Crystal Structure of the Periplasmic Component of a Tripartite Macrolide-Specific Efflux Pump

J. Mol. Biol. (2009) 387, 1286–1297

doi:10.1016/j.jmb.2009.02.048

Available online at www.sciencedirect.com

Crystal Structure of the Periplasmic Component of a Tripartite Macrolide-Specific Efflux Pump Soohwan Yum 1 †, Yongbin Xu 1 †, Shunfu Piao 1 , Se-Hoon Sim 2 , Hong-Man Kim 2 , Wol-Soon Jo 3 , Kyung-Jin Kim 4 , Hee-Seok Kweon 5 , Min-Ho Jeong 3 , Hyesung Jeon 6 , Kangseok Lee 2 and Nam-Chul Ha 1 ⁎ 1

College of Pharmacy and Research Institute for Drug Development, Pusan National University, Busan 609-735, Korea 2

Department of Life Science, Chung-Ang University, Seoul 156-756, Korea 3

Dong-A University Medical Science Research Center, Busan 602-714, Korea 4

Beamline Division, Pohang Accelerator Laboratory, Pohang 790-784, Korea 5 Division of Electron Microscopic Research, Korea Basic Science Institute, Daejeon 305-333, Korea

In Gram-negative bacteria, type I protein secretion systems and tripartite drug efflux pumps have a periplasmic membrane fusion protein (MFP) as an essential component. MFPs bridge the outer membrane factor and an inner membrane transporter, although the oligomeric state of MFPs remains unclear. The most characterized MFP AcrA connects the outer membrane factor TolC and the resistance–nodulation–division-type efflux transporter AcrB, which is a major multidrug efflux pump in Escherichia coli. MacA is the periplasmic MFP in the MacAB–TolC pump, where MacB was characterized as a macrolide-specific ATP-binding-cassette-type efflux transporter. Here, we report the crystal structure of E. coli MacA and the experimentally phased map of Actinobacillus actinomycetemcomitans MacA, which reveal a domain orientation of MacA different from that of AcrA. Notably, a hexameric assembly of MacA was found in both crystals, exhibiting a funnel-like structure with a central channel and a conical mouth. The hexameric MacA assembly was further confirmed by electron microscopy and functional studies in vitro and in vivo. The hexameric structure of MacA provides insight into the oligomeric state in the functional complex of the drug efflux pump and type I secretion system. © 2009 Elsevier Ltd. All rights reserved.

6

Biomedical Research Center, Korea Institute of Science and Technology, Seoul 136-791, Korea Received 10 November 2008; received in revised form 17 February 2009; accepted 18 February 2009 Available online 28 February 2009 Edited by J. Bowie

Keywords: multidrug efflux pump; MacA; TolC; AcrA; Gram-negative bacteria

Introduction *Corresponding author. E-mail address: [email protected]. † S.Y. and Y.X. contributed equally to this work. Abbreviations used: MFP, membrane fusion protein; RND, resistance–nodulation–division; ABC, ATP-binding cassette; Ec AcrA, Escherichia coli AcrA; Aa MacA, Actinobacillus actinomycetemcomitans MacA; MAD, multiple anomalous dispersion; Ec MacA, Escherichia coli MacA; MIC, minimal inhibitory concentration; ORF, open reading frame.

In Gram-negative bacteria, type I protein secretion systems and drug efflux pumps consist of three components: the inner membrane transporter, the outer membrane factor, and the periplasmic membrane fusion protein (MFP).1–4 In Escherichia coli, the tripartite AcrAB–TolC is a major multidrug efflux pump.5–7 The inner membrane transporter AcrB belongs to the resistance–nodulation–division

0022-2836/$ - see front matter © 2009 Elsevier Ltd. All rights reserved.

