues, 156 water molecules and 1 PLP molecule. The Nterminal 15 residues and the C-terminal 36 residues were not included in the electron density map. The overall structure of RmSDH is presented in Fig. 1. The protein molecule with approximate dimensions of 50  40  70 Å is composed of two domains: the small domain consisting of residues 43e145, and the large domain consisting of residues 16e42 and 146e330. This two

434

Z. Qin et al. / Biochemical and Biophysical Research Communications 466 (2015) 431e437

domain fold is a typical architecture of b-elimination enzymes. The small domain folds as a twisted a/b structure with four stranded parallel b-sheets (b3eb6) surrounded by four a-helices (a2ea5). The large domain is also a classical a/b structure with open twisted six-stranded b-sheets (b1, b2 and b7eb10) surrounded by nine ahelices (a1 and a6ea13). The active site is located between the small domain and large domain, and a PLP is attached to Lys52 by a Schiff-base linkage. Many of the active site residues that interact with the cofactor are situated at or near one end of the six-stranded b-sheets from the large domain, which form the base of the active site cavity (Fig. 1). 3.2. Active site geometry The electron density is clearly defined for the entire PLP molecule in RmSDH (Fig. 2A). The interaction between the cofactor and the residues of the enzyme is plotted (Fig. 2B). The PLP cofactor, which is covalently bound to the enzyme, forms a Schiff base linkage between its C4 atom (the internal aldimine) with the Nz of Lys52. The pyridine ring of PLP is sandwiched between Val51 on one side that faces the protein interior and Ser234, Leu235 on the other side. The phosphate moiety of the PLP cofactor is surrounded by five amide groups of the conserved amino residues 180GGGGL184 (phosphate binding-loop); its three oxygens (O1P, O2P and O3P) form six hydrogen-bonds with the amide groups of Gly180, Gly181, Gly182, Gly183, Leu184 and Ser147. The hydroxyl moiety is surrounded by the other conserved amino acid residues (77SGPNT81), forming one hydrogen-bond (O3 … Nd2) with Asn80. O3 of the PLP is apparently deprotonated and forms two hydrogen-bonds with the linked Nz of Lys52 and Nd2 of Asn80. The pyridinium nitrogen of PLP is hydrogen-bonded to the Og1 of Thr312. 3.3. Structure comparison RmSDH shares low amino acid sequence similarity (~42%) with

other structurally determined SDHs in the Protein Date Bank (PDB) (Fig. 1A), but it adopts a similar fold. A DALI search on the proteins from the PDB shows that the four most related structures are human SDH (hSDH, PDB codes: 1P5J, 4H27), rat SDH (rSDH, PDB codes: 1PWH), human cancer cells SDH (cSDH, PDB codes: 2RKB) and S. typhimurium threonine deaminase (StTDH, PDB codes: 2GN1), which gave 46.4, 46.1, 45.2 and 38.4 of Z-score and structural superposition root-mean-square distance (r.m.s.d) values of 1.6, 1.7, 1.9 and 2.1 Å, respectively (Supplementary Table S1). Superimposition of the structures of RmSDH, rSDH and hSDH (Fig. 3) show that their structural differences are located mainly in the loop regions. In many SDHs, single metal ions such as Mg2þ or Kþ are often located near the catalytic sites and have an important effect on catalytic activity [6,7,10]. The major roles of such metal ions are to stabilize the framework of the active sites, and the enzyme loses its activity after the treatment with EDTA [10]. However, no metal ion is found near the catalytic sites in the RmSDH. Like the reported eukaryotic SDH structures (rSDH and hSDH) [7,27], RmSDH has no regulatory domain. Therefore, RmSDH shows complete catalytic activity but no allosteric regulation, which is different from bacterial SDHs [11].

3.4. Unique residues in the catalytic cleft Sequence alignments indicate that RmSDH processes different binding sites surrounding the cofactor PLP from those of the known eukaryotic SDHs (Fig. 1A). Five key residues (Gly78, Pro79, Ser146, Ser147 and Thr312) are different from those in rSDH and hSDH (Figs. 1A and 3). Gly78 and Pro79 are a part of motif 77SGPN80 on the surface of the active cleft surrounding the hydroxyl moiety of PLP. Based on previous studies, these residue groups are mostly conserved (consisting of residues “SAGN”) in rSDH, hSDH and other serine/threonine ammonia-lyase (StTDH) [7,11,27]. The importance of the conserved residues Gly78 for substrate binding loop (residues 75e79) was corroborated by sitedirected mutagenesis of cSDH

Fig. 2. Pyridoxal-50 -phosphate in the active sites of RmSDH. (A) The 2Fo-Fc electron density map corresponding to PLP bound to Lys52 and the associated hydrogen bonding network are shown. The contour is drawn at 1.5s level. (B) Schematic representation of the interactions between the PLP molecules with RmSDH. The picture was produced by Ligplus. The atoms involved in hydrogen bonds (with distances) or hydrophobic contacts are depicted.

