- Email: [email protected]
Crystal Structure of Inositol 1-Phosphate Synthase from Mycobacterium tuberculosis, a Key Enzyme in Phosphatidylinositol Synthesis
Structure, Vol. 10, 393–402, March, 2002, 2002 Elsevier Science Ltd. All rights reserved.
PII S0969-2126(02)00718-9
Crystal Structure of Inositol 1-Phosphate Synthase from Mycobacterium tuberculosis, a Key Enzyme in Phosphatidylinositol Synthesis Richard A. Norman,1 Mark S.B. McAlister,2 Judith Murray-Rust,1,4 Farahnaz Movahedzadeh,3 Neil G. Stoker,3 and Neil Q. McDonald1,4,5 1 Structural Biology Laboratory Cancer Research U.K. 44 Lincoln’s Inn Fields London WC2A 3PX United Kingdom 2 Bloomsbury Centre for Structural Biology Birkbeck College Malet Street London WC1E 7HX United Kingdom 3 Department of Infectious and Tropical Diseases London School of Hygiene & Tropical Medicine London WC1E 7HT United Kingdom 4 School of Crystallography Birkbeck College Malet Street London WC1E 7HX United Kingdom
Summary Phosphatidylinositol (PI) is essential for Mycobacterium tuberculosis viability and the enzymes involved in the PI biosynthetic pathway are potential antimycobacterial agents for which little structural information is available. The rate-limiting step in the pathway is the production of (L)-myo-inositol 1-phosphate from (D)-glucose 6-phosphate, a complex reaction catalyzed by the enzyme inositol 1-phosphate synthase. We have determined the crystal structure of this enzyme from Mycobacterium tuberculosis (tbINO) at 1.95 A˚ resolution, bound to the cofactor NADⴙ. The active site is located within a deep cleft at the junction between two domains. The unexpected presence of a zinc ion here suggests a mechanistic difference from the eukaryotic inositol synthases, which are stimulated by monovalent cations, that may be exploitable in developing selective inhibitors of tbINO. Introduction Inositol and inositol-containing compounds such as phosphatidylinositol (PI) are essential in all eukaryotes where they play important roles in cell signaling, membrane trafficking (for reviews see [1, 2]), cell survival [3], and even DNA repair [4]. Although rarely found in prokaryotes, inositol and PI are known to be present in mycobacteria [5], a genus that contains major human pathogens such as Mycobacterium leprae and Mycobacterium tuberculosis. PI is a precursor of phosphatidylinositol dimannoside (PIM2) and of lipoarabinomannan (LAM), which are important structural components 5
Correspondence: [email protected]
of the complex mycobacterial cell wall. These molecules are also involved in infection and pathology of M. tuberculosis; PIM2 has been implicated in entry into host cells [6], while LAM has been shown to modulate the host immune response, induce cytokines such as TNF [7], and act as a virulence factor contributing to the persistence of mycobacteria within mononuclear phagocytes [8]. Inositol is also a component of the major mycobacterial thiol, mycothiol, essential for maintaining a reduced environment inside the cell [9, 10]. Mutants of Mycobacterium smegmatis that are unable to produce mycothiol grow very poorly in vitro [11], while PI mutants are not viable [12]. Thus, enzymes in the inositol synthesis pathway are potentially attractive antituberculosis drug targets. In all organisms studied to date, PI is synthesized by the exchange of the CMP moiety of CDP-diacyglycerol for inositol [13, 14]. Inositol is synthesized from (D)-glucose 6-phosphate (G-6-P) by the concerted action of inositol-1-phosphate synthase (INO, EC 5.5.1.4) and inositol-1-phosphate phosphatase. The rate-limiting step in inositol synthesis is the conversion of G-6-P to (L)-myoinositol-1-phosphate (I-1-P) by INO in a three-stage reaction involving (1) oxidation of G-6-P to 5-keto-(D)glucose 6-phosphate, (2) cyclization to myo-inosose-21-phosphate, and (3) reduction to I-1-P (Figure 1). INO requires NAD⫹ for this reaction and is inhibited by glucitol-6-phosphate and 2-deoxy-glucose-6-phosphate and stimulated by NH4⫹ [15]. Sequence analysis has shown that INOs cluster into two distinct phylogenetic branches, the mycobacterial and archaeal enzymes (ⵑ40 kDa) and the larger (ⵑ60 kDa) eukaryotic orthologs [16]. Despite the apparent sequence divergence between these two branches, INO from Mycobacterium tuberculosis (tbINO) is able to functionally replace the yeast INO protein in yeast INO deletion strains [17]. Although INOs from various organisms have been characterized and some of the reaction intermediates identified, it is still unclear how the enzyme carries out the conversion of (D)-glucose 6-phosphate to (L)-myoinositol 1-phosphate. In order to elucidate the catalytic mechanism and to determine whether this inositol-synthesizing enzyme may be a suitable target for designing antituberculosis drugs, we have solved the crystal structure of tbINO in a binary complex with the cofactor NAD⫹ and a Zn2⫹ ion. This has enabled us to localize the active site and provide some structural insights into the catalytic mechanism of INOs. Structure-based sequence analysis between the mycobacterial/archaeal and the eukaryotic INOs suggest that the details of the substrate binding and mechanism may exhibit some subtle variations which may be exploited for drug design. Results and Discussion Structure Determination Crystals of recombinant wild-type and selenomethionine-substituted tbINO both belong to the space group Key words: crystal structure; inositol; inositol 1-phosphate synthase; Mycobacterium tuberculosis; phosphatidylinositol
Structure 394
Figure 1. Reaction Catalyzed by tbINO
P4212 and the asymmetric unit contains a single tbINO protomer. The three-dimensional structure of tbINO was determined at 2.6 A˚ resolution by the multiwavelength anomalous diffraction (MAD) method, using a crystal of a selenomethionine-substituted form of the enzyme. Experimental electron density is shown in Figure 2A. The structure was refined to an R factor of 23.7% and an R free of 25.0% and then used as a starting point for refinement against the 1.95 A˚ resolution native dataset that converged to an R factor of 21.1% and R free of 23.9% (Table 1). Refined electron density is shown in Figure 2B. Recombinant tbINO protein spans residues 1–367; however, for both structures no density was observed for residues 1–14 and 241–267. Both the native and selenomethionine-substituted structures have an NAD⫹ moiety and a zinc ion in the active site. The tbINO Protomer Structure A tbINO protomer (Figures 3A and 3B) comprises two domains connected by two hinge regions; domain 1 (D1) encompasses a Rossmann fold domain (D1a, residues 15–199) with a C-terminal extension (D1b, residues 312– 367), and domain 2 (D2, residues 200–311) includes the majority of interface residues involved within the tbINO tetramer. A cleft between D1 and D2 adjacent to the NAD⫹ cofactor establishes the location of the active site and is lined with highly conserved residues found in all INO sequences. D1 comprises two parts—an N-terminal Rossmann fold (D1a, blue in Figures 3A and 3B) and an elaboration of the domain by residues at the C terminus of the enzyme (D1b, green in Figures 3A and 3B). D1a differs from a canonical Rossmann fold in having two unusually long connections between secondary structure elements, one between h1 and 2, and another between 2 and 4. In particular, the region between 2 and 4 includes a four-residue helix c1 that is reminiscent of helix 2 of the Rossmann ␣␣ motif but is aligned in the opposite sense. The extended element c2 forms an irregular strand, as if the third strand of a ␣␣ motif were twisted away from the sheet, and the sequence continues into helices h2 and h3. Residues 312–367 (domain D1b) at the C-terminal portion of tbINO form secondary structure elements h8, h9, h10, and their connecting loops, forming a C-terminal extension to D1a. Given its intimate connection to D1a, it can be considered as part of the same overall domain and appears important for overall structural stability. In particular, h8 is buried between part of the long connection between h1 and 2, contacts helix h9, and makes hydrophobic contacts with residues on strands 4, 5,
6. Residues toward the N terminus of h8 also form part of the pocket occupied by F295 from a neighboring molecule in the dimer (see below) and may also play a part in substrate binding. Domain D2 has a higher degree of sequence conservation than D1 amongst INO orthologs. It consists of a long four-stranded sheet (7–10) flanked by helices h6 and h7 and the missing residues 241–267 (dashed line in Figure 3B). Strands 7, 9, 10 are antiparallel, while 8 is parallel and forms hydrogen bonds with 10. Strand 10 is the key strand that pairs with an equivalent strand in the tbINO dimer. The missing residues are in a region adjacent to the active site cleft and contain the conserved K248-x-x-x-K252 motif. Fold Comparison of tbINO to Other Enzymes The closest structural relatives to the tbINO fold in the FSSP database [18] are meso-diaminopimelic acid dehydrogenase (DAP) from Corynebacterium glutamicum (PDB codes 1dap, 2dap, and 3dap) [19], as prevoiusly predicted by Bachhawat and Mande [17], and dihydrodipicolinate reductase (DHPR) from Escherichia coli (PDB codes 1dru, 1dih, 1drw, 1drv, and 1arz) [20], both of which are classified in SCOP [21] as members of the glyceraldehyde-3-phosphate dehydrogenase-like (GAPDH-like) family of NAD(P) Rossmann fold domains (Figure 4). This family of enzymes carries out the reduction of various substrates using NAD(P) as the cofactor. The main differences/similarities include the absence of tbINO helix h2 in DAP and DHPR, whereas h3 is equivalent to the typical helix between the two ␣␣ motifs. In DAP, the D1b domain was classified as part of the dimerization domain. A long helix corresponding to tbINO h8 is common to all three protomers, although DAP and DHPR lack a long h1-2 connection to enclose it. The remainder of the tbINO C-terminal residues (330– 367) are a longer sequence than in DAP or DHPR, and forms two antiparallel helices h9 and h10. One important observation is that the residues equivalent to the missing loop in tbINO (residues 241–267) form regular secondary structures that help to define the active site cavity of DHPR, while in DAP this region is longer (150–239 of the DAP sequence) and it was classified as a separate domain of six strands and five helices [22]. Given the differences in the relative orientations of the D1 and D2 domains of tbINO, DAP and DHPR caused by flexible interdomain linkers superpositions of the two domains can only be carried out independently. For DAP (PDB code 1dap, molecule A) alignment of the Rossmann fold domain with D1 of tbINO gave an rms fit of 1.97 A˚ for 139 C␣ atoms, and alignment of the dimeriza-
Structure of the M. tuberculosis Inositol Synthase 395
Figure 2. Electron Density (A) Stereo view of the 2.60 A˚ experimental SeMet MAD map corresponding to the NAD contoured at 1.2 (blue) to within 2 A˚ of the NAD molecule. (B) Stereo view of the 1.95 A˚ refined 2Fo ⫺ Fc map corresponding to the NAD contoured at 1.2 (blue) to within 2 A˚ of the NAD molecule. Nitrogen atoms are blue; oxygen atoms, red; phosphorous atoms, purple; carbon atoms and bonds, light purple. All molecular graphics were made with Bobscript [37] and Raster3D [38].
tion domain with D2 of tbINO gave an rms fit of 2.31 A˚ for 58 C␣ atoms. For DHPR (PDB code 1arz, molecule B) the rms fit for the D1 domain was 1.94 A˚ for 134 C␣ atoms and 2.14 A˚ for 38 C␣ atoms for the D2. The sequence identities between the D1 domain of tbINO and the Rossmann fold domains of DAP and DHPR are 23% and 20%, respectively, and between the D2 domain and the dimerization/tetramerization domains of DAP and DHPR are 10% and 8%, respectively. There is no sequence identity between the tbINO active site residues and the corresponding regions of DAP and DHPR. Despite the absence of significant sequence homology and some overall differences in tertiary fold, tbINO
shares a topologically conserved core with DAP and DHPR. This conserved core consists of all of D1 for DAP (except helices h2, h9, and h10) and DHPR (except helices h2, h3, h9, and h10) and all of D2 for DAP (except strand 8) and DHPR (except helix h7 and strand 8). This structural conservation indicates that these three enzymes may have evolved from a common ancestor, a distant relative of the GAPDH-like family of NAD(P) binding enzymes. Further, all three enzymes form similar dimers and both tbINO and DHPR form tetramers with identical arrangements of protomers (see below). Interestingly, the single-stage reaction catalyzed by the majority of GAPDH-like family of enzymes is a reduction
Structure 396
Table 1. Data Collection and Refinement Statistics
Resolution (A˚) Spacegroup Z Cell dimensions (A˚) a b c Wavelength (A˚) Observed reflections Unique reflections Highest resolution shell (A˚) Redundancya I/(I) Completeness (%) Rmerge (%) Rwork (%) Rfreeb (%) Rms bond lengths (A˚) Rms bond angles (⬚) Number of non-hydrogen atoms Number of waters a b
Native
SeMet
1.95 P4212 1
2.60 P4212 1
116.2 116.2 64.5 ⫽ 0.9790 80,189 29,486 1.98–1.95 2.7 (2.6) 7.7 (2.8) 89.9 (86.6) 7.1 (33.8) 21.1 23.9 0.006 1.5 2,559 171
115.8 115.8 69.2 2 ⫽ 0.9792 86,188 14,782 2.66–2.60 5.8 (5.2) 12.5 (5.6) 96.8 (80.8) 5.4 (13.1) 20.9 22.8 0.007 1.5 2,554 28
1 ⫽ 0.9790 86,574 14,777 2.66–2.60 5.9 (5.3) 12.7 (6.2) 97.3 (83.9) 5.2 (12.1)
3 ⫽ 0.9393 87,232 14,732 2.66–2.60 5.9 (5.3) 12.6 (5.8) 96.5 (79.6) 5.3 (13.0)
Values in parentheses correspond to the high resolution shell. Rfree was calculated against 5% of the complete dataset excluded from refinement.
that is also the third step in the conversion of G-6-P to I-1-P. The active site of tbINO may have evolved to accommodate a more complex reaction mechanism while retaining a similar structural framework. Oligomer Formation A tbINO tetramer with 222 symmetry is generated from the single protomer present in the asymmetric unit by three orthogonal crystallographic dyad axes (Figures 5A and 5B). The tetramer is best visualized as an assembly of two dimers, in which the dimer is formed by antiparallel main chain hydrogen bonding between a pair of strands 10 from D2, generating a six-stranded  sheet. There are additional hydrophobic contacts between two antiparallel h6 helices. The tbINO tetramer is formed when the six-stranded  sheets from two dimers assemble to form a “squashed barrel”. The 8 strands from the edges of the two sheets are antiparallel, and although there are no main chain contacts, there are side chain hydrogen bonds between H270 of one protomer and D275 of the other in tbINO, and this pair is conserved in a subset of bacterial INO sequences. There are extensive contacts, both hydrophobic and hydrogen bonded, between the side chains in the center of the barrel. A total surface area of 4231 A˚2 is buried within the dimer interface (2115 A˚2 per protomer), whereas the tetramer interface buries a further 4210 A˚2 (2105 A˚2 per dimer). These large interfaces suggest that the crystallographic tetramer has the same arrangement as in solution, consistent with SEC experiments (data not shown). Within the tbINO dimer, conserved residues at the tips of two D2 domain loops, R218 (loop h6-7) and F295 (loop 9-10), each occupy pockets in the D1 domain of the opposing protomer. As these residues are conserved in all archaeal/mycobacteria sequences, this suggests they may also form dimers. The dimer-dimer interface includes a hydrophobic core dominated by
aromatic (W279, W285, Y287) and hydrophobic (L228 and V277) side chains that are generally poorly conserved outside of the archaeal/mycobacterial branch of INOs. Therefore, we anticipate that, while some of the archaeal/mycobacterial are likely to be tetramers, others may be dimeric or have distinctive dimer-dimer interfaces. The constituent tbINO dimers are similar to those found in both DAP and DHPR structures, and the further elaboration to a tetramer is analogous to that found in the complex of DHPR with NADH and 2,6 pyridine dicarboxylate (PDB code 1arz), which has four molecules in the crystallographic asymmetric unit. It therefore appears that in view of the large intermolecular interfaces within a tbINO tetramer that this oligomeric state confers a significant degree of stability on the protein. NADⴙ Binding and Structure of the tbINO Active Site NAD⫹ binding to D1a involves residues analogous to those of other NAD⫹ binding proteins. The loop between 1 and h1 (G22-x-G-x-x-A27), D69 and K74 all play important roles, while the helix dipole of h2 attracts the pyrophosphate moiety of the NAD⫹. The absence of basic residues at positions 70 and 71 contributes to the enzyme’s dependence on NAD⫹ rather than NADP, as previously predicted [17]. The adenosine portion of NAD⫹ is rotated about the ribose C4-C5 bond by roughly 90⬚ relative to the DAP NADP conformation [19]. The nicotinamide moiety of the NAD⫹ cofactor is in the syn conformation about the N-glycosidic bond and is held there by coordination with the Zn2⫹ ion. The re face is buried in a small pocket, while the si face is accessible to substrate within the binding cleft, so that the C4(S) position is available for in hydride transfer, as suggested chemically [23]. In tbINO, the nicotinamide portion of NAD⫹ interacts with both domain D1 (O of 146, N of 148,
Structure of the M. tuberculosis Inositol Synthase 397
Figure 3. Structure of tbINO (A) Stereo pair of the tbINO promoter showing the main chain trace of the D1 domain (blue and green) and the D2 domain (yellow). NAD (light purple) and Zn2⫹ (steel blue) are shown as ball-and-stick models in a cleft situated at the interface between the D1 and D2 domains. (B) Topology diagram of the tbINO promoter color-coded in the same manner as in (A).
and OG of S311) and domain D2 (OD1 of D235), and we propose that this cavity between D1 and D2 is the catalytic center of the enzyme (Figure 6). This site is located in an analogous position to the substrate binding pockets found for DHPR and DAP [19, 20]. Within the tbINO active site are a number of absolutely conserved INO residues shown in Figure 6. These include the putative catalytic residues D197 and D235 from the two important motifs G-D-D-x(3-5)-G-x-T and N-x-x-G-N-x-D, in addition to residues K284, D310, and K346. The side chains of D197and K346 on one side of the cleft are mirrored by K284 and D310 on the other, although the functional significance of this symmetry is unknown. N233, D235, and D310 provide ligands to a water molecule that coordinates the zinc ion (see below and Figure 6). G203, A204, and T205 are at the N ter-
minus of h6, where the conservation of small side chains would favor interaction of the helix dipole with a negatively charged phosphate group. The Zn2⫹ ion was identified by its tetrahedral coordination and from bond lengths of close to 2.2 A˚ for each of its four ligands. It lies adjacent to the NAD⫹ nicotinamide moiety, bridging the NO7 and NO2 atoms and coordinating the S311 OG atom and a water molecule. The presence of a Zn2⫹ ion may influence the pKa of the acidic side chains D235 and D310 which coordinate this water molecule (Figure 6). The Zn2⫹ ion is more buried than that present in similar enzymes that employ Zn2⫹ directly in the mechanism, e.g., horse liver alcohol dehydrogenase (PDB code 3bto). The recent characterization of the Archaeoglobus fulgidus INO found that divalent metal ions such as Zn2⫹ were required for activity and
Structure 398
Figure 4. Fold Comparison of tbINO Fold comparison of tbINO with diaminopimelic acid dehydrogenase (DAP) [22] and dihydrodipicolinate reductase (DHPR) [20]. The three molecules are in the same orientation, and the domains are colored as in Figure 3A. Gray main chains indicate portions which are not common to the three structures.
that NH4⫹ had no effect on the enzyme in marked contrast to the yeast INO [24]. In tbINO, the zinc is apparently integral to the active site, bridging the NAD⫹ cofactor, an absolutely conserved side chain and a critical water molecule that may act in a charge-relay system or mimic a hydroxyl group on the glucose-6-phosphate substrate. Further experiments are clearly required to define the precise role of zinc in tbINO. The absolute conservation of S311, N233, D235, and D310 in all INOs does suggest that this site is conserved in the INO family. Structure-Based Sequence Alignment of INOs The availability of an inositol synthase structure allows us to compare the major sequence and secondary structural differences between INOs from eukaryotes and archaea/mycobacteria. To do this, we have used aligned sequences from two branches of the phylogenetic tree, namely the branch containing tbINO and the next closest branch containing Aquifex aeolicus [16]. We have then manually aligned the S. cerevisiae INO from the eukaryotic branch using both sequence conservation, structure prediction, and the tbINO structure as a guide (Figure 7). The most conserved INO region extends from 6 to h8 and contains the junction between D1a and D2, extending through the entire D2 and including helix 8 of D1b (Figure 3). Most active site residues lie within this region except for K346. Eukaryotic INOs have an additional 70 residues, predicted to contain  strands,
at the N terminus of D1 and an extra C-terminal helix. An extra 14 residues are present within the disordered segment not observed in the tbINO structure. The Rossmann fold from different proteins is often quite divergent in sequence and structure as well as in the precise orientation and mode of binding NAD⫹ [25]. We note that the archaeal/mycobacterial branch of INOs has a cysteine (C26 in tbINO) that contributes to the NAD⫹ binding site. In tbINO C26 interacts with NO7 and NO1 atoms of NAD⫹. An equivalent cysteine is not obvious from sequences of eukaryotic INOs or a subbranch of archaeal INOs [16] and may point toward some variation within the INOs active sites that may be exploited by drug design. A detailed structural comparison between tbINO and eukaryotic INOs will be possible once the coordinates of the recently crystallized yeast INO [26] become available. Mechanistic Considerations Both DAP and DHPR exhibit relative domain movements on binding of cofactor and/or substrate. DHPR has both open (unliganded) and closed (ternary complex with NADP and inhibitor) forms present in the tetramer that comprises the asymmetric unit, and there is a relative rotation of 16⬚ in the interdomain angle between the two forms. DAP has been found not only in open (unliganded) and closed (ternary complex) forms equivalent to DHPR, but also in an intermediate state in a binary (substrate)
Figure 5. Tetramer of tbINO (A) The tetramer was generated by applying 222 crystallographic symmetry to the tbINO monomer. Each tbINO promoter is colored individually and contains a ball and stick model of NAD (light purple) and Zn2⫹ (steel blue). Dimer pairs are colored (orange/gold) and (blue/cyan). (B) The view of the tetramer in (A) has been rotated by 90⬚ around the x- and z-axes.
Structure of the M. tuberculosis Inositol Synthase 399
Figure 6. Active Site of tbINO View of the tbINO active site highlighting the zinc ion (Zn) coordination by NAD, serine (S311), and an active site water (W). Conserved residues likely to be involved in catalysis, and their interactions are also shown. The tbINO secondary structure is colored as in Figure 3A to highlight the position of the active site at the interface of the D1 and D2 domains.
complex (PDB code 2dap). The tbINO is potentially capable of analogous relative domain movements and may pass through one or more intermediate forms on sequential binding of cofactor and ligand. A further ordering of the missing residues 242–267 is also probable; the length of this sequence is approximately the same as that part of DHPR which encloses its active site. It is therefore very likely that basic residues from the conserved K248-X-X-X-K252 motif also participate in substrate binding and/or catalysis, by analogy with DHPR and DAP. The conversion of G-6-P to I-1-P by INO reportedly involves three stereospecific reactions in one active site, without release of the intermediate products (Figure 1). The ability to perform several steps in this manner is not unique to INO, another example from a Rossmann fold enzyme being the three-step mechanism of dehydroquinate synthase [27]. The exquisite stereospecificity of the INO reaction has been the subject of considerable chemical investigation and is reviewed in some detail by Parthasarathy et al. [23]. Obtaining detailed insight into the catalytic mechanism of tbINO cocrystallization with substrate, product, or the inhibitor 2-deoxy-glucose-6-phosphate has been attempted unsuccessfully. This may be due to the crystallization conditions precluding the ordering of the missing residues 242–267 and thus the binding of substrate or inhibitor. The lack of a structure with complexed substrate or suitable inhibitor prohibits a detailed analysis of the INO catalytic mechanism. The first stage of the
reaction was previously reported to employ the cyclic  anomer of G-6-P as substrate [28]. Ring opening could then either precede, or be simultaneous with, oxidation at C5. Loewus et al. proposed a mechanism for INO that involved binding the cyclic G-6-P in a cisoid conformation, in which the phosphate group forms an anchor and the number of conformational changes in the substrate would be minimized [29]. More recently, the greater potency of open chain glucitols versus locked-ring compounds [30] has given rise to the suggestion that rather than enzyme-catalyzed ring opening, INO selects the small percentage of the acyclic form of G-6-P present in solution. However, the flexibility of the open chain form of glucose effectively precludes ligand-docking calculations. Oxidation at C5 results from base attack at H of the O1 hydroxyl group on C1 [28] and a hydride ion is transferred to the si face of NAD⫹ at the C4 of nicotinamide, and this is indeed facing the active site cavity. Biological Implications Inositol and phosphatidylinositol (PI) are essential molecules found in all eukaryotes and some prokaryotes such as mycobacteria. In M. tuberculosis PI and its precursor inositol are essential for membrane stability. They form the basis of complex cell wall glycolipids like phosphatidylinositol dimannoside (PIM2) and lipoarabinomannan (LAM), which are involved in the infectivity of this pathogenic species. Thus, enzymes in the PI synthesis
Structure 400
Figure 7. Structure-Based Sequence Alignment of tbINO and Related Sequences Amino acid sequence alignment of Mycobacterium tuberculosis (Mtub), Mycobacterium leprae (Mlep), Streptomyces coelicolor (Scoe), Aquifex aeolicus (Aaoe), Methanobacter thermoautotrophicum (Mthe), Sulfolobus solfataricus (Ssol), Pyrococcus horikoshii (Phor), Pyrococcus abyssi (Paby), Thermotoga maritima (Tmar), Aeropyrum pernix (Aper), and Saccharomyces cerevisiae (Scer). Important conserved residues are highlighted and color coded according to residue type. Residue numbers and secondary structure elements correspond to tbINO and are shown above the sequence alignment and colored as in Figure 3A.
pathway are clear targets for novel antituberculosis therapeutics. We have solved the structure of inositol 1-phosphate synthase from M. tuberculosis (tbINO), a key enzyme in the PI synthesis pathway, which catalyzes the conversion of (D)-glucose 6-phosphate to (L)-myoinositol 1-phosphate in a three-step mechanism without the release of reaction intermediates. The tbINO fold reveals a high degree of similarity to the glyceraldehyde3-phosphate dehydrogenase-like (GAPDH-like) family of enzymes, which carry out the reduction of various substrates using NAD(P) as the cofactor in a one-step mechanism, despite low overall and active site sequence similarity. Thus, we propose that tbINO and a subset of the structurally related GAPDH-like family of enzymes
originate from a common ancestor. It appears that tbINO has retained the ability to carry out the characteristic reduction reaction of the GAPDH-like family and added to this the ability to perform several consecutive reactions in one active site. The structure of tbINO provides the first view of an inositol synthase and has allowed us to locate the active site and identify conserved residues within the active site. The unexpected identification of a zinc ion bridging the nicotinamide ring of the NAD⫹ and coordinating conserved side chains poses the question of whether it plays a structural or functional role in catalysis. The tbINO structure has provided the basis for further experiments involving cocrystallization of tbINO with sub-
Structure of the M. tuberculosis Inositol Synthase 401
strate, inhibitor, or product and site-directed mutagenesis to further elucidate the catalytic mechanism of this family of enzymes. Finally, we observe limited sequence variation within the active site of the eukaryotic and the archaeal/mycobacterial INOs that will form the basis for developing selective inhibitors of the mycobacterial enzymes. Experimental Procedures Cloning of Mycobacterium tuberculosis ino1 In order to express recombinant tbINO, the coding sequence of M. tuberculosis ino1 was amplified by PCR using primers tb_Ims5 (GGAATTCCATATGAGTGAGCACCAGTCG) and tb_Ims6 (CGAG GATCCTAACCGATGATGAACTC), which introduced an NdeI site at the 5⬘ end and BamHI at the 3⬘ end to allow the gene to be cloned in-frame into the expression vector pET-15b (Novagen). The primers used each at 300 nM final concentration. PCR was carried out using the Expand High Fidelity PCR system (Boehringer Mannheim) with H37Rv as template and DMSO at 2%. The temperature cycle used was included an initial 3 min at 94⬚C to denature high GC DNA; 10 cycles of 45 s at 94⬚C, 1 min at 57⬚C and 45 s at 72⬚C; 25 cycles of 45 s at 94⬚C, 1 min at 57⬚C and 1 min at 72⬚C (this last increasing by 20 s per cycle); and finally an extension step of 7 min at 72⬚C to complete primer extension. The PCR product was cleaved with NdeI and BamHI, and cloned into the vector pET-15b to give a construct that would express a protein with a 21 residue amino-terminal extension containing a histidine tag. The sequence of the inserted DNA was verified to ensure no mutations had been introduced. Overproduction, Purification, and Crystallization of Native and Selenomethionine tbINO Native tbINO was isolated from E. coli BL21(DE3) cells (Novagen, USA) transformed with pET15b-tbINO and grown to midexponential growth phase at 37⬚C in Luria-Bertani medium plus appropriate antibiotics and induced with 0.5 mM IPTG. The culture was incubated for a further 4–6 hr and the cells harvested by centrifugation at 4000 rpm at 4⬚C for 10 min. The cell pellet was resuspended in buffer A (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 10 mM imidazole, pH 8.0, protease inhibitor cocktail, complete EDTA-free [Boehringer]) plus 10–100 g ml⫺1 DNaseI and French-pressed (Spectronic Instruments) twice at 1000 psi before ultracentrifuging the cell-lysate at 26,000 rpm at 4⬚C for 30 min. The clear cell-lysate was loaded onto a Ni-NTA (Qiagen) column preequilibrated in buffer A and washed with 10 column volumes of 4% buffer B (buffer A ⫹ 250 mM imidazole, pH 8.0) followed by 10 column volumes of 20% buffer B. tbINO was eluted off the column in 5 column volumes of buffer B and fractions shown to contain most of tbINO by SDS-PAGE were pooled and buffer-exchanged into buffer C (20 mM Tris-HCl, 50 mM NaCl, 10 mM DTT, pH 7.5) using a Sephadex G25 column. The buffer-exchanged sample was loaded onto a HiLoad Q-Sepharose FF column preequilibrated in buffer C and the tbINO was eluted off the column with a linear gradient of buffer D (buffer C ⫹ 1 M NaCl) over 20 column volumes. Fractions identified as containing the tbINO were pooled and loaded onto a HiLoad Superdex 200 column preequilibrated in buffer C. The single peak containing tbINO essentially free of all contaminants was pooled and concentrated to 15 mg ml⫺1 by ultrafiltration using a Vivaspin centrifugal concentrator (Sartorius). Selenomethionine-labeled tbINO was prepared as native tbINO except that E. coli B834(DE3) cells transformed with pET15btbINO were grown at 30⬚C in minimal medium supplemented with selenomethionine [31], and induced as described above and harvested after 12 hr. tbINO was crystallized at room temperature by a hanging-drop vapor diffusion method. Optimal crystallization conditions were found to be as follows: PEG 4000 (6.2%–6.7% w/v), sodium cacodylate (50 mM, pH 7.0), calcium acetate (100 mM), native tbINO plus 400 M NAD and PEG 4000 (5.0%–5.5% w/v), sodium cacodylate (50 mM, pH 7.0), calcium acetate (100 mM), selenomethionine tbINO plus 400 M NAD. Crystals appeared after 1 day and reached maximum size after 3–4 days. The crystallization buffer plus an extra 1% (w/v) PEG 4000 and 20% (v/v) glycerol was used both as a recovery and cryoprotection solution.
Data Collection, Structure Determination, and Refinement Both native and selenomethionine diffraction data were collected from cryocooled single crystals on a MAR image plate on beamline ID14-4 at the ESRF and processed with the DENZO-SCALEPACK package [32]. Statistics for the data collection are given in Table 1. The structure of tbINO was determined using phase information calculated to 2.7 A˚ from the three wavelength selenomethionine data. Several runs of SnB [33] using the three wavelength selenomethionine data at various resolution cut-offs located 5 of the 6 Seatoms in the substructure. Phases were determined by MLPHARE [34], an initial electron density map was calculated by FFT [34] and visualized using O [35]. This initial electron density map displayed a distinct solvent-protein boundary without the need for solventflattening and detailed inspection clearly showed secondary structure elements and density for NAD⫹ and most side chains. An initial model was built using this map and refined against Semet data collected at wavelength 1 using CNS [36] to an R factor of 23.7 and an R free of 25.0. This model was used in a single step of rigidbody refinement using the higher resolution native data to 4 A˚, which was enough to overcome the differences in cell dimensions between the Semet and the native data. Subsequent rounds of manual intervention and refinement against the native data using CNS produced the final model with an R factor of 21.1 and an R free of 23.9. The Semet model was further refined (R factor 20.9, R free 22.8) and displayed no major differences when compared to the native model. Statistics for the refinement are given in Table 1. Acknowledgments R.A.N. would like to thank all members (past and present) of the Structural Biology Laboratory and in particular Robert Patrick and Matthew Newman, for helpful discussions. J.M-R. was supported by Vth Framework Program of the European Union Grant QLRT-199900099. We gratefully acknowledge the staff and use of facilities at the ESRF, Grenoble, France, in particular Dr. Raimond Ravelli. Received: October 30, 2001 Revised: December 12, 2001 Accepted: December 17, 2001 References 1. Martin, T.F. (1998). Phosphoinositide lipids as signaling molecules: common themes for signal transduction, cytoskeletal regulation, and membrane trafficking. Annu. Rev. Cell Dev. Biol. 14, 231–264. 2. Hunter, T. (2000). Signaling—2000 and Beyond. Cell 100, 113–127. 3. Franke, T.F., Kaplan, D.R., Cantley, L.C., and Toker, A. (1997). Direct regulation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphosphate. Science 275, 665–668. 4. Hanakahi, L.A., Bartlet-Jones, M., Chappell, C., Pappin, D., and West, S.C. (2000). Binding of Inositol phosphate to DNA-PK and stimulation of double-strand break repair. Cell 102, 721–729. 5. Besra, G.S., and Chatterjee, D. Lipids and carbohydrates of Mycobacterium tuberculosis (1994). In Tuberculosis: Pathogenesis, Protection and Control, B.R. Broom, ed. (Washington D.C.: American Society for Microbiology). 6. Hoppe, H.C., de Wet, B.J., Cywes, C., Daffe, M., and Ehlers, M.R. (1997). Identification of phosphatidylinositol mannoside as a mycobacterial adhesin mediating both direct and opsonic binding to nonphagocytic mammalian cells. Infect. Immun. 65, 3896–3905. 7. Roach, T.I., Barton, C.H., Chatterjee, D., and Blackwell, J.M. (1993). Macrophage activation: lipoarabinomannan from avirulent and virulent strains of Mycobacterium tuberculosis differentially induces the early genes c-fos, KC, JE, and tumor necrosis factor-alpha. J. Immunol. 150, 1886–1896. 8. Chan, J., Fan, X.D., Hunter, S.W., Brennan, P.J., and Bloom, B.R. (1991). Lipoarabinomannan, a possible virulence factor involved in persistence of Mycobacterium tuberculosis within macrophages. Infect. Immun. 59, 1755–1761. 9. Newton, G.L., Arnold, K., Price, M.S., Sherrill, C., Delcardayre,
Structure 402
10.
11.
12.
13. 14.
15.
16.
17.
18. 19.
20.
21.
22.
23.
24.
25.
26. 27.
28.
29.
30.
S.B., Aharonowitz, Y., Cohen, G., Davies, J., Fahey, R.C., and Davis, C. (1996). Distribution of thiols in microorganisms: mycothiol is a major thiol in most actinomycetes. J. Bacteriol. 178, 1990–1995. Spies, H.S., and Steenkamp, D.J. (1994). Thiols of intracellular pathogens. Identification of ovothiol A in Leishmania donovani and structural analysis of a novel thiol from Mycobacterium bovis. Eur. J. Biochem. 224, 203–213. Newton, G.L., Unson, M.D., Anderberg, S.J., Aguilera, J.A., Oh, N.N., del Cardayre, S.B., Av-Gay, Y., Fahey, R.C. (1999). Characterization of Mycobacterium smegmatis mutants defective in 1-d-myo-inosityl-2-amino-2-deoxy-alpha-d-glucopyranoside and mycothiol biosynthesis. Biochem. Biophys. Res. Commun. 255, 239–244. Jackson, M., Crick, D.C., and Brennan, P.J. (2000). Phosphatidylinositol is an essential phospholipid of mycobacteria. J. Biol. Chem. 275, 30092–30099. Kent, C. (1995). Eukaryotic phospholipid biosynthesis. Annu. Rev. Biochem. 64, 315–343. Salman, M., Lonsdale, J.T., Besra, G.S., and Brennan, P.J. (1999). Phosphatidylinositol synthesis in mycobacteria. Biochem. Biophys. Acta 1436, 437–450. Majumder, A.L., Johnson, M.D., and Henry, S.A. (1997). 1L-myoinositol-1-phosphate synthase. Biochim. Biophys. Acta 1348, 245–256. Bachhawat, N., and Mande, S.C. (2000). Complex evolution of the inositol-1-phosphate synthase gene amongst archaea and eubacteria. Trends Genet. 16, 111–113. Bachhawat, N., and Mande, S.C. (1999). Identification of the INO1 gene of Mycobacterium tuberculosis H37Rv reveals a novel class of inositol-1-phosphate synthase enzyme. J. Mol. Biol. 291, 531–536. Holm, L., and Sander, C. (1996). Mapping the protein universe. Science 273, 595–602. Scapin, G., Cirilli, M., Reddy, S.G., Gao, Y., Vederas, J.C., and Blanchard, J.S. (1998). Substrate and inhibitor binding sites in Corynebacterium glutamicum diaminopimelate dehydrogenase. Biochemistry 37, 3278–3285. Scapin, G., Reddy, S.G., Zheng, R., and Blanchard, J.S. (1997). Three-dimensional structure of Escherichia coli dihydrodipicolinate reductase in complex with NADH and the inhibitor 2,6pyridinedicarboxylate. Biochemistry 36, 15081–15088. Murzin, A.G., Brenner, S.E., Hubbard, T.P.J., and Chothia, C. (1995). SCOP: a structural classification of proteins database for the investigation of sequences and structures. J. Mol. Biol. 247, 536–540. Scapin, G., Reddy, S.G., and Blanchard, J.S. (1996). Threedimensional structure of meso-diaminopimelic acid dehydrogenase from Corynebacterium glutamicum. Biochemistry 35, 13540–13551. Parthasarathy, R., and Eisenberg, F.J. (1986). The inositol phospholipids: a stereochemical view of biological activity. Biochem. J. 235, 313–322. Chen, L., Zhou, C., Yang, H., and Roberts, M.F. (2000). Inositol1-phosphate synthase from Archaeoglobus fulgidus is a class II aldolase. Biochemistry 39, 12415–12423. Bell, C.E., Yeates, T.O., and Eisenberg, D. (1997). Unusual conformation of nicotinamide adenine dinucleotide (NAD) bound to diphtheria toxin: a comparison with NAD bound to the oxidoreductase enzymes. Protein Sci. 6, 2084–2096. Stein, A.J., and Geiger, J.H. (2000). Structural studies of MIP synthase. Acta Crystallogr. D 56, 348–350. Carpenter, E.P., Hawkins, A.R., Frost, J.W., and Brown, K.A. (1998). Structure of dehydroquinate synthase reveals an active site capable of multistep catalysis. Nature 394, 299–302. Wong, Y.H.H., and Sherman, W.R. (1985). Anomeric and other substrate specificity studies with myo-inositol-1-P synthase. J. Biol. Chem. 260, 11083–11090. Loewus, M.W., Loewus, F.A., Brillinger, G.U., Otsuka, H., and Floss, H.G. (1980). Stereochemistry of the myo-inositol-1-phosphate synthase reaction. J. Biol. Chem. 255, 11710–11712. Tian, F., Migaud, M.E., and Frost, J.W. (1999). Myo-inositol 1-phosphate synthase: does a single active-site amino acid
31.
32.
33.
34. 35.
36.
37.
38.
catalyze multiple proton transfers? J. Am. Chem. Soc. 121, 5795–5796. Hendrickson, W.A., Horton, J.R., and LeMaster, D.M. (1990). Selenomethionyl proteins produced for analysis by multiwavelength anomalous diffraction (MAD): a vehicle for direct determination of three-dimensional structure. EMBO J. 9, 1665–1672. Otwinowski, Z., and Minor, W. (1997). Processing of X-ray diffraction data collected in oscillation mode. In Macromolecular Crystallography Part A, Vol. 276, C.W. Carter and R.M. Sweet, eds. (New York: Academic Press). Howell, P.L., Blessing, R.H., Smith, G.D., and Weeks, C.M. (2000). Optimizing DREAR and SnB parameters for determining Se-atom substructures. Acta Crystallogr. D 56, 604–617. CCP4 (1994). The CCP4 suite: programs for computational crystallography. Acta Crystallogr. D 50, 760–763. Jones, T.A., Zou, J.-Y., Cowan, S.W., and Kjeldgaard, M. (1991). Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr. A 47, 110–119. Brunger, A.T., et al., and Warren, G.L. (1998). Crystallography and NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr. D 54, 905–921. Esnouf, R.M. (1999). Further additions to MolScript version 1.4, including reading and contouring of electron-density maps. Acta Crystallogr. D 55, 938–940. Merrit, E.A., and Murphy, M.E.P. (1994). Raster3D version 2.0—a program for photorealistic molecular graphics. Acta Crystallogr. 50, 869–873.
Accession Numbers The atomic coordinates for the tbINO structure have been deposited in the Protein Data Bank with accession code 1GR0.
PII S0969-2126(02)00718-9
Crystal Structure of Inositol 1-Phosphate Synthase from Mycobacterium tuberculosis, a Key Enzyme in Phosphatidylinositol Synthesis Richard A. Norman,1 Mark S.B. McAlister,2 Judith Murray-Rust,1,4 Farahnaz Movahedzadeh,3 Neil G. Stoker,3 and Neil Q. McDonald1,4,5 1 Structural Biology Laboratory Cancer Research U.K. 44 Lincoln’s Inn Fields London WC2A 3PX United Kingdom 2 Bloomsbury Centre for Structural Biology Birkbeck College Malet Street London WC1E 7HX United Kingdom 3 Department of Infectious and Tropical Diseases London School of Hygiene & Tropical Medicine London WC1E 7HT United Kingdom 4 School of Crystallography Birkbeck College Malet Street London WC1E 7HX United Kingdom
Summary Phosphatidylinositol (PI) is essential for Mycobacterium tuberculosis viability and the enzymes involved in the PI biosynthetic pathway are potential antimycobacterial agents for which little structural information is available. The rate-limiting step in the pathway is the production of (L)-myo-inositol 1-phosphate from (D)-glucose 6-phosphate, a complex reaction catalyzed by the enzyme inositol 1-phosphate synthase. We have determined the crystal structure of this enzyme from Mycobacterium tuberculosis (tbINO) at 1.95 A˚ resolution, bound to the cofactor NADⴙ. The active site is located within a deep cleft at the junction between two domains. The unexpected presence of a zinc ion here suggests a mechanistic difference from the eukaryotic inositol synthases, which are stimulated by monovalent cations, that may be exploitable in developing selective inhibitors of tbINO. Introduction Inositol and inositol-containing compounds such as phosphatidylinositol (PI) are essential in all eukaryotes where they play important roles in cell signaling, membrane trafficking (for reviews see [1, 2]), cell survival [3], and even DNA repair [4]. Although rarely found in prokaryotes, inositol and PI are known to be present in mycobacteria [5], a genus that contains major human pathogens such as Mycobacterium leprae and Mycobacterium tuberculosis. PI is a precursor of phosphatidylinositol dimannoside (PIM2) and of lipoarabinomannan (LAM), which are important structural components 5
Correspondence: [email protected]
of the complex mycobacterial cell wall. These molecules are also involved in infection and pathology of M. tuberculosis; PIM2 has been implicated in entry into host cells [6], while LAM has been shown to modulate the host immune response, induce cytokines such as TNF [7], and act as a virulence factor contributing to the persistence of mycobacteria within mononuclear phagocytes [8]. Inositol is also a component of the major mycobacterial thiol, mycothiol, essential for maintaining a reduced environment inside the cell [9, 10]. Mutants of Mycobacterium smegmatis that are unable to produce mycothiol grow very poorly in vitro [11], while PI mutants are not viable [12]. Thus, enzymes in the inositol synthesis pathway are potentially attractive antituberculosis drug targets. In all organisms studied to date, PI is synthesized by the exchange of the CMP moiety of CDP-diacyglycerol for inositol [13, 14]. Inositol is synthesized from (D)-glucose 6-phosphate (G-6-P) by the concerted action of inositol-1-phosphate synthase (INO, EC 5.5.1.4) and inositol-1-phosphate phosphatase. The rate-limiting step in inositol synthesis is the conversion of G-6-P to (L)-myoinositol-1-phosphate (I-1-P) by INO in a three-stage reaction involving (1) oxidation of G-6-P to 5-keto-(D)glucose 6-phosphate, (2) cyclization to myo-inosose-21-phosphate, and (3) reduction to I-1-P (Figure 1). INO requires NAD⫹ for this reaction and is inhibited by glucitol-6-phosphate and 2-deoxy-glucose-6-phosphate and stimulated by NH4⫹ [15]. Sequence analysis has shown that INOs cluster into two distinct phylogenetic branches, the mycobacterial and archaeal enzymes (ⵑ40 kDa) and the larger (ⵑ60 kDa) eukaryotic orthologs [16]. Despite the apparent sequence divergence between these two branches, INO from Mycobacterium tuberculosis (tbINO) is able to functionally replace the yeast INO protein in yeast INO deletion strains [17]. Although INOs from various organisms have been characterized and some of the reaction intermediates identified, it is still unclear how the enzyme carries out the conversion of (D)-glucose 6-phosphate to (L)-myoinositol 1-phosphate. In order to elucidate the catalytic mechanism and to determine whether this inositol-synthesizing enzyme may be a suitable target for designing antituberculosis drugs, we have solved the crystal structure of tbINO in a binary complex with the cofactor NAD⫹ and a Zn2⫹ ion. This has enabled us to localize the active site and provide some structural insights into the catalytic mechanism of INOs. Structure-based sequence analysis between the mycobacterial/archaeal and the eukaryotic INOs suggest that the details of the substrate binding and mechanism may exhibit some subtle variations which may be exploited for drug design. Results and Discussion Structure Determination Crystals of recombinant wild-type and selenomethionine-substituted tbINO both belong to the space group Key words: crystal structure; inositol; inositol 1-phosphate synthase; Mycobacterium tuberculosis; phosphatidylinositol
Structure 394
Figure 1. Reaction Catalyzed by tbINO
P4212 and the asymmetric unit contains a single tbINO protomer. The three-dimensional structure of tbINO was determined at 2.6 A˚ resolution by the multiwavelength anomalous diffraction (MAD) method, using a crystal of a selenomethionine-substituted form of the enzyme. Experimental electron density is shown in Figure 2A. The structure was refined to an R factor of 23.7% and an R free of 25.0% and then used as a starting point for refinement against the 1.95 A˚ resolution native dataset that converged to an R factor of 21.1% and R free of 23.9% (Table 1). Refined electron density is shown in Figure 2B. Recombinant tbINO protein spans residues 1–367; however, for both structures no density was observed for residues 1–14 and 241–267. Both the native and selenomethionine-substituted structures have an NAD⫹ moiety and a zinc ion in the active site. The tbINO Protomer Structure A tbINO protomer (Figures 3A and 3B) comprises two domains connected by two hinge regions; domain 1 (D1) encompasses a Rossmann fold domain (D1a, residues 15–199) with a C-terminal extension (D1b, residues 312– 367), and domain 2 (D2, residues 200–311) includes the majority of interface residues involved within the tbINO tetramer. A cleft between D1 and D2 adjacent to the NAD⫹ cofactor establishes the location of the active site and is lined with highly conserved residues found in all INO sequences. D1 comprises two parts—an N-terminal Rossmann fold (D1a, blue in Figures 3A and 3B) and an elaboration of the domain by residues at the C terminus of the enzyme (D1b, green in Figures 3A and 3B). D1a differs from a canonical Rossmann fold in having two unusually long connections between secondary structure elements, one between h1 and 2, and another between 2 and 4. In particular, the region between 2 and 4 includes a four-residue helix c1 that is reminiscent of helix 2 of the Rossmann ␣␣ motif but is aligned in the opposite sense. The extended element c2 forms an irregular strand, as if the third strand of a ␣␣ motif were twisted away from the sheet, and the sequence continues into helices h2 and h3. Residues 312–367 (domain D1b) at the C-terminal portion of tbINO form secondary structure elements h8, h9, h10, and their connecting loops, forming a C-terminal extension to D1a. Given its intimate connection to D1a, it can be considered as part of the same overall domain and appears important for overall structural stability. In particular, h8 is buried between part of the long connection between h1 and 2, contacts helix h9, and makes hydrophobic contacts with residues on strands 4, 5,
6. Residues toward the N terminus of h8 also form part of the pocket occupied by F295 from a neighboring molecule in the dimer (see below) and may also play a part in substrate binding. Domain D2 has a higher degree of sequence conservation than D1 amongst INO orthologs. It consists of a long four-stranded sheet (7–10) flanked by helices h6 and h7 and the missing residues 241–267 (dashed line in Figure 3B). Strands 7, 9, 10 are antiparallel, while 8 is parallel and forms hydrogen bonds with 10. Strand 10 is the key strand that pairs with an equivalent strand in the tbINO dimer. The missing residues are in a region adjacent to the active site cleft and contain the conserved K248-x-x-x-K252 motif. Fold Comparison of tbINO to Other Enzymes The closest structural relatives to the tbINO fold in the FSSP database [18] are meso-diaminopimelic acid dehydrogenase (DAP) from Corynebacterium glutamicum (PDB codes 1dap, 2dap, and 3dap) [19], as prevoiusly predicted by Bachhawat and Mande [17], and dihydrodipicolinate reductase (DHPR) from Escherichia coli (PDB codes 1dru, 1dih, 1drw, 1drv, and 1arz) [20], both of which are classified in SCOP [21] as members of the glyceraldehyde-3-phosphate dehydrogenase-like (GAPDH-like) family of NAD(P) Rossmann fold domains (Figure 4). This family of enzymes carries out the reduction of various substrates using NAD(P) as the cofactor. The main differences/similarities include the absence of tbINO helix h2 in DAP and DHPR, whereas h3 is equivalent to the typical helix between the two ␣␣ motifs. In DAP, the D1b domain was classified as part of the dimerization domain. A long helix corresponding to tbINO h8 is common to all three protomers, although DAP and DHPR lack a long h1-2 connection to enclose it. The remainder of the tbINO C-terminal residues (330– 367) are a longer sequence than in DAP or DHPR, and forms two antiparallel helices h9 and h10. One important observation is that the residues equivalent to the missing loop in tbINO (residues 241–267) form regular secondary structures that help to define the active site cavity of DHPR, while in DAP this region is longer (150–239 of the DAP sequence) and it was classified as a separate domain of six strands and five helices [22]. Given the differences in the relative orientations of the D1 and D2 domains of tbINO, DAP and DHPR caused by flexible interdomain linkers superpositions of the two domains can only be carried out independently. For DAP (PDB code 1dap, molecule A) alignment of the Rossmann fold domain with D1 of tbINO gave an rms fit of 1.97 A˚ for 139 C␣ atoms, and alignment of the dimeriza-
Structure of the M. tuberculosis Inositol Synthase 395
Figure 2. Electron Density (A) Stereo view of the 2.60 A˚ experimental SeMet MAD map corresponding to the NAD contoured at 1.2 (blue) to within 2 A˚ of the NAD molecule. (B) Stereo view of the 1.95 A˚ refined 2Fo ⫺ Fc map corresponding to the NAD contoured at 1.2 (blue) to within 2 A˚ of the NAD molecule. Nitrogen atoms are blue; oxygen atoms, red; phosphorous atoms, purple; carbon atoms and bonds, light purple. All molecular graphics were made with Bobscript [37] and Raster3D [38].
tion domain with D2 of tbINO gave an rms fit of 2.31 A˚ for 58 C␣ atoms. For DHPR (PDB code 1arz, molecule B) the rms fit for the D1 domain was 1.94 A˚ for 134 C␣ atoms and 2.14 A˚ for 38 C␣ atoms for the D2. The sequence identities between the D1 domain of tbINO and the Rossmann fold domains of DAP and DHPR are 23% and 20%, respectively, and between the D2 domain and the dimerization/tetramerization domains of DAP and DHPR are 10% and 8%, respectively. There is no sequence identity between the tbINO active site residues and the corresponding regions of DAP and DHPR. Despite the absence of significant sequence homology and some overall differences in tertiary fold, tbINO
shares a topologically conserved core with DAP and DHPR. This conserved core consists of all of D1 for DAP (except helices h2, h9, and h10) and DHPR (except helices h2, h3, h9, and h10) and all of D2 for DAP (except strand 8) and DHPR (except helix h7 and strand 8). This structural conservation indicates that these three enzymes may have evolved from a common ancestor, a distant relative of the GAPDH-like family of NAD(P) binding enzymes. Further, all three enzymes form similar dimers and both tbINO and DHPR form tetramers with identical arrangements of protomers (see below). Interestingly, the single-stage reaction catalyzed by the majority of GAPDH-like family of enzymes is a reduction
Structure 396
Table 1. Data Collection and Refinement Statistics
Resolution (A˚) Spacegroup Z Cell dimensions (A˚) a b c Wavelength (A˚) Observed reflections Unique reflections Highest resolution shell (A˚) Redundancya I/(I) Completeness (%) Rmerge (%) Rwork (%) Rfreeb (%) Rms bond lengths (A˚) Rms bond angles (⬚) Number of non-hydrogen atoms Number of waters a b
Native
SeMet
1.95 P4212 1
2.60 P4212 1
116.2 116.2 64.5 ⫽ 0.9790 80,189 29,486 1.98–1.95 2.7 (2.6) 7.7 (2.8) 89.9 (86.6) 7.1 (33.8) 21.1 23.9 0.006 1.5 2,559 171
115.8 115.8 69.2 2 ⫽ 0.9792 86,188 14,782 2.66–2.60 5.8 (5.2) 12.5 (5.6) 96.8 (80.8) 5.4 (13.1) 20.9 22.8 0.007 1.5 2,554 28
1 ⫽ 0.9790 86,574 14,777 2.66–2.60 5.9 (5.3) 12.7 (6.2) 97.3 (83.9) 5.2 (12.1)
3 ⫽ 0.9393 87,232 14,732 2.66–2.60 5.9 (5.3) 12.6 (5.8) 96.5 (79.6) 5.3 (13.0)
Values in parentheses correspond to the high resolution shell. Rfree was calculated against 5% of the complete dataset excluded from refinement.
that is also the third step in the conversion of G-6-P to I-1-P. The active site of tbINO may have evolved to accommodate a more complex reaction mechanism while retaining a similar structural framework. Oligomer Formation A tbINO tetramer with 222 symmetry is generated from the single protomer present in the asymmetric unit by three orthogonal crystallographic dyad axes (Figures 5A and 5B). The tetramer is best visualized as an assembly of two dimers, in which the dimer is formed by antiparallel main chain hydrogen bonding between a pair of strands 10 from D2, generating a six-stranded  sheet. There are additional hydrophobic contacts between two antiparallel h6 helices. The tbINO tetramer is formed when the six-stranded  sheets from two dimers assemble to form a “squashed barrel”. The 8 strands from the edges of the two sheets are antiparallel, and although there are no main chain contacts, there are side chain hydrogen bonds between H270 of one protomer and D275 of the other in tbINO, and this pair is conserved in a subset of bacterial INO sequences. There are extensive contacts, both hydrophobic and hydrogen bonded, between the side chains in the center of the barrel. A total surface area of 4231 A˚2 is buried within the dimer interface (2115 A˚2 per protomer), whereas the tetramer interface buries a further 4210 A˚2 (2105 A˚2 per dimer). These large interfaces suggest that the crystallographic tetramer has the same arrangement as in solution, consistent with SEC experiments (data not shown). Within the tbINO dimer, conserved residues at the tips of two D2 domain loops, R218 (loop h6-7) and F295 (loop 9-10), each occupy pockets in the D1 domain of the opposing protomer. As these residues are conserved in all archaeal/mycobacteria sequences, this suggests they may also form dimers. The dimer-dimer interface includes a hydrophobic core dominated by
aromatic (W279, W285, Y287) and hydrophobic (L228 and V277) side chains that are generally poorly conserved outside of the archaeal/mycobacterial branch of INOs. Therefore, we anticipate that, while some of the archaeal/mycobacterial are likely to be tetramers, others may be dimeric or have distinctive dimer-dimer interfaces. The constituent tbINO dimers are similar to those found in both DAP and DHPR structures, and the further elaboration to a tetramer is analogous to that found in the complex of DHPR with NADH and 2,6 pyridine dicarboxylate (PDB code 1arz), which has four molecules in the crystallographic asymmetric unit. It therefore appears that in view of the large intermolecular interfaces within a tbINO tetramer that this oligomeric state confers a significant degree of stability on the protein. NADⴙ Binding and Structure of the tbINO Active Site NAD⫹ binding to D1a involves residues analogous to those of other NAD⫹ binding proteins. The loop between 1 and h1 (G22-x-G-x-x-A27), D69 and K74 all play important roles, while the helix dipole of h2 attracts the pyrophosphate moiety of the NAD⫹. The absence of basic residues at positions 70 and 71 contributes to the enzyme’s dependence on NAD⫹ rather than NADP, as previously predicted [17]. The adenosine portion of NAD⫹ is rotated about the ribose C4-C5 bond by roughly 90⬚ relative to the DAP NADP conformation [19]. The nicotinamide moiety of the NAD⫹ cofactor is in the syn conformation about the N-glycosidic bond and is held there by coordination with the Zn2⫹ ion. The re face is buried in a small pocket, while the si face is accessible to substrate within the binding cleft, so that the C4(S) position is available for in hydride transfer, as suggested chemically [23]. In tbINO, the nicotinamide portion of NAD⫹ interacts with both domain D1 (O of 146, N of 148,
Structure of the M. tuberculosis Inositol Synthase 397
Figure 3. Structure of tbINO (A) Stereo pair of the tbINO promoter showing the main chain trace of the D1 domain (blue and green) and the D2 domain (yellow). NAD (light purple) and Zn2⫹ (steel blue) are shown as ball-and-stick models in a cleft situated at the interface between the D1 and D2 domains. (B) Topology diagram of the tbINO promoter color-coded in the same manner as in (A).
and OG of S311) and domain D2 (OD1 of D235), and we propose that this cavity between D1 and D2 is the catalytic center of the enzyme (Figure 6). This site is located in an analogous position to the substrate binding pockets found for DHPR and DAP [19, 20]. Within the tbINO active site are a number of absolutely conserved INO residues shown in Figure 6. These include the putative catalytic residues D197 and D235 from the two important motifs G-D-D-x(3-5)-G-x-T and N-x-x-G-N-x-D, in addition to residues K284, D310, and K346. The side chains of D197and K346 on one side of the cleft are mirrored by K284 and D310 on the other, although the functional significance of this symmetry is unknown. N233, D235, and D310 provide ligands to a water molecule that coordinates the zinc ion (see below and Figure 6). G203, A204, and T205 are at the N ter-
minus of h6, where the conservation of small side chains would favor interaction of the helix dipole with a negatively charged phosphate group. The Zn2⫹ ion was identified by its tetrahedral coordination and from bond lengths of close to 2.2 A˚ for each of its four ligands. It lies adjacent to the NAD⫹ nicotinamide moiety, bridging the NO7 and NO2 atoms and coordinating the S311 OG atom and a water molecule. The presence of a Zn2⫹ ion may influence the pKa of the acidic side chains D235 and D310 which coordinate this water molecule (Figure 6). The Zn2⫹ ion is more buried than that present in similar enzymes that employ Zn2⫹ directly in the mechanism, e.g., horse liver alcohol dehydrogenase (PDB code 3bto). The recent characterization of the Archaeoglobus fulgidus INO found that divalent metal ions such as Zn2⫹ were required for activity and
Structure 398
Figure 4. Fold Comparison of tbINO Fold comparison of tbINO with diaminopimelic acid dehydrogenase (DAP) [22] and dihydrodipicolinate reductase (DHPR) [20]. The three molecules are in the same orientation, and the domains are colored as in Figure 3A. Gray main chains indicate portions which are not common to the three structures.
that NH4⫹ had no effect on the enzyme in marked contrast to the yeast INO [24]. In tbINO, the zinc is apparently integral to the active site, bridging the NAD⫹ cofactor, an absolutely conserved side chain and a critical water molecule that may act in a charge-relay system or mimic a hydroxyl group on the glucose-6-phosphate substrate. Further experiments are clearly required to define the precise role of zinc in tbINO. The absolute conservation of S311, N233, D235, and D310 in all INOs does suggest that this site is conserved in the INO family. Structure-Based Sequence Alignment of INOs The availability of an inositol synthase structure allows us to compare the major sequence and secondary structural differences between INOs from eukaryotes and archaea/mycobacteria. To do this, we have used aligned sequences from two branches of the phylogenetic tree, namely the branch containing tbINO and the next closest branch containing Aquifex aeolicus [16]. We have then manually aligned the S. cerevisiae INO from the eukaryotic branch using both sequence conservation, structure prediction, and the tbINO structure as a guide (Figure 7). The most conserved INO region extends from 6 to h8 and contains the junction between D1a and D2, extending through the entire D2 and including helix 8 of D1b (Figure 3). Most active site residues lie within this region except for K346. Eukaryotic INOs have an additional 70 residues, predicted to contain  strands,
at the N terminus of D1 and an extra C-terminal helix. An extra 14 residues are present within the disordered segment not observed in the tbINO structure. The Rossmann fold from different proteins is often quite divergent in sequence and structure as well as in the precise orientation and mode of binding NAD⫹ [25]. We note that the archaeal/mycobacterial branch of INOs has a cysteine (C26 in tbINO) that contributes to the NAD⫹ binding site. In tbINO C26 interacts with NO7 and NO1 atoms of NAD⫹. An equivalent cysteine is not obvious from sequences of eukaryotic INOs or a subbranch of archaeal INOs [16] and may point toward some variation within the INOs active sites that may be exploited by drug design. A detailed structural comparison between tbINO and eukaryotic INOs will be possible once the coordinates of the recently crystallized yeast INO [26] become available. Mechanistic Considerations Both DAP and DHPR exhibit relative domain movements on binding of cofactor and/or substrate. DHPR has both open (unliganded) and closed (ternary complex with NADP and inhibitor) forms present in the tetramer that comprises the asymmetric unit, and there is a relative rotation of 16⬚ in the interdomain angle between the two forms. DAP has been found not only in open (unliganded) and closed (ternary complex) forms equivalent to DHPR, but also in an intermediate state in a binary (substrate)
Figure 5. Tetramer of tbINO (A) The tetramer was generated by applying 222 crystallographic symmetry to the tbINO monomer. Each tbINO promoter is colored individually and contains a ball and stick model of NAD (light purple) and Zn2⫹ (steel blue). Dimer pairs are colored (orange/gold) and (blue/cyan). (B) The view of the tetramer in (A) has been rotated by 90⬚ around the x- and z-axes.
Structure of the M. tuberculosis Inositol Synthase 399
Figure 6. Active Site of tbINO View of the tbINO active site highlighting the zinc ion (Zn) coordination by NAD, serine (S311), and an active site water (W). Conserved residues likely to be involved in catalysis, and their interactions are also shown. The tbINO secondary structure is colored as in Figure 3A to highlight the position of the active site at the interface of the D1 and D2 domains.
complex (PDB code 2dap). The tbINO is potentially capable of analogous relative domain movements and may pass through one or more intermediate forms on sequential binding of cofactor and ligand. A further ordering of the missing residues 242–267 is also probable; the length of this sequence is approximately the same as that part of DHPR which encloses its active site. It is therefore very likely that basic residues from the conserved K248-X-X-X-K252 motif also participate in substrate binding and/or catalysis, by analogy with DHPR and DAP. The conversion of G-6-P to I-1-P by INO reportedly involves three stereospecific reactions in one active site, without release of the intermediate products (Figure 1). The ability to perform several steps in this manner is not unique to INO, another example from a Rossmann fold enzyme being the three-step mechanism of dehydroquinate synthase [27]. The exquisite stereospecificity of the INO reaction has been the subject of considerable chemical investigation and is reviewed in some detail by Parthasarathy et al. [23]. Obtaining detailed insight into the catalytic mechanism of tbINO cocrystallization with substrate, product, or the inhibitor 2-deoxy-glucose-6-phosphate has been attempted unsuccessfully. This may be due to the crystallization conditions precluding the ordering of the missing residues 242–267 and thus the binding of substrate or inhibitor. The lack of a structure with complexed substrate or suitable inhibitor prohibits a detailed analysis of the INO catalytic mechanism. The first stage of the
reaction was previously reported to employ the cyclic  anomer of G-6-P as substrate [28]. Ring opening could then either precede, or be simultaneous with, oxidation at C5. Loewus et al. proposed a mechanism for INO that involved binding the cyclic G-6-P in a cisoid conformation, in which the phosphate group forms an anchor and the number of conformational changes in the substrate would be minimized [29]. More recently, the greater potency of open chain glucitols versus locked-ring compounds [30] has given rise to the suggestion that rather than enzyme-catalyzed ring opening, INO selects the small percentage of the acyclic form of G-6-P present in solution. However, the flexibility of the open chain form of glucose effectively precludes ligand-docking calculations. Oxidation at C5 results from base attack at H of the O1 hydroxyl group on C1 [28] and a hydride ion is transferred to the si face of NAD⫹ at the C4 of nicotinamide, and this is indeed facing the active site cavity. Biological Implications Inositol and phosphatidylinositol (PI) are essential molecules found in all eukaryotes and some prokaryotes such as mycobacteria. In M. tuberculosis PI and its precursor inositol are essential for membrane stability. They form the basis of complex cell wall glycolipids like phosphatidylinositol dimannoside (PIM2) and lipoarabinomannan (LAM), which are involved in the infectivity of this pathogenic species. Thus, enzymes in the PI synthesis
Structure 400
Figure 7. Structure-Based Sequence Alignment of tbINO and Related Sequences Amino acid sequence alignment of Mycobacterium tuberculosis (Mtub), Mycobacterium leprae (Mlep), Streptomyces coelicolor (Scoe), Aquifex aeolicus (Aaoe), Methanobacter thermoautotrophicum (Mthe), Sulfolobus solfataricus (Ssol), Pyrococcus horikoshii (Phor), Pyrococcus abyssi (Paby), Thermotoga maritima (Tmar), Aeropyrum pernix (Aper), and Saccharomyces cerevisiae (Scer). Important conserved residues are highlighted and color coded according to residue type. Residue numbers and secondary structure elements correspond to tbINO and are shown above the sequence alignment and colored as in Figure 3A.
pathway are clear targets for novel antituberculosis therapeutics. We have solved the structure of inositol 1-phosphate synthase from M. tuberculosis (tbINO), a key enzyme in the PI synthesis pathway, which catalyzes the conversion of (D)-glucose 6-phosphate to (L)-myoinositol 1-phosphate in a three-step mechanism without the release of reaction intermediates. The tbINO fold reveals a high degree of similarity to the glyceraldehyde3-phosphate dehydrogenase-like (GAPDH-like) family of enzymes, which carry out the reduction of various substrates using NAD(P) as the cofactor in a one-step mechanism, despite low overall and active site sequence similarity. Thus, we propose that tbINO and a subset of the structurally related GAPDH-like family of enzymes
originate from a common ancestor. It appears that tbINO has retained the ability to carry out the characteristic reduction reaction of the GAPDH-like family and added to this the ability to perform several consecutive reactions in one active site. The structure of tbINO provides the first view of an inositol synthase and has allowed us to locate the active site and identify conserved residues within the active site. The unexpected identification of a zinc ion bridging the nicotinamide ring of the NAD⫹ and coordinating conserved side chains poses the question of whether it plays a structural or functional role in catalysis. The tbINO structure has provided the basis for further experiments involving cocrystallization of tbINO with sub-
Structure of the M. tuberculosis Inositol Synthase 401
strate, inhibitor, or product and site-directed mutagenesis to further elucidate the catalytic mechanism of this family of enzymes. Finally, we observe limited sequence variation within the active site of the eukaryotic and the archaeal/mycobacterial INOs that will form the basis for developing selective inhibitors of the mycobacterial enzymes. Experimental Procedures Cloning of Mycobacterium tuberculosis ino1 In order to express recombinant tbINO, the coding sequence of M. tuberculosis ino1 was amplified by PCR using primers tb_Ims5 (GGAATTCCATATGAGTGAGCACCAGTCG) and tb_Ims6 (CGAG GATCCTAACCGATGATGAACTC), which introduced an NdeI site at the 5⬘ end and BamHI at the 3⬘ end to allow the gene to be cloned in-frame into the expression vector pET-15b (Novagen). The primers used each at 300 nM final concentration. PCR was carried out using the Expand High Fidelity PCR system (Boehringer Mannheim) with H37Rv as template and DMSO at 2%. The temperature cycle used was included an initial 3 min at 94⬚C to denature high GC DNA; 10 cycles of 45 s at 94⬚C, 1 min at 57⬚C and 45 s at 72⬚C; 25 cycles of 45 s at 94⬚C, 1 min at 57⬚C and 1 min at 72⬚C (this last increasing by 20 s per cycle); and finally an extension step of 7 min at 72⬚C to complete primer extension. The PCR product was cleaved with NdeI and BamHI, and cloned into the vector pET-15b to give a construct that would express a protein with a 21 residue amino-terminal extension containing a histidine tag. The sequence of the inserted DNA was verified to ensure no mutations had been introduced. Overproduction, Purification, and Crystallization of Native and Selenomethionine tbINO Native tbINO was isolated from E. coli BL21(DE3) cells (Novagen, USA) transformed with pET15b-tbINO and grown to midexponential growth phase at 37⬚C in Luria-Bertani medium plus appropriate antibiotics and induced with 0.5 mM IPTG. The culture was incubated for a further 4–6 hr and the cells harvested by centrifugation at 4000 rpm at 4⬚C for 10 min. The cell pellet was resuspended in buffer A (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 10 mM imidazole, pH 8.0, protease inhibitor cocktail, complete EDTA-free [Boehringer]) plus 10–100 g ml⫺1 DNaseI and French-pressed (Spectronic Instruments) twice at 1000 psi before ultracentrifuging the cell-lysate at 26,000 rpm at 4⬚C for 30 min. The clear cell-lysate was loaded onto a Ni-NTA (Qiagen) column preequilibrated in buffer A and washed with 10 column volumes of 4% buffer B (buffer A ⫹ 250 mM imidazole, pH 8.0) followed by 10 column volumes of 20% buffer B. tbINO was eluted off the column in 5 column volumes of buffer B and fractions shown to contain most of tbINO by SDS-PAGE were pooled and buffer-exchanged into buffer C (20 mM Tris-HCl, 50 mM NaCl, 10 mM DTT, pH 7.5) using a Sephadex G25 column. The buffer-exchanged sample was loaded onto a HiLoad Q-Sepharose FF column preequilibrated in buffer C and the tbINO was eluted off the column with a linear gradient of buffer D (buffer C ⫹ 1 M NaCl) over 20 column volumes. Fractions identified as containing the tbINO were pooled and loaded onto a HiLoad Superdex 200 column preequilibrated in buffer C. The single peak containing tbINO essentially free of all contaminants was pooled and concentrated to 15 mg ml⫺1 by ultrafiltration using a Vivaspin centrifugal concentrator (Sartorius). Selenomethionine-labeled tbINO was prepared as native tbINO except that E. coli B834(DE3) cells transformed with pET15btbINO were grown at 30⬚C in minimal medium supplemented with selenomethionine [31], and induced as described above and harvested after 12 hr. tbINO was crystallized at room temperature by a hanging-drop vapor diffusion method. Optimal crystallization conditions were found to be as follows: PEG 4000 (6.2%–6.7% w/v), sodium cacodylate (50 mM, pH 7.0), calcium acetate (100 mM), native tbINO plus 400 M NAD and PEG 4000 (5.0%–5.5% w/v), sodium cacodylate (50 mM, pH 7.0), calcium acetate (100 mM), selenomethionine tbINO plus 400 M NAD. Crystals appeared after 1 day and reached maximum size after 3–4 days. The crystallization buffer plus an extra 1% (w/v) PEG 4000 and 20% (v/v) glycerol was used both as a recovery and cryoprotection solution.
Data Collection, Structure Determination, and Refinement Both native and selenomethionine diffraction data were collected from cryocooled single crystals on a MAR image plate on beamline ID14-4 at the ESRF and processed with the DENZO-SCALEPACK package [32]. Statistics for the data collection are given in Table 1. The structure of tbINO was determined using phase information calculated to 2.7 A˚ from the three wavelength selenomethionine data. Several runs of SnB [33] using the three wavelength selenomethionine data at various resolution cut-offs located 5 of the 6 Seatoms in the substructure. Phases were determined by MLPHARE [34], an initial electron density map was calculated by FFT [34] and visualized using O [35]. This initial electron density map displayed a distinct solvent-protein boundary without the need for solventflattening and detailed inspection clearly showed secondary structure elements and density for NAD⫹ and most side chains. An initial model was built using this map and refined against Semet data collected at wavelength 1 using CNS [36] to an R factor of 23.7 and an R free of 25.0. This model was used in a single step of rigidbody refinement using the higher resolution native data to 4 A˚, which was enough to overcome the differences in cell dimensions between the Semet and the native data. Subsequent rounds of manual intervention and refinement against the native data using CNS produced the final model with an R factor of 21.1 and an R free of 23.9. The Semet model was further refined (R factor 20.9, R free 22.8) and displayed no major differences when compared to the native model. Statistics for the refinement are given in Table 1. Acknowledgments R.A.N. would like to thank all members (past and present) of the Structural Biology Laboratory and in particular Robert Patrick and Matthew Newman, for helpful discussions. J.M-R. was supported by Vth Framework Program of the European Union Grant QLRT-199900099. We gratefully acknowledge the staff and use of facilities at the ESRF, Grenoble, France, in particular Dr. Raimond Ravelli. Received: October 30, 2001 Revised: December 12, 2001 Accepted: December 17, 2001 References 1. Martin, T.F. (1998). Phosphoinositide lipids as signaling molecules: common themes for signal transduction, cytoskeletal regulation, and membrane trafficking. Annu. Rev. Cell Dev. Biol. 14, 231–264. 2. Hunter, T. (2000). Signaling—2000 and Beyond. Cell 100, 113–127. 3. Franke, T.F., Kaplan, D.R., Cantley, L.C., and Toker, A. (1997). Direct regulation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphosphate. Science 275, 665–668. 4. Hanakahi, L.A., Bartlet-Jones, M., Chappell, C., Pappin, D., and West, S.C. (2000). Binding of Inositol phosphate to DNA-PK and stimulation of double-strand break repair. Cell 102, 721–729. 5. Besra, G.S., and Chatterjee, D. Lipids and carbohydrates of Mycobacterium tuberculosis (1994). In Tuberculosis: Pathogenesis, Protection and Control, B.R. Broom, ed. (Washington D.C.: American Society for Microbiology). 6. Hoppe, H.C., de Wet, B.J., Cywes, C., Daffe, M., and Ehlers, M.R. (1997). Identification of phosphatidylinositol mannoside as a mycobacterial adhesin mediating both direct and opsonic binding to nonphagocytic mammalian cells. Infect. Immun. 65, 3896–3905. 7. Roach, T.I., Barton, C.H., Chatterjee, D., and Blackwell, J.M. (1993). Macrophage activation: lipoarabinomannan from avirulent and virulent strains of Mycobacterium tuberculosis differentially induces the early genes c-fos, KC, JE, and tumor necrosis factor-alpha. J. Immunol. 150, 1886–1896. 8. Chan, J., Fan, X.D., Hunter, S.W., Brennan, P.J., and Bloom, B.R. (1991). Lipoarabinomannan, a possible virulence factor involved in persistence of Mycobacterium tuberculosis within macrophages. Infect. Immun. 59, 1755–1761. 9. Newton, G.L., Arnold, K., Price, M.S., Sherrill, C., Delcardayre,
Structure 402
10.
11.
12.
13. 14.
15.
16.
17.
18. 19.
20.
21.
22.
23.
24.
25.
26. 27.
28.
29.
30.
S.B., Aharonowitz, Y., Cohen, G., Davies, J., Fahey, R.C., and Davis, C. (1996). Distribution of thiols in microorganisms: mycothiol is a major thiol in most actinomycetes. J. Bacteriol. 178, 1990–1995. Spies, H.S., and Steenkamp, D.J. (1994). Thiols of intracellular pathogens. Identification of ovothiol A in Leishmania donovani and structural analysis of a novel thiol from Mycobacterium bovis. Eur. J. Biochem. 224, 203–213. Newton, G.L., Unson, M.D., Anderberg, S.J., Aguilera, J.A., Oh, N.N., del Cardayre, S.B., Av-Gay, Y., Fahey, R.C. (1999). Characterization of Mycobacterium smegmatis mutants defective in 1-d-myo-inosityl-2-amino-2-deoxy-alpha-d-glucopyranoside and mycothiol biosynthesis. Biochem. Biophys. Res. Commun. 255, 239–244. Jackson, M., Crick, D.C., and Brennan, P.J. (2000). Phosphatidylinositol is an essential phospholipid of mycobacteria. J. Biol. Chem. 275, 30092–30099. Kent, C. (1995). Eukaryotic phospholipid biosynthesis. Annu. Rev. Biochem. 64, 315–343. Salman, M., Lonsdale, J.T., Besra, G.S., and Brennan, P.J. (1999). Phosphatidylinositol synthesis in mycobacteria. Biochem. Biophys. Acta 1436, 437–450. Majumder, A.L., Johnson, M.D., and Henry, S.A. (1997). 1L-myoinositol-1-phosphate synthase. Biochim. Biophys. Acta 1348, 245–256. Bachhawat, N., and Mande, S.C. (2000). Complex evolution of the inositol-1-phosphate synthase gene amongst archaea and eubacteria. Trends Genet. 16, 111–113. Bachhawat, N., and Mande, S.C. (1999). Identification of the INO1 gene of Mycobacterium tuberculosis H37Rv reveals a novel class of inositol-1-phosphate synthase enzyme. J. Mol. Biol. 291, 531–536. Holm, L., and Sander, C. (1996). Mapping the protein universe. Science 273, 595–602. Scapin, G., Cirilli, M., Reddy, S.G., Gao, Y., Vederas, J.C., and Blanchard, J.S. (1998). Substrate and inhibitor binding sites in Corynebacterium glutamicum diaminopimelate dehydrogenase. Biochemistry 37, 3278–3285. Scapin, G., Reddy, S.G., Zheng, R., and Blanchard, J.S. (1997). Three-dimensional structure of Escherichia coli dihydrodipicolinate reductase in complex with NADH and the inhibitor 2,6pyridinedicarboxylate. Biochemistry 36, 15081–15088. Murzin, A.G., Brenner, S.E., Hubbard, T.P.J., and Chothia, C. (1995). SCOP: a structural classification of proteins database for the investigation of sequences and structures. J. Mol. Biol. 247, 536–540. Scapin, G., Reddy, S.G., and Blanchard, J.S. (1996). Threedimensional structure of meso-diaminopimelic acid dehydrogenase from Corynebacterium glutamicum. Biochemistry 35, 13540–13551. Parthasarathy, R., and Eisenberg, F.J. (1986). The inositol phospholipids: a stereochemical view of biological activity. Biochem. J. 235, 313–322. Chen, L., Zhou, C., Yang, H., and Roberts, M.F. (2000). Inositol1-phosphate synthase from Archaeoglobus fulgidus is a class II aldolase. Biochemistry 39, 12415–12423. Bell, C.E., Yeates, T.O., and Eisenberg, D. (1997). Unusual conformation of nicotinamide adenine dinucleotide (NAD) bound to diphtheria toxin: a comparison with NAD bound to the oxidoreductase enzymes. Protein Sci. 6, 2084–2096. Stein, A.J., and Geiger, J.H. (2000). Structural studies of MIP synthase. Acta Crystallogr. D 56, 348–350. Carpenter, E.P., Hawkins, A.R., Frost, J.W., and Brown, K.A. (1998). Structure of dehydroquinate synthase reveals an active site capable of multistep catalysis. Nature 394, 299–302. Wong, Y.H.H., and Sherman, W.R. (1985). Anomeric and other substrate specificity studies with myo-inositol-1-P synthase. J. Biol. Chem. 260, 11083–11090. Loewus, M.W., Loewus, F.A., Brillinger, G.U., Otsuka, H., and Floss, H.G. (1980). Stereochemistry of the myo-inositol-1-phosphate synthase reaction. J. Biol. Chem. 255, 11710–11712. Tian, F., Migaud, M.E., and Frost, J.W. (1999). Myo-inositol 1-phosphate synthase: does a single active-site amino acid
31.
32.
33.
34. 35.
36.
37.
38.
catalyze multiple proton transfers? J. Am. Chem. Soc. 121, 5795–5796. Hendrickson, W.A., Horton, J.R., and LeMaster, D.M. (1990). Selenomethionyl proteins produced for analysis by multiwavelength anomalous diffraction (MAD): a vehicle for direct determination of three-dimensional structure. EMBO J. 9, 1665–1672. Otwinowski, Z., and Minor, W. (1997). Processing of X-ray diffraction data collected in oscillation mode. In Macromolecular Crystallography Part A, Vol. 276, C.W. Carter and R.M. Sweet, eds. (New York: Academic Press). Howell, P.L., Blessing, R.H., Smith, G.D., and Weeks, C.M. (2000). Optimizing DREAR and SnB parameters for determining Se-atom substructures. Acta Crystallogr. D 56, 604–617. CCP4 (1994). The CCP4 suite: programs for computational crystallography. Acta Crystallogr. D 50, 760–763. Jones, T.A., Zou, J.-Y., Cowan, S.W., and Kjeldgaard, M. (1991). Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr. A 47, 110–119. Brunger, A.T., et al., and Warren, G.L. (1998). Crystallography and NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr. D 54, 905–921. Esnouf, R.M. (1999). Further additions to MolScript version 1.4, including reading and contouring of electron-density maps. Acta Crystallogr. D 55, 938–940. Merrit, E.A., and Murphy, M.E.P. (1994). Raster3D version 2.0—a program for photorealistic molecular graphics. Acta Crystallogr. 50, 869–873.
Accession Numbers The atomic coordinates for the tbINO structure have been deposited in the Protein Data Bank with accession code 1GR0.