Crystal Structure of MacA

(RND) family and is driven by the proton gradient across the inner membrane.8 The homotrimeric AcrB expels an extremely broad range of antimicrobial compounds to the external medium9,10 through the central channel of the outer membrane factor TolC,

1287 which spans the outer membrane.11 The homotrimeric TolC is embedded in the outer membrane as a 12-stranded β-barrel that continues ∼100 Å into the periplasmic space as an α-helical barrel composed of 12 α-helices, which make the wall of a 35-Å-inner-

Fig. 1. The overall MacA protein structures. The overall MacA protein structures(a) The electron density map of Aa MacA built with the MAD method at 4.2 Å resolution. The Cα trace of the partially refined model (R-factor = ∼ 40%) is drawn in red. The asymmetric unit contains one Aa MacA protomer. The crystallographic 6-fold axis is shown. The N-terminal and C-terminal regions are ordered on the electron density map. (b) The asymmetric unit of Ec MacA, which consists of two protomers. Each domain is shown in a different color. (c) Superposition of the Ec MacA protomers, displayed as Cα traces. Nearly the same conformation, except for the N-terminal and C-terminal parts, is shown. (d) Superposition of Aa MacA onto the Ec MacA structure, displayed as Cα traces. Aa MacA is drawn in gray, and Ec MacA is shown in magenta.

1288 diameter cylindrical channel.12 OprM and VceC were characterized as functional and structural homologues of TolC in Pseudomonas aeruginosa and Vibrio cholerae, respectively.13,14 The third component AcrA, which is known as an MFP, is located in the periplasmic space and mediates cooperation between AcrB and TolC.9,11 AcrA interacts physically with both AcrB and TolC.15–17 Like the other components, AcrA plays an essential role in the tripartite pump.18,19 MacA–MacB–TolC pump has been identified in diverse Gram-negative bacteria, including E. coli.7,20,21 The inner membrane transporter MacB is a noncanonic member of the ATP-binding cassette (ABC) family6,7,20 and was revealed to form a homodimer by extensive biochemical analyses.22 Because MacB can translocate only 14- and 15membered macrolide antibiotics,20 its role in antibiotic resistance has not been easily observed under normal laboratory conditions. Only overexpression of MacAB could increase resistance to the macrolide antibiotics in a macrolide-susceptible AcrABdeficient E. coli strain.6,7,20 However, it has been recently reported that MacAB is also involved in the secretion of an E. coli heat-stable enterotoxin.23 MacA is the MFP in the MacA–MacB–TolC pump, and it is expected to share structural similarity with AcrA due to high sequence similarity (44%), although recent phylogenetic analysis has revealed that MacA belongs to a subfamily different from that of AcrA protein.24 The structures of E. coli AcrA (Ec AcrA) and its homologue MexA from P. aeruginosa revealed that MFPs are elongated sickle-shaped molecules comprising three linearly arranged domains; these three domains include β-barrel, lipoyl, and coiled-coil α-hairpin domains. 25–27 MacA interacts directly with both MacB and TolC, similar to AcrA in the AcrA–AcrB–TolC pump.22 MacA is anchored to the inner membrane via an uncleavable signal peptide,20 while AcrA is attached at the N-terminal region via lipid moiety.2,28 To date, only MFPs associated with the RND-type transporters have been determined, and the oligomeric state of MFPs remains to be elucidated. In this study, we describe the first crystal structure of MFP linked to the ABC-type transporter, providing insight into the molecular function of MacA in the MacA–MacB– TolC pump.

Results Structure determination and overall structure of E. coli MacA We have previously reported the crystallization and preliminary X-ray analysis of Actinobacillus actinomycetemcomitans MacA (Aa MacA).29 From the data set, we calculated an experimentally determined electron density map at 4.2 Å resolution using the multiple anomalous dispersion (MAD) method, which appeared to cover the whole structure of

Crystal Structure of MacA

MacA, including the N-terminal and C-terminal flexible regions (Fig. 1a; Supplementary Figs. S1, S2, and S3). Although the N-terminal and C-terminal regions are intrinsically flexible,25–27,30 the regions are ordered in the Aa MacA crystal due to crystal packing interactions (Supplementary Figs. S1 and S2). However, the low-resolution MAD map only allowed us to build a partial model for the β-barrel, lipoyl, and α-hairpin domains, whose structures were formerly determined in AcrA and MexA.25–27 Because there is no known atomic model for the Nterminal and C-terminal regions, which occupy onethird of the whole protein, we were unable to refine the atomic model for Aa MacA. From the partial model (Fig. 1a; Supplementary Material), the interdomain orientations for the three domains were found to be significantly different from those of the AcrA and MexA structures. Next, we attempted to crystallize E. coli MacA (Ec MacA), expecting better crystals for structural determination. The Ec MacA protein, devoid of a signal-peptide-like sequence, was solubly expressed and purified. Fortunately, Ec MacA crystals were obtained, and the Ec MacA structure was determined by the molecular replacement method at 3.0 Å resolution using the partial model of Aa MacA as search model. The N-terminal and C-terminal regions of Ec MacA were disordered in the crystal, like AcrA and MexA, due to the lack of packing interaction observed in Aa MacA crystal, which enabled us to refine the model without the Nterminal and C-terminal regions. The final refined model includes two molecules of residues 42–301, with 10 disordered N-terminal residues and 71 disordered C-terminal residues. The crystals contained two molecules with nearly identical conformations in the asymmetric unit (Fig. 1b and c). In addition, the overall structure and relative domain orientation of Ec MacA and Aa MacA are very similar, confirming that the electron density map of Aa MacA was correctly phased (Fig. 1d). MacA structures exhibit domain orientations different from those of AcrA and MexA structures In previous studies, a notable conformational flexibility in the α-hairpin domains of AcrA and MexA was exhibited with an overall difference of ∼ 15° between the α-hairpin domains.25–27 When Ec MacA was superimposed onto the structures of AcrA and MexA using the lipoyl domain as reference, the αhairpin domains of Ec MacA and AcrA or MexA differed by ∼20° (Fig. 2a). This conformational flexibility of Ec MacA was beyond the range of α-helical hairpin orientations observed for AcrA and MexA, where an effective hinge was located at the base of the hairpins. This observation suggested that the hinge-like motion of α-hairpin domains is a common property for MacA. In contrast to the α-hairpin domain, the relative orientation of the β-barrel domains of AcrA and MexA was invariant in all 13 views captured in the MexA crystal and in 4 views captured in the AcrA

Crystal Structure of MacA

1289

Fig. 2. Comparison of the MacA structure with that of AcrA. Comparison of the MacA structure with that of AcrA (a) Superposition of the Ec MacA protomer onto AcrA using the lipoyl domain as reference (top). The length of the funnel stem of Ec MacA is 11 Å longer than that of AcrA, as predicted by sequence alignment (Supplementary Fig. S3). The α-hairpin domains of MacA and AcrA differ by ∼ 20°. The α-hairpin domain of AcrA may exhibit a conformation similar to that of MacA in the functional state because its hinge-like motion has been previously observed in the AcrA and MexA structures.25 The β-barrel domain of MacA is different from that of AcrA by ∼ 20°. Strictly conserved residues are found in the connecting loop between the helices (bottom), as shown in the sequence alignment of MFPs from different species: E. coli (Ec), Pseudomonas putida (Pp), A. actinomycetemcomitans (Aa), Enterobacter aerogenes (Ea), and P. aeruginosa (Pa). (b) Superposition of Ec MacA lipoyl domain onto that of Ec AcrA (top). Ec MacA is shown in magenta, while Ec AcrA is shown in blue. Gln209, which is conserved only in MacA proteins (not in AcrA or MexA), is drawn in stick representation (bottom). In the sequence alignment, St stands for Salmonella typhimurium, and Yp stands for Yersinia pestis.

crystal. This observation suggested that the movement of the β-barrel domain relative to that of the lipoyl domain may not occur or may be restricted even in their functional states of AcrA and MexA when associated with outer and inner membrane components. The β-barrel domains of both MacA proteins are, however, quite different from those of AcrA and MexA, which are the unique features of MacA. When superposed onto AcrA, the β-barrel domains of MacA and AcrA differed by ∼ 20° overall (Fig. 2a). This distinct orientation of the MacA βbarrel domain may be related to the difference in cognate inner membrane transporter because the lipoyl and β-barrel domains of MFPs were engaged with the inner membrane transporters.31,32 Structural features in the three MacA domains The coiled-coil α-hairpin domain of MFPs has been implicated to bind to TolC.15,17,33 The coiledcoil α-hairpin of MacA proteins is 11 Å long and has six heptad repeats per helix (Figs. 1d and 2), making it longer than the α-helical hairpins of AcrA and MexA, which have five and four heptads, respec-

tively. While the additional heptad in MacA is located at the middle region of the helices, the connecting loop between the two helices shows good sequence conservation to AcrA and MexA (Fig. 2a). These facts suggest that the connecting loop region of MFPs plays a more important role in binding to TolC rather than the middle region of the α-hairpin. Consistent with these facts, Lobedanz et al. reported that the tip region containing the connecting loop mainly comprises the interface for the recruitment of TolC.17 These findings suggest that MacA–TolC interaction might be similar to AcrA–TolC interaction. Given the amino acid sequence analysis of MacA proteins with the MFPs associated with RND-type transporters, we found invariant residues only among MacA proteins. One residue (Gln209 of Ec MacA), which is strictly conserved only in MacA proteins, is added in a flexible loop of the lipoyl domain of MacA proteins. This one-residue insertion provides a longer loop, although it did not cause a significant conformational change in the lipoyl domain (Fig. 2b). In addition, three residues (Thr293, Tyr275, and Glu231) showing a characteristic

1290 interaction with an adjacent β-barrel domain of an adjacent protomer (its biochemical role is discussed below) were found in β-barrel domain. The hexameric assembly of Ec MacA and Aa MacA in the crystal Given the two structures of MacA proteins, hexameric arrangement was commonly found in the crystals (Figs. 1a and 3). The electron density map of Aa MacA and the atomic model of Ec MacA showed a funnel-like structure with a central channel along the crystallographic 6-fold axis or pseudo-6-fold axis, respectively, which was generated by a side-byside packing interaction of six protomers. The hexameric ring structures of the MacA proteins are compatible with the anchoring of the proteins to the

Crystal Structure of MacA

inner membrane in vivo. Although the hexameric ring structure was first observed in the MFP structures here, the propensity of the side-by-side packing interaction between the MFP protomers has been implicated.25–27 MexA formed an unusual helical assembly through similar side-by-side interactions, and AcrA showed dimeric arrangements by both parallel and antiparallel interactions.25–27 The overall structures, resembling an upsidedown funnel, have a stem and a conical mouth; the stem is formed by the juxtaposition of the α-hairpin domains, and the conical mouth is formed by the lipoyl and β-barrel domains (Fig. 3). The α-hairpin domains from both MacA structures form a channel that is 70 Å long and 35 Å wide, with a cogwheel structure at the end of the α-hairpin domain (Fig. 3; Supplementary Fig. S4). The funnel-like structure of

Fig. 3. The hexameric structure of The hexameric structure ofEc MacA. (a) A ribbon representation of the Ec MacA hexamer. Two MacA protomers in the asymmetric unit are shown in magenta and green. The flexible N-terminal and C-terminal regions are depicted as dotted lines, and the pseudo 6-fold axis (crystallographic 3-fold axis) is drawn. (b) Surface representation of the MacA hexamer. The two front protomers are omitted to show the central channel. (c) A top view of the hexameric structure of Ec MacA. Only α-hairpin domains are shown for simplicity. (d) A bottom view of the hexameric structure of Ec MacA. Only β-barrel domains are shown for simplicity.

Crystal Structure of MacA

MacA suggests that the conical mouth part, containing the inner-membrane-anchoring motif, should be associated with the inner membrane transporter, and the stem part should be associated with TolC (Fig. 3a). However, further studies are required to test whether the hexameric assembly of MacA proteins is biologically relevant. Aa MacA protein is a good model for analyzing the oligomeric state of MacA Although the association state of AcrA is uncertain, soluble forms of AcrA and MexA are monomeric in vitro, and cross-linking of AcrA in vivo suggests a trimeric form.26,27,34,35 To gain insight into the oligomeric state of MacA, size-exclusion chromatography was performed with Aa MacA and Ec MacA. Aa MacA protein, which is devoid of the membrane anchoring moiety, was eluted as a pentamer or its similar-order oligomer, while Ec MacA protein exhibited a molecular size similar to that of AcrA, which is known as a monomeric protein in solution34 (Fig. 4a). Because Aa MacA shares a high sequence homology (54%) with Ec MacA and both proteins play a homologous role, the result was unexpected. This result presents the first observation

1291 that MFP forms an oligomer in vitro in the absence of a chemical cross-linker, although it is not readily apparent why such large differences exist in Aa MacA. Thus, Aa MacA may be a good model protein for probing the oligomeric state of MacA protein. Our findