Crystal structure of Drosophila PGRP-SD suggests binding to DAP-type but not lysine-type peptidoglycan

Available online at www.sciencedirect.com

Molecular Immunology 45 (2008) 2521–2530

Crystal structure of Drosophila PGRP-SD suggests binding to DAP-type but not lysine-type peptidoglycan Philippe Leone a , Vincent Bischoff b , Christine Kellenberger c , Charles Hetru b , Julien Royet d , Alain Roussel c,∗ a

Architecture et Fonction des Macromol´ecules Biologiques, UMR 6098 CNRS and Universit´es Aix-Marseille I & II, Marseille, France b Institut de Biologie Mol´ eculaire et Cellulaire, UPR9022 CNRS, Strasbourg, France c Centre de Biophysique Mol´ eculaire, UPR 4301 CNRS, Orl´eans, France d Institut de Biologie du D´ eveloppement de Marseille-Luminy, UMR 6216 CNRS and Universit´e de la M´edit´erann´ee Aix-Marseille II, Marseille, France Received 7 November 2007; received in revised form 4 January 2008; accepted 8 January 2008 Available online 4 March 2008

Abstract In Drosophila the synthesis of antimicrobial peptides in response to microbial infections is under the control of the Toll and immune deficiency (Imd) signaling pathways. The Toll signaling pathway responds mainly to Gram-positive bacterial and fungal infection while the Imd pathway mediates the response to Gram-negative bacteria. Microbial recognition upstream of Toll involves, at least in part, peptidoglycan recognition proteins (PGRPs). The sensing of Gram-positive bacteria is mediated by the pattern recognition receptors PGRP-SA and Gram-negative binding protein 1 (GNBP1) that cooperate to detect the presence of lysine-type peptidoglycan in the host. Recently it has been shown that a loss-of-function mutation in peptidoglycan recognition protein SD (PGRP-SD) severely exacerbates the PGRP-SA and GNBP1 mutant phenotypes. Here we have ˚ resolution. Comparison with available structures of PGRPs in complex with their peptidoglycan solved the crystal structure of PGRP-SD at 1.5 A (PGN) ligand strongly suggests a diaminopimelic acid (DAP) specificity for PGRP-SD. This result is supported by pull-down assays with insoluble PGNs. In addition we show that Toll pathway activation after infection by DAP-type PGN containing bacteria is clearly reduced in PGRP-SD mutant flies. Our hypothesis is that the role of PGRP-SD is the recognition of DAP-type PGNs responsible for the activation of the Toll pathway by Gram-negative bacteria. © 2008 Elsevier Ltd. All rights reserved. Keywords: Innate immunity; Toll; Pattern recognition; PGRP; Drosophila

1. Introduction In all living species, the first line of defense against microbial aggressions is constituted by innate immunity. During evolution, it appeared in invertebrates and plants, long before adaptive immunity emerged in vertebrates. The innate immune system comprises a variety of components and mechanisms that can discriminate between different micro-organisms and mountspecific responses to control pathogenic infections. Central to this host defense is the synthesis of antimicrobial peptides. In Drosophila the transcription of the genes encoding these pep-

∗ Corresponding author at: Centre de Biophysique Mol´ eculaire, UPR 4301 CNRS, Rue Charles Sadron, 45071 Orleans, France. Tel.: +33 238 257 858; fax: +33 238 631 517. E-mail address: [email protected] (A. Roussel).

0161-5890/$ – see front matter © 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2008.01.015

tides is under the control of two distinct signaling pathways (Hoffmann, 2003). The Toll signaling pathway responds mainly to Gram-positive bacterial and fungal infections (Lemaitre et al., 1996) while the immune deficiency (Imd) pathway mediates the response to Gram-negative bacteria (Lemaitre et al., 1995). During the immune response, the Toll receptor is activated by the interaction with a cleaved form of the cytokine-like protein spaetzle. This cleavage is the result of a proteolytic cascade involving clip-domain serine proteases like persephone (Ligoxygakis et al., 2002) and ending in the activation of the ultimate clip-domain protease called spaetzle processing enzyme (SPE) (Jang et al., 2006). Microbial recognition upstream of the proteolytic cascade is achieved, at least in part, through peptidoglycan recognition proteins (PGRPs). Peptidoglycan (PGN) is a microbial-associated component found only in bacteria, not in eukaryotes. Polymeric PGN is composed of disaccharide N-acetyl glucosaminyl(GlcNAc)-N-acetylmuramic acid