Z. Qin et al. / Biochemical and Biophysical Research Communications 466 (2015) 431e437

435

Fig. 3. Superimposition of RmSDH, human SDH and rat SDH. (A) Superposition of RmSDH, human SDH and rat SDH is shown by Ribbon diagram. RmSDH in green, human SDH in cyan and rat SDH in blue. (B) Substituted residues on the catalytic sites of RmSDH to human SDH and rat SDH. PLP and the key residues are shown as sticks and colored as above. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

[6]. The substitutions of the alanine with glycine would increase the flexibility of the substrate binding loop of SDH, and decrease its catalytic activity [6]. Ser146 and Ser147 in the loop between b6 and a6 are uniquely observed in RmSDH, whose counterparts are absent in other PLP-dependent b-elimination enzymes. Remarkably, the

Og of residue Ser147 forms a hydrogen-bond with O1P of the PLP cofactor, where the binding of cofactor in RmSDH is more stable than in rSDH and hSDH. The pyridinium nitrogen of PLP is hydrogen-bonded with the Og1 of Thr312 in RmSDH, whereas it is coordinated by the sulfhydryl of Cys302 in the rSDH and hSDH.

▫

Fig. 4. Optimal pH (A), pH stability (B), optimal temperature (C) and thermostability (D) of the RmSDH. Buffers were McIlvaine buffer ( ), phosphate buffer (;), TriseHCl buffer (B) and glycine-NaOH buffer (:).

436

Z. Qin et al. / Biochemical and Biophysical Research Communications 466 (2015) 431e437

Examination of the hydrogen-bond networks around Thr312 in the structure of RmSDH indicates that the hydrogen-bond between the threonine and the PLP is an OH … N bond, where N1 of the PLP is not protonated. This supports that RmSDH belongs to the first group of b-elimination enzymes [7], and its catalytic mechanism is similar to the reported eukaryotic SDHs, which catalyze the cleavage of the CbeOg bond of serine. Taking all the structural features together, we conclude that the fungal SDH, represented by RmSDH, is more related to animal SDHs than to bacterial SDHs. The unique residues in the catalytic cleft serve the structural basis for the conversion of L-serine (L-threonine) to pyruvate (a-ketobutyrate) and ammonia. The exact roles that these unique substitutions play in the catalytic mechanism of SDH are worth further study and could provide a basis for rational enzyme engineering of SDH.

3.5. Characterization of the purified RmSDH For characterization, RmSDH was overexpressed in P. pastoris as a secreted protein into the culture medium (Supplementary Fig. S1). The purified enzyme migrated as a single, homogeneous band of about 41 kDa on SDS-PAGE (Supplementary Fig. S2). Effects of pH and temperature on the activity of RmSDH were examined. The enzyme displayed maximal SDH activity at pH 7.5 in 50 mM TriseHCl buffer (Fig. 4A). It exhibited good stability within pH 7.0e9.0, as more than 80% of its activity was retained (Fig. 4B). RmSDH exhibited optimal activity at 40  C and had over 50% activity between 25  C and 45  C (Fig. 4C). The enzyme was stable up to 40  C, with more than 80% of its activity remaining (Fig. 4D). Under optimal conditions, RmSDH exhibited specific activity of 7.35 U/mg toward L-serine. However, it showed very low specific activity toward L-threonine (1.18 U/mg, about 16.1% of the activity toward L-serine), and did not display activity toward D-serine. Most of the reported SDHs, such as those from Homo sapiens [28], L. pneumophila [29], and Mus musculus [30], have optimal pH between 6.0 and 8.0. The purified RmSDH has optimum activity at pH 7.5, which is similar to the aforementioned enzymes. The metrics of mild reaction condition and high selectivity indicate this enzyme has potential application in splitting D/L-serine. Although many SDH genes have been cloned from various organisms, there have been no reports of SDH gene expression in P. pastoris. P. pastoris is often preferred in industrial preparation of enzymes owing to its efficient secretion, correct protein folding and the potential for very high cell density fermentations [17]. Therefore, the present results should contribute to improving industrial production of LSerine ammonia-lyases.

Conflict of interest The authors declare that they have no direct or indirect conflict of interest.

Acknowledgments This work was supported in part by the National Science Fund for Distinguished Young Scholars (No. 31325021) and Program for Changjiang Scholars (No. T2014055). We are grateful to the staff from SSRF for their assistance in X-ray data collection.

Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2015.09.043.

References [1] H. Holzer, C. Cennamo, M. Boll, Product activation of yeast threonine dehydratase by ammonia, Biochem. Biophys. Res. Commun. 14 (1964) 487e492. [2] H. Reiber, Proceedings: alpha, beta-elimination of serine: mechanism and catalysis of a model reaction and the consequences for the active centre of serine dehydratases, Hoppe Seyler's Z. Physiol. Chem. 355 (1974) 1240. [3] S. Ebara, S. Toyoshima, T. Matsumura, S. Adachi, S. Takenaka, R. Yamaji, F. Watanabe, K. Miyatake, H. Inui, Y. Nakano, Cobalamin deficiency results in severe metabolic disorder of serine and threonine in rats, Biochim. Biophys. Acta 1568 (2001) 111e117. [4] J. Gao, J.Z. Liu, H. Li, Q. Liu, Q.C. Jiao, Enzymatic resolution of D/L-serine with recobinant serine deaminase activity, Fine Chem. 30 (2013) 155e158. [5] L. Sun, X. Li, Y. Dong, M. Yang, Y. Liu, X. Han, X. Zhang, H. Pang, Z. Rao, Crystallization and preliminary crystallographic analysis of human serine dehydratase, Acta Crystallogr. D. Biol. Crystallogr. 59 (2003) 2297e2299. [6] T. Yamada, J. Komoto, T. Kasuya, Y. Takata, H. Ogawa, H. Mori, F. Takusagawa, A catalytic mechanism that explains a low catalytic activity of serine dehydratase like-1 from human cancer cells: crystal structure and site-directed mutagenesis studies, Biochim. Biophys. Acta 1780 (2008) 809e818. [7] T. Yamada, J. Komoto, Y. Takata, H. Ogawa, H.C. Pitot, F. Takusagawa, Crystal structure of serine dehydratase from rat liver, Biochemistry 42 (2003) 12854e12865. [8] J.B. Thoden, H.M. Holden, G.A. Grant, Structure of L-serine dehydratase from Legionella pneumophila: novel use of the C-terminal cysteine as an intrinsic competitive inhibitor, Biochemistry 53 (2014) 7615e7624. [9] M.A. Smith, V. Mack, A. Ebneth, I. Moraes, B. Felicetti, M. Wood, D. Schonfeld, O. Mather, A. Cesura, J. Barker, The structure of mammalian serine racemase: evidence for conformational changes upon inhibitor binding, J. Biol. Chem. 285 (2010) 12873e12881. [10] M. Goto, T. Yamauchi, N. Kamiya, I. Miyahara, T. Yoshimura, H. Mihara, T. Kurihara, K. Hirotsu, N. Esaki, Crystal structure of a homolog of mammalian serine racemase from Schizosaccharomyces pombe, J. Biol. Chem. 284 (2009) 25944e25952. [11] D.K. Simanshu, H.S. Savithri, M.R. Murthy, Crystal structures of Salmonella typhimurium biodegradative threonine deaminase and its complex with CMP provide structural insights into ligand-induced oligomerization and enzyme activation, J. Biol. Chem. 281 (2006) 39630e39641. [12] E. Gonzales-Vigil, C.M. Bianchetti, G.N. Phillips, G.A. Howe, Adaptive evolution of threonine deaminase in plant defense against insect herbivores, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 5897e5902. [13] D.T. Gallagher, G.L. Gilliland, G. Xiao, J. Zondlo, K.E. Fisher, D. Chinchilla, E. Eisenstein, Structure and control of pyridoxal phosphate dependent allosteric threonine deaminase, Structure 6 (1998) 465e475. [14] D. Salzmann, P. Christen, P.K. Mehta, E. Sandmeier, Rates of evolution of pyridoxal-50 -phosphate-dependent enzymes, Biochem. Biophys. Res. Commun. 270 (2000) 576e680. [15] P. Zhou, G. Zhang, S. Chen, Z. Jiang, Y. Tang, B. Henrissat, Q. Yan, S. Yang, C.F. Chen, B. Zhang, Z. Du, Genome sequence and transcriptome analyses of the thermophilic zygomycete fungus Rhizomucor miehei, BMC Genomics 15 (2014) 294. [16] X. Fu, Q. Yan, S. Yang, X. Yang, Y. Guo, Z. Jiang, An acidic, thermostable exochitinase with b-N-acetylglucosaminidase activity from Paenibacillus barengoltzii converting chitin to N-acetyl glucosamine, Biotechnol. Biofuels 7 (2014) 174. [17] Z. Chen, Q. Yan, Z. Jiang, Y. Liu, Y. Li, High-level expression of a novel agalactosidase gene from Rhizomucor miehei in Pichia pastoris and characterization of the recombinant enyzme, Protein Expr. Purif. 110 (2015) 107e114. [18] Z. Otwinowski, W. Minor, Processing of X-ray diffraction data collected in oscillation mode, macromolecular crystallography, Methods Enzymol. 276 (1997) 307e326. [19] P.D. Adams, P.V. Afonine, G. Bunkoczi, V.B. Chen, I.W. Davis, N. Echols, J.J. Headd, L.W. Hung, G.J. Kapral, R.W. Grosse-Kunstleve, A.J. McCoy, N.W. Moriarty, R. Oeffner, R.J. Read, D.C. Richardson, J.S. Richardson, T.C. Terwilliger, P.H. Zwart, PHENIX: a comprehensive python-based system for macromolecular structure solution, Acta Crystallogr. D. Biol. Crystallogr. 66 (2010) 213e221. [20] P. Emsley, B. Lohkamp, W.G. Scott, K. Cowtan, Features and development of coot, Acta Crystallogr. D. Biol. Crystallogr. 66 (2010) 486e501. [21] L. Holm, P. Rosenstrom, Dali server: conservation mapping in 3D, Nucleic Acids Res. 38 (2010) W545eW549. [22] G.J. Kleywegt, Experimental assessment of differences between related protein crystal structures, Acta Crystallogr. D. Biol. Crystallogr. 55 (1999) 1878e1884. [23] W. Kabsch, C. Sander, Dictionary of protein secondary structure: pattern recognition of hydrogen-bonded and geometrical features, Biopolymers 22 (1983) 2577e2637. [24] M.A. Larkin, G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, F. Valentin, I.M. Wallace, A. Wilm, R. Lopez, J.D. Thompson, T.J. Gibson, D.G. Higgins, Clustal W and clustal X version 2.0, Bioinformatics 23 (2007) 2947e2948. [25] X. Robert, P. Gouet, Deciphering key features in protein structures with the new ENDscript server, Nucleic Acids Res. 42 (2014) W320eW324. [26] T. Ito, K. Takahashi, T. Naka, H. Hemmi, T. Yoshimura, Enzymatic assay of D-

Z. Qin et al. / Biochemical and Biophysical Research Communications 466 (2015) 431e437 serine using D-serine dehydratase from Saccharomyces cerevisiae, Anal. Biochem. 371 (2007) 167e172. [27] L. Sun, M. Bartlam, Y. Liu, H. Pang, Z. Rao, Crystal structure of the pyridoxal-50 phosphate-dependent serine dehydratase from human liver, Protein Sci. 14 (2005) 791e798. [28] H. Ogawa, T. Gomi, M. Nishizawa, Y. Hayakawa, S. Endo, K. Hayashi, H. Ochiai, F. Takusagawa, H.C. Pitot, H. Mori, H. Sakurai, K. Koizumi, I. Saiki, H. Oda, T. Fujishita, T. Miwa, M. Maruyama, M. Kobayashi, Enzymatic and biochemical properties of a novel human serine dehydratase isoform, Biochim. Biophys.

437

Acta 1764 (2006) 961e971. [29] X.L. Xu, S. Chen, G.A. Grant, Kinetic, mutagenic, and structural homology analysis of L-serine dehydratase from Legionella pneumophila, Arch. Biochem. Biophys. 515 (2011) 28e36. [30] I. Lopez-Flores, J. Peragon, R. Valderrama, F.J. Esteban, F. Luque, M.A. Peinado, F. Aranda, J.A. Lupianez, J.B. Barroso, Downregulation in the expression of the serine dehydratase in the rat liver during chronic metabolic acidosis, Am. J. Physiol. Regul. Integr. Comp. Physiol. 291 (2006) R1295eR1302.