2522

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

(MurNAc) linked to a stem peptide of d and l (or meso) amino acids. The third amino acid is mostly lysine in Gram-positive bacteria and diaminopimelic acid (DAP) in Gram-negative bacteria. Based on the predicted structures of the gene products, insect PGRPs have been grouped into two classes: short PGRPs (PGRP-S), which are small extracellular proteins (around 20 kDa) and long PGRPs (PGRP-L), which have long transcripts and are either intracellular or membrane-spanning proteins (Werner et al., 2000). In Drosophila, 13 PGRP genes have been identified. They are transcribed into at least 17 PGRPs (Dziarski, 2004), 7 short and 10 long. All of them have a conserved PGRP-domain that shows sequence similarity to the N-acetylmuramyl-alanine amidase. The residues required for the amidase activity are conserved in six Drosophila PGRP members suggesting that they can be involved in the degradation of peptidoglycans. Recently two of them, namely PGRP-SC1 and PGRP-LB, have been shown to control the intensity of the fly immune response (Bischoff et al., 2006; Zaidman-Remy et al., 2006). The catalytic activity has been lost in the remaining PGRPs due to mutations of key residues. A peptidoglycan recognition activity was established for some of them like PGRP-SA and peptidoglycan recognition protein SD (PGRP-SD), which are involved in the activation of the Toll pathway. PGRP-SA was the first pattern recognition protein found to act upstream of Toll. A point mutation of PGRP-SA is enough to eliminate Toll activation in response to Gram-positive bacterium Micrococcus luteus in adult flies (Michel et al., 2001). Moreover, a similar phenotype has been observed for Gram-negative binding protein 1 (GNBP1) loss-of-function mutant flies. In addition concomitant overexpression of PGRP-SA and GNBP1 induces Toll activation in the absence of microbial challenge. Thus it has been proposed that these two receptors cooperate to sense Grampositive bacteria and to activate the proteolytic cascade leading to the cleavage of the Toll ligand (Gobert et al., 2003). However Toll activation by Staphylococcus saprophyticus is wild-type in both PGRP-SA and GNBP1 loss-of-function mutant flies and only reduced after infection by Staphylococcus aureus and Enterococcus faecalis. This suggests the existence of other receptors upstream of Toll. Except PGRP-SA, PGRP-SD is the only short extracellular PGRP that is devoid of amidase activity. A gene knockout of PGRP-SD is sufficient to reduce the ability of flies to resist infection by Staphylococcus pyogenes and S. aureus (Bischoff et al., 2004). As for PGRP-SA and GNBP1, overexpression of PGRP-SD alone does not activate the Toll pathway. Moreover concomitant expression of PGRP-SD and GNBP1 fails to induce drosomycin expression. These two results suggest that PGRP-SD may require a co-receptor, which is not GNBP1. To date, the crystal structures of several PGRPs have been solved. They confirm the high level of fold conservation among the families. Two structural studies on PGRP-SA (Chang et al., 2004; Reiser et al., 2004) give explanations for the lack of amidase activity and bring light onto an unusual l,dcarboxypeptidase activity. Furthermore the structure of the PGRP-domain of human PGRP-I␣ in complex with MurNAcl-Ala-d-isoGln-l-Lys (Guan et al., 2004) together with that of Drosophila PGRP-LCx and PGRP-LE in complex with tracheal

cytotoxin (Chang et al., 2006; Lim et al., 2006) provide important insights into the structural bases for the recognition of PGN. However very little is known about the interaction between the PGRPs and their co-receptors and about the mechanism of activation of the proteolytic cascades. To improve our knowledge of the fine-tuned modulation of bacteria recognition in Drosophila we determined the crystal ˚ We benefited structure of PGRP-SD to a resolution of 1.5 A. from the enormous amount of sequence information coming from the 12 complete Drosophila genomes recently studied. Observing the strictly conserved residues at the surface of PGRP-SA and PGRP-SD brings three patches to light; one of them corresponds to the binding site. Comparison with available structures of PGRPs in complex with their ligand suggests a DAP specificity for PGRP-SD. This result is supported by pull-down assays with insoluble PGNs. In addition we show that PGRP-SD is able to recognize DAP-type PGN in vivo. Altogether our data indicate that PGRP-SD is required for the activation of the Toll pathway by DAP-type PGN. 2. Materials and methods 2.1. Protein expression and purification A DNA fragment encoding the PGRP-SD protein was amplified from a Berkeley Drosophila Genome Project cDNA expressed sequence tag clone and was subcloned into an S2 cells expression vector for recombinant protein production. DNA fragments encoding wild-type PGRP-SD was subcloned into the pMT-V5-His vector (Invitrogen) by introducing EcoRI and XhoI sites, respectively 5 and 3 of the PGRP-SD cDNA using the following primers GGGGGAATTCATGACTTGGATCGGTTTGCTC and GGGGCTCGAGCATTTCTTCGGACCAGTTGGG. Stable cell lines were obtained and grown in suspension at 28 ◦ C and kept under selection in 500 mL Schneider’s medium (Biowest) containing 0.5 ␮g/mL puromycin (Euromedex), 100 mg/mL streptomycin, 10,000 U/L penicillin (Biowest), 2 mM glutamax (Gibco) and 10% heat-inactivated fetal bovine serum (FBS, Cambrex). Expression of the secreted protein was induced by the addition of 0.5 mM CuSO4 . After 6 days of induction, cells were aseptically centrifuged, resuspended in 500 mL of fresh medium and induced again for 6 days. The cell culture supernatant was harvested and dialysed against 50 mM Tris pH 7.0, 150 mM NaCl and 10 mM imidazole. The recombinant protein was recovered by nickel affinity chromatography (Chelating Sepharose Fast Flow, Amersham) by elution with the loading buffer supplemented with 250 mM imidazole. Further purification was performed by size exclusion (Superdex 200 HiLoad 26/60, Amersham) in 10 mM Tris pH 7.0 and 100 mM NaCl. The PGRP-SD fractions were pooled and concentrated by centrifugation to 12.4 mg/mL. The two inductions gave similar amounts of protein. 2.2. Crystallization and structure determination Crystals of PGRP-SD were obtained within 2 weeks by the hanging-drop vapour diffusion method at 20 ◦ C with a reservoir

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

solution containing 0.1 M MES pH 6.0 and 25% PEG-mme 2000. For data collection, the crystals were cryoprotected by brief soaking in mother liquor containing 15% (v/v) glycerol. ˚ resolution were collected on an X-ray diffraction data to 1.5 A ADSQ Q210 CCD detector on beam line ID29 at the ESRF (Grenoble, France) and processed with the programs Denzo and Scalepack (Otwinowski and Minor, 1997). The crystals contain one molecule per asymmetric unit. The structure of PGRP-SD was determined by molecular replacement using the program Auto-AMoRE (Navaza, 2001). The crystal structure of PGRPSA (PDB code 1S2J) served as the search model, with data ˚ The rotation and translation functions between 8.0 and 3.5 A. gave both one solution, with final correlation coefficient and Rfac of 26.2% and 48.9%, respectively. Refinement was first performed by several steps of slow cooling followed by an individual B-factor refinement, using CNS (Brunger et al., 1998). The final model was then refined with Refmac5 (Murshudov et al., 1997). During the refinement, the alteration of residues and the positioning of water molecules were done manually with Turbo-Frodo (Roussel and Cambillau, 1991). The final model consists of 169 residues and 252 water molecules. The final refinement statistics are shown in Table 1. MOLSCRIPT, Raster3D and PYMOL were used to generate the structure figures and ALSCRIPT for the sequence alignment. The atomic coordinates and structure factors have been deposited in the Protein Data Bank (http://www.rcsb.org/pdb) under accession number 2RKQ.

2523

2.3. Quantitative real-time PCR key1

The IKKγ , Dif, PGRP-LCΔE and PGRP-SAseml mutant alleles and RpL32, Diptericin, Drosomycin primers are described by Gottar et al. (2002). Briefly, for drosomycin quantification from whole animals, RNA was extracted using RNA TRIzol (Invitrogen). cDNAs were synthesized using SuperScript II (Invitrogen) and PCR was performed using dsDNA dye SYBR green I (Roche Diagnostics, Basel, Switzerland) on a Lightcycler (Roche). All samples were analyzed in duplicate and the amount of mRNA detected was normalized to control RpL32 mRNA values. We used normalized data to quantify the relative levels of a given mRNA according to cycling threshold analysis (DCt). 2.4. PGN-binding assay The assay was performed at 20 ◦ C by incubating 10 ␮g of purified PGRP-SD or PGRP-SA with 250 ␮g of commercial insoluble PGNs S. aureus (Invivogen) or B. subtilis (Fluka), in 100 ␮L of binding buffer containing 20 mM Tris–HCl (pH 7.8) and 300 mM NaCl on a shaking platform for 24 h. Bound protein, retained in the PGN pellet after spinning the incubation mixture at 16,000 × g for 5 min, was washed three times with 0.5 mL of binding buffer followed by a 5-min spin and finally dissolved in 10 ␮L of SDS buffer for SDS-PAGE electrophoresis. The PGNbound proteins were visualized by Coomassie Blue staining. 2.5. Microbial strains

Table 1 Data collection and refinement statistics Data collectiona Space group ˚ Unit cell (A) ˚ Resolution (A) Mean I/σ Completeness (%) Redundancy (%) Rsym b (%)

P21 21 21 a = 37.559; b = 57.438; c = 71.490 20–1.5 10.0 (3.8) 99.9 (98.7) 3.8 (3.7) 7.3 (32.6)

Refinement ˚ Resolution (A) Unique reflections (Rfree set)d Protein atoms Water molecules Rfac c /Rfree d (%)

20–1.5 24153 (1273) 1304 252 15.7/17.3

˚ 2) B factors (A Protein Water molecules

11.3 27.6

rmsd ˚ Bond lengths (A) Bond angles (◦ )

0.010 1.38

Ramachandran plot Most favored regions (%) Allowed regions (%) Additionally allowed regions (%)

92.2 7.8 0

a b c d

˚ Values in parentheses are for the highest resolution shell (1.55–1.50 A). Rsym = h i |Ihi − |/h i Ihi . Rfac = h ||Fobs |−|Fcalc ||/h |Fobs |. Rfree is calculated for a randomly chosen 5% of reflections.

The following microbes have been used in this study: E. coli (1106), M. luteus (CIP A270), B. subtilis (Mo201), S. aureus (they were given by H. Monteil, Universit´e Louis Pasteur, Strasbourg, France). 2.6. Sequence alignment The sequences were searched using TBLASTN on the fly database “flybase.net”. The hits detected were analyzed using multiple gene prediction tools Genescan (http://genes.mit. edu/GENSCAN.html) and Genemark (http://opal.biology. gatech.edu/GeneMark/eukhmm.cgi). All sequences were verified manually. 3. Results and discussion 3.1. Overall structure Peptidoglycan recognition protein SD from Drosophila melanogaster was successfully cloned and expressed at more than 10 mg/L of cell culture in Drosophila S2 cells. PGRP-SD was then purified, crystallized and its crystal structure was determined by molecular replacement using PGRP-SA as a starting model (41% sequence identity with PGRP-SD). The final refined model consists of residues 11–178 of the cloned sequence. The missing N-terminal residues correspond mostly to the extracellular signal peptide. The sequence of PGRP-SD ends at position

2524

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

177. Leucine 178 is the only residue among the 31 of the Cterminal fusion tail that is visible in electron density maps. Two conflicts with the deposited sequence were observed and confirmed both in the sequence of the construction and in the density map. Position 32 is a valine instead of a glutamic acid and position 59 is an arginine instead of a glutamine. PGRP-SD structure contains a central ␤-sheet of six strands, four parallel and two (␤1 and ␤4) antiparallel, three ␣-helices and two 310 turns (Fig. 1A). The first turn (18–20) is situated after the strand ␤1 and is conserved in the other PRGPs structures while the second (100–102) which connects the strands ␤4 and ␤5 is specific to PGRP-SD. Residues 11–34 in PGRP-SD correspond to the N-terminal ‘PGRP-specific segment’ which is present in all PGRPs and which displays a structure that varies substantially within the family. PGRP-SD includes only one disulfide bond linking Cys48 and Cys54. This disulfide bond appears to be present in all known PGRPs, with Drosophila PGRP-LE being the sole exception, indicating its importance in maintaining the structural integrity of the PGRP-domain. In PGRP-SA a second disulfide bridge between Cys11 and Cys134 maintains the Nterminal fragment close to the ␣2-helix. This disulfide bridge is not present in PGRP-SD as the corresponding positions are occupied by Glu11 and Gln134, respectively. However strong interactions between the main chain of Val12 and the side chain of Gln134 play similar role to the disulfide bridge of PGRP-SA by anchoring the N-terminal fragment to the ␣2-helix. In conclusion the PGRP-SD overall structure is very similar to that of ˚ PGRP-SA with a root-mean-square deviation (rmsd) of 1.13 A (Fig. 1B). The most significant differences appear around the N-terminus region and for the loop ␤4-␤5. 3.2. Catalytic site PGRPs with amidase activity show an active site cleft with a zinc cage made of His42, His152 and Cys160, according to PGRP-LB numbering (Kim et al., 2003). Like PGRP-SA, PGRP-SD lacks two of the three Zn-coordinating residues. Thus the corresponding residues are His41, Gly150 and Ser158 for PGRP-SD and Ala41, His150 and Ser158 for PGRP-SD. In addition, the electron density map of PGRP-SD confirms that no metal ion is present in the vicinity of these residues. For all these reasons, PGRP-SD is unlikely to possess any amidase activity. Nevertheless a serine hydrolase activity different from the amidase activity has been supposed in the structural studies of PGRP-SA (Chang et al., 2004; Reiser et al., 2004). On one hand, Reiser et al. described a constellation of residues (Ser158, His41, Thr99 and His98) that resembles the catalytic triad of serine hydrolases, which is composed of serine, histidine and aspartic acid residues. Indeed in PGRP-SA, His41 is hydrogen bonded to Ser158 while Thr99 O␥1 and His98 O occupy positions superimposable to that of the O␦1 and O␦2 atoms of the missing aspartic acid. On the other hand, Chang et al. reported an unusual l,dcarboxypeptidase activity. Based on a mutational analysis, the catalytic activity was attributed to the dyad involving Ser158His42. In PGRP-SD, although the dyad Ser158/His42 does exist, Ser158 makes a rather loose hydrogen bond with His42. More

Fig. 1. Overall structure of PGRP-SD. (A) Ribbon representation of PGRP-SD. The ␤-sheets are in blue, the ␣-helices in red and the turns and unstructured regions in yellow. The secondary structures are labelled from N- to C-terminus. The disulfide bond between Cys48 and Cys54 is drawn in green ball-andsticks. (B) Superposition of PGRP-SD, PGRP-SA and PGRP-I␣. The backbone structures are represented in coils, oriented as in (A). The structures of PGRPSD, PGRP-SA and PGRP-I␣ are in blue, green and yellow, respectively. (C) Sequence alignment of PGRP-SD, PGRP-SA and PGRP-I␣. The sequences were aligned with Clustalw program. The figure was drawn using Alscript program. The residues strictly conserved in the PGRP-SD and PGRP-SA sequence families are highlighted in blue and green boxes, respectively. The residues of PGRP-I␣ in contact with PGN are highlighted in yellow boxes. The secondary structure elements from PGRP-SD are indicated above the sequences. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

interesting is the comparison with the modified triad described by Reiser et al. The position 41 is highly variable in the PGRP recognition subgroup and is occupied by an alanine in PGRPSD. Thus the modified triad of PGRP-SA is not conserved. However, His150 is fortuitously oriented in such way that its

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

Fig. 2. Superimposition of PGRP-SD and PGRP-SA modified triads. PGRPSD is in blue and PGRP-SA in green. Hydrogen bonds involving Ser158 are displayed in dotted lines. The atoms Nδ1 of His150 in PGRP-SD and His41 in PGRP-SA are located in a similar position. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

N␦1 atom superimposes to the same atom of PGRP-SA His41. As a matter of fact, PGRP-SD His150 is hydrogen bonded to Ser158 (Fig. 2). Moreover, Ser154 O␥ atom and Phe98-carbonyl are well located to complete a modified triad made of His150, Ser158 and carbonyl oxygens of Ser154 and of Phe98. 3.3. Sequence alignment Genome sequences of 12 Drosophila species have been released in near past. Molecular data have suggested that these species evolved and diverged during the last 63 million years (Tamura et al., 2004). The sequences of the 12 PGRP-SA and of the 12 PGRP-SD have been aligned in order to define the conserved and variable residues and regions. The PGRP-SA sequence family (which comprises the sequences of the 12 PGRP-SA) displays an overall conservation higher than the PGRP-SD sequence family with 57% (96 residues) and 34% (58 residues) identity, respectively (Fig. 1C). Twenty-six of the 33 residues that are identical in both PGRP-SD and PGRP-SA families are also conserved in PGRP-I␣, PGRP-LCx and PGRP-LE. 3.4. Conserved surface residues A number of studies have examined the attributes of protein binding sites (Jones and Thornton, 1997). Although binding sites

2525

on enzyme surfaces typically consist of a concave cleft shape, this is not the case for the larger protein–protein complexes. For example the shape of dimer-binding sites is often quite flat and practically indistinguishable from the rest of the protein surface. Although interfaces bury a large extent of nonpolar surface area, the magnitude of the hydrophobic effect is insufficient to identify binding sites. But then it has been shown that the presence of structurally conserved residues enables to distinguish between binding sites and the remainder of the molecular surface (Ma et al., 2003). A recent study (Wang et al., 2007) proposes a novel method to predict interaction sites by using the evolution rate of the surface residues. The protein–protein interaction residues are more likely to remain unchanged during evolution. We took advantage of the 12 sequenced Drosophila genomes to look for evolutionary conserved patches on the molecular surfaces of PGRP-SD and PGRP-SA. Observing the strictly conserved surface residues brings three regions to light. One of them is the PGN-binding site described below. The two others have been named as regions A and B. Interestingly the three conserved regions are pointing to three distinct directions (Fig. 3A). This could enable interactions with several partners. Region A is constituted on one side by the residues 18–27 belonging to the N-terminal part, and on the other side by the C-terminus extremity of helix ␣2 (residues 131–136). The central area corresponds to the hairpin linking strand ␤3–␤4 (residues 73–94) (Fig. 3B). It contains the following strictly conserved surface residues: Ala22, Pro24, Gly27, Glu88, Ser91, Ser93 and Gln94. ˚ 2 cenRegion A is a rather flat circular surface of about 300 A tered on Arg17 which is also strictly conserved but not exposed. ˚ length and 10-A ˚ Region B is a narrow cleft of about 25-A width along the ␣2-helix (Fig. 3C). The bottom of this cleft is composed of mainly buried and hydrophobic residues: Pro34, Pro120, Leu125, Leu132, Val136, Leu141, Tyr145 and Trp170. All these residues are identical in PGRP-SA and are also conserved in both sequence families, except for position 132, which is Leu or Ile. 3.5. PGN-binding site PGRP-SD presents the classical L-shaped cleft for PGN binding as found in all other PGRP structures. The bottom of the groove is formed by the central ␤-sheet while the walls are constituted on one side by the loops ␤2–␣1, ␤6–␣3 and ␤4–␤5 and on the other side by the C-terminus part of helix ␣1 and the loop ␣1–␤3. The crystal structures of PGRP-I( in complex with Lys-type muramyl tripeptide (Lys-MTP) (Guan et al., 2004), and that of PGRP-LCx (Chang et al., 2006) and PGRP-LE (Lim et al., 2006) in complex with tracheal cytotoxin, a DAP-type PGN analogue, were superimposed on the structure of PGRPSD. As the binding of Lys-MTP and TCT to PGRPs does not differ substantially except for the stabilization of the diamino pimelic acid (see below) we decided to refer to the structure of PGRP-I␣ for the description of the binding site. Lys-MTP makes extensive contacts with 16 residues lining the binding cleft of PGRP-I␣ (Guan et al., 2004). Among them only the following seven residues are identical in PGRP-SD: His42, Thr43, Phe71, Tyr76, Asn103, His150 and Ser158 (Fig. 3A). Six of them are

2526

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

Fig. 3. Conserved residue patches at the surface of PGRP-SD. (A) Molecular surface representation of PGRP-SD binding site. The orientation of the molecule is such that the binding site stands in the plan of the sheet. The residues that are strictly conserved within the SD family are colored in blue. The residues that are identical in 11 out of the 12 sequences are colored in orange. Light and dark colors stand for solvent accessibility (below and above 40% accessibility, respectively). The seven residues that are identical in PGRP-I␣ and PGRP-SD are labelled in yellow. The PGN represented in ball-and-stick was docked into PGRP-SD binding site by superimposing PGRP-SD to PGRP-I␣/PGN complex. Black arrows indicate the localization of regions A and B. (B) Molecular surface representation of region A. (C) Molecular surface representation of region B. In (B) and (C), the color code is the same as in (A). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

strictly conserved in the PGRP-SD sequence family while the seventh at position 71 can either be Phe or Tyr. For comparison 10 residues are identical in PGRP-SA, 7 of them being strictly conserved in the PGRP-SA sequence family. Among the remaining nine residues not identical between PGRP-SD and PGRP-I␣, Ala99, which corresponds to Thr265 in PGRP-I␣, is strictly conserved in the PGRP-SD sequence family. Position 98, corresponding to His264 in PGRP-I␣, is always taken by bulky hydrophobic residue Phe or Ile. His264 and Thr265 together with His316 form a hydrogen bond network that contributes to the positioning of the loop ␤4-␤5 in PGRP-I␣. In PGRP-SA, the loop is maintained in a similar position through a comparable

bond network formed by His98, Thr99 and His41. In PGRP-SD, the bulky residue Phe98 together with Pro101 (not conserved in the PGRP-SD sequence family) is responsible for the protrusion of the loop ␤4–␤5, which in turn modifies slightly the shape of the binding groove. 3.6. Structural determinants governing the specificity of recognition One important question is how PGRPs can discriminate between PGN containing DAP or lysine residue at the third position of the stem peptide. These two amino acids differ from one

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

another only by the presence or absence of a carboxyl group on their side chain. The structure of PGRP-I␣ gave the first insight on the molecular basis for lysine-type PGN recognition. The Asn236-Phe237 pair forms a number of VDW contacts with the side chain of the lysine. In PGRP-SA, the corresponding sequence is Asp70-Phe71. In the PGRP-SA sequence family, the residue 70 is either an aspartic acid or an asparagine and the residue 71 is a tyrosine, or a phenylalanine for D. melanogaster. The nature of these two residues is in accordance with the lysine-type specificity shown for PGRP-SA. In PGRP-SD the corresponding sequence is Lys70-Phe71. Residue 70 is either a lysine or in most cases an arginine (10 out of the 12 sequences). Lys70 together with Lys68 in PGRP-SD contribute to a drastic change in the electrostatic surface in comparison to PGRP-SA. The resulting positively charged patch seems not compatible with the anchoring of a lysine residue (Fig. 4A). Recently, the structural studies of PGRP-LE (Lim et al., 2006) and PGRPLC (Chang et al., 2006) in complex with tracheal cytotoxin,

2527

a DAP-type PGN analogue, unraveled the key role of an arginine residue (Arg254 and Arg413 for PGRP-LE and PGRP-LC, respectively). This residue provides the guanidinium group that forms a bidentate salt bridge with the carboxylate group of the DAP residue at the bottom of the PGN-binding groove. The arginine main chain is located on the back side and its long side chain crosses the molecule to contact the PGN ligand. This residue is conserved in all of the known DAP-type PGN-interacting PGRPs. The corresponding residue in PGRP-SA is a threonine. The mutation of Arg254 into threonine in PGRP-LE induces a 13-fold decrease of its binding constant with DAP-type PGN (Lim et al., 2006). In PGRP-SD, the corresponding residue is Arg90, which fully superimposes on Arg254 and Arg413 of PGRP-LE and PGRP-LC, respectively (Fig. 4B). The presence of Lys68 and Lys70 that creates a positive charged patch together with the striking similarity in the position of Arg90 compared with PGRP-LE and PGRP-LC strongly suggest a preference for DAP-type PGN binding by PGRP-SD.

Fig. 4. Determinants of PGRP-SD binding specificity. (A) Electrostatic surfaces of PGRP-SD (left) and PGRP-SA (right). Surface potentials were calculated using the program APBS. Positive potential is depicted in blue and negative potential in red. The residue Arg90 is labelled. (B) Location of Arg90. The structure of PGRP-SD (in blue), PGRP-LC (yellow) and PGRP-LE (orange) in complex with TCT (in ball-and-stick representation) have been superimposed. The side chain of Arg90 in PGRP-SD fully superimposes that of Arg413 and Arg254 in PGRP-LC and PGRP-LE, respectively. The view is rotated by about 90◦ from (A) around a vertical axis. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

2528

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

Fig. 5. In vitro and in vivo functional studies. (A) Pull-down of PGRP-SA and PGRP-SD by insoluble PGN from Gram-positive and Gram-negative bacteria. The lines are labelled with I and B, which correspond to the input and bound fraction, respectively. (B) Drosomycin (left) and Diptericin (right) mRNA induction after infection by various bacteria. The value obtained for the wild-type flies (control) after M. luteus injection was arbitrarily set to 100. Each histogram corresponds to the mean value of three independent experiments. *Indicates that the difference between control and PGRP-SD3 values is statistically significant (P < 0.05). RpL32 is used as an internal control.

3.7. Functional studies Drosomycin and diptericin RNA levels are used here as molecular read outs for Toll and Imd pathways activation, respectively. It was already shown that the levels of Toll activation are similar in wild-type and PGRP-SD mutant flies challenged by several bacteria containing Lys-type PGN (Bischoff et al., 2004). Using quantitative real-time PCR, we further confirmed this result for another Gram-positive bacteria, M. luteus (Fig. 5B). It has been reported that DAP-type containing bacteria are weak inducers of the Toll pathway. Induction of drosomycin transcription after infection by bacteria carrying DAP-type PGN as B. subtilis and E. coli in wt flies represents about 25% of the induction by M. luteus. This induction is notably reduced in both PGRP-SD and PGRP-SA mutant flies, reaching levels comparable to those found in Dif mutant. Diptericin expression, after a challenge with B. subtilis and E. coli, is unaffected in PGRP-SD mutant flies indicating that PGRP-SD is not involved in the Imd pathway activation (Fig. 5B). We have analyzed the ability of PGRP-SD to bind to lysinetype and DAP-type PGN using an in vitro assay. This was achieved by pulling down the protein with insoluble PGN. Fig. 5A shows that PGRP-SD does not bind to lysine-type PGN from S. aureus but binds to DAP-type PGN from the Gram-positive B. subtilis. Using the same assay, we found that PGRP-SA binds to lysine-type PGN from S. aureus but not to amidated DAP-type PGN from the Gram-positive B. subtilis, that is in accordance with the literature (Chang et al., 2004). Although it should be emphasized that the sensitivity of the pulldown assays does not allow to compare the differential binding

of PGRP-SA or PGRP-SD, these results are overall in good agreement with in vivo data. 4. Discussion The structure of PGRP-SD shows the classical PGN-binding site found in the other PGRPs whose crystal structure has been solved. The fold is highly conserved throughout the family. The presence of an arginine residue at the bottom of the PGN-binding site strongly suggests a DAP-type specificity for PGRP-SD. Binding assays with insoluble PGN corroborate this result: PGRP-SD binds to DAP-type and not to lysine-type PGN. Altogether, the above results indicate that PGRP-SD is a DAP-type recognition protein. However, genetic studies show that PGRPSD is not required for the Imd pathway activation (Fig. 5B), the main cascade triggered by this class of elicitors. Although DAP-type PGNs are mainly elicitors of the Imd pathway, they can also activate the Toll pathway but to a lesser extent than Lys-type PGN (Fig. 5B). Using qRT-PCR, we show that Toll pathway activation after infection by DAP-type PGN containing bacteria is clearly reduced in PGRP-SD mutant flies. These results demonstrate that PGRP-SD recognizes DAP-type PGN in vivo but that this recognition leads to Toll pathway rather than to Imd pathway activation. Although PGRP-SD does not bind in vitro to Lys-type PGN, flies carrying a protein null mutation for this gene are prone to be infected by Gram-positive bacteria such as S. aureus. A possible explanation to this apparently contradicting observation is that PGRP-SD plays a role in some Lys-type PGN detection but without binding directly to PGN. Recent studies have pointed out the importance of molecular association for the detection of micro-

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

organisms in Drosophila. This has been clearly demonstrated for the activation of the Imd pathway by the structural study of the complex between PGRP-LCa and PGRP-LCx ectodomains. Although PGRP-LCa is an essential component of the Imd receptor, it has lost all the PGN binding ability (Chang et al., 2005). As far as Toll pathway activation is concerned, physical interactions between PGRP-SA and GNBP1 have been reported using recombinant protein (Wang et al., 2006). It has also been shown that clustering of PGRP-SA molecules on polymeric peptidoglycan is required for the activation of the prophenoloxidase cascade (Park et al., 2007). Another study showed that flies with the PGRP-SA; PGRP-SD double mutation IS highly susceptible to Gram-positive bacteria infection (Bischoff et al., 2004). In order to combine all these results with our findings on the DAP specificity of PGRP-SD we propose the following model. The receptor responsible for the Toll pathway activation is a large molecular complex containing at least PGRP-SA, GNBP1 and PGRP-SD. When one of these proteins is mutated, the resulting complex is less functional as shown for PGRP-SA and GNBP1 loss-of-function mutants (Gobert et al., 2003) and for PGRP-SD gene knockout flies (Bischoff et al., 2004). The smaller effect observed for the latter is explained by its DAP-type specificity of recognition. We postulate that inside the activation complex PGN recognition is devoted to PGRP-SA and PGRP-SD. This is in agreement with the results obtained with the PGRP-SA; PGRP-SD double mutation (Bischoff et al., 2004). Without any possibility to detect PGN, the activation complex is absolutely unable to respond to bacterial infection. Additional studies are necessary to confirm or infirm this model. Direct interaction between PGRP-SD and the other known recognition molecules has to be shown. The role of the region of surface conserved residues will be evaluated by mutagenesis studies. Acknowledgments We would like to thank Dr. Hakan Steiner for the gift of recombinant PGRP-SA and the European Synchrotron Radiation Facility (ESRF) at Grenoble and in particular the beamline ID29 staff for their assistance. This work was supported by the Centre National de la Recherche Scientifique (CNRS-ATIP program to AR), the Agence Nationale de la Recherche (ANRMIME program to AR and JR), the ACI jeunes chercheurs and the Fondation pour la Recherhe M´edicale (JR). References Bischoff, V., Vignal, C., Boneca, I.G., Michel, T., Hoffmann, J.A., Royet, J., 2004. Function of the drosophila pattern-recognition receptor PGRP-SD in the detection of Gram-positive bacteria. Nat. Immunol. 5, 1175–1180. Bischoff, V., Vignal, C., Duvic, B., Boneca, I.G., Hoffmann, J.A., Royet, J., 2006. Downregulation of the Drosophila immune response by peptidoglycanrecognition proteins SC1 and SC2. PLoS Pathog. 2, e14. Brunger, A.T., Adams, P.D., Clore, G.M., DeLano, W.L., Gros, P., GrosseKunstleve, R.W., Jiang, J.S., Kuszewski, J., Nilges, M., Pannu, N.S., Read, R.J., Rice, L.M., Simonson, T., Warren, G.L., 1998. Crystallography & NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr. D: Biol. Crystallogr. 54, 905–921. Chang, C.I., Pili-Floury, S.S., Herve, M., Parquet, C., Chelliah, Y., Lemaitre, B., Mengin-Lecreulx, D., Deisenhofer, J., 2004. A Drosophila pattern

2529

recognition receptor contains a peptidoglycan docking groove and unusual l,d-carboxypeptidase activity. PLoS Biol. 2, E277. Chang, C.I., Ihara, K., Chelliah, Y., Mengin-Lecreulx, D., Wakatsuki, S., Deisenhofer, J., 2005. Structure of the ectodomain of Drosophila peptidoglycan-recognition protein LCa suggests a molecular mechanism for pattern recognition. Proc. Natl. Acad. Sci. U.S.A. 102, 10279–10284. Chang, C.I., Chelliah, Y., Borek, D., Mengin-Lecreulx, D., Deisenhofer, J., 2006. Structure of tracheal cytotoxin in complex with a heterodimeric patternrecognition receptor. Science 311, 1761–1764. Dziarski, R., 2004. Peptidoglycan recognition proteins (PGRPs). Mol. Immunol. 40, 877–886. Gobert, V., Gottar, M., Matskevich, A.A., Rutschmann, S., Royet, J., Belvin, M., Hoffmann, J.A., Ferrandon, D., 2003. Dual activation of the Drosophila toll pathway by two pattern recognition receptors. Science 302, 2126–2130. Gottar, M., Gobert, V., Michel, T., Belvin, M., Duyk, G., Hoffmann, J.A., Ferrandon, D., Royet, J., 2002. The Drosophila immune response against Gram-negative bacteria is mediated by a peptidoglycan recognition protein. Nature 416, 640–644. Guan, R., Roychowdhury, A., Ember, B., Kumar, S., Boons, G.J., Mariuzza, R.A., 2004. Structural basis for peptidoglycan binding by peptidoglycan recognition proteins. Proc. Natl. Acad. Sci. U.S.A. 101, 17168–17173. Hoffmann, J.A., 2003. The immune response of Drosophila. Nature 426, 33–38. Jang, I.H., Chosa, N., Kim, S.H., Nam, H.J., Lemaitre, B., Ochiai, M., Kambris, Z., Brun, S., Hashimoto, C., Ashida, M., Brey, P.T., Lee, W.J., 2006. A spatzle-processing enzyme required for toll signaling activation in Drosophila innate immunity. Dev. Cell 10, 45–55. Jones, S., Thornton, J.M., 1997. Analysis of protein–protein interaction sites using surface patches. J. Mol. Biol. 272, 121–132. Kim, M.S., Byun, M., Oh, B.H., 2003. Crystal structure of peptidoglycan recognition protein LB from Drosophila melanogaster. Nat. Immunol. 4, 787–793. Lemaitre, B., Kromer-Metzger, E., Michaut, L., Nicolas, E., Meister, M., Georgel, P., Reichhart, J.M., Hoffmann, J.A., 1995. A recessive mutation, immune deficiency (imd), defines two distinct control pathways in the Drosophila host defense. Proc. Natl. Acad. Sci. U.S.A. 92, 9465–9469. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spatzle/toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Ligoxygakis, P., Pelte, N., Hoffmann, J.A., Reichhart, J.M., 2002. Activation of Drosophila toll during fungal infection by a blood serine protease. Science 297, 114–116. Lim, J.H., Kim, M.S., Kim, H.E., Yano, T., Oshima, Y., Aggarwal, K., Goldman, W.E., Silverman, N., Kurata, S., Oh, B.H., 2006. Structural basis for preferential recognition of diaminopimelic acid-type peptidoglycan by a subset of peptidoglycan recognition proteins. J. Biol. Chem. 281, 8286– 8295. Ma, B., Elkayam, T., Wolfson, H., Nussinov, R., 2003. Protein–protein interactions: structurally conserved residues distinguish between binding sites and exposed protein surfaces. Proc. Natl. Acad. Sci. U.S.A. 100, 5772– 5777. Michel, T., Reichhart, J.M., Hoffmann, J.A., Royet, J., 2001. Drosophila toll is activated by Gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature 414, 756–759. Murshudov, G.N., Vagin, A.A., Dodson, E.J., 1997. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D: Biol. Crystallogr. 53, 240–255. Navaza, J., 2001. Implementation of molecular replacement in AMoRe. Acta Crystallogr. D: Biol. Crystallogr. 57, 1367–1372. Otwinowski, Z., Minor, W., 1997. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307–326. Park, J.W., Kim, C.H., Kim, J.H., Je, B.R., Roh, K.B., Kim, S.J., Lee, H.H., Ryu, J.H., Lim, J.H., Oh, B.H., Lee, W.J., Ha, N.C., Lee, B.L., 2007. Clustering of peptidoglycan recognition protein-SA is required for sensing lysine-type peptidoglycan in insects. Proc. Natl. Acad. Sci. U.S.A. 104, 6602–6607. Reiser, J.B., Teyton, L., Wilson, I.A., 2004. Crystal structure of the Drosophila peptidoglycan recognition protein (PGRP)-SA at 1.56 A resolution. J. Mol. Biol. 340, 909–917. Roussel, A., Cambillau, C., 1991. In: Graphics, S. (Ed.), Silicon Graphics Geometry Partners Directory. Turbo-Frodo, Mountain View, CA, p. 86.

2530

P. Leone et al. / Molecular Immunology 45 (2008) 2521–2530

Tamura, K., Subramanian, S., Kumar, S., 2004. Temporal patterns of fruit fly (Drosophila) evolution revealed by mutation clocks. Mol. Biol. Evol. 21, 36–44. Wang, L., Weber, A.N., Atilano, M.L., Filipe, S.R., Gay, N.J., Ligoxygakis, P., 2006. Sensing of Gram-positive bacteria in Drosophila: GNBP1 is needed to process and present peptidoglycan to PGRP-SA. Embo J. 25, 5005–5014. Wang, H.Y., Chien, H.C., Osada, N., Hashimoto, K., Sugano, S., Gojobori, T., Chou, C.K., Tsai, S.F., Wu, C.I., Shen, C.K., 2007. Rate of evolution in brain-expressed genes in humans and other primates. PLoS Biol. 5, e13.

Werner, T., Liu, G., Kang, D., Ekengren, S., Steiner, H., Hultmark, D., 2000. A family of peptidoglycan recognition proteins in the fruit fly Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 97, 13772– 13777. Zaidman-Remy, A., Herve, M., Poidevin, M., Pili-Floury, S., Kim, M.S., Blanot, D., Oh, B.H., Ueda, R., Mengin-Lecreulx, D., Lemaitre, B., 2006. The Drosophila amidase PGRP-LB modulates the immune response to bacterial infection. Immunity 24, 463–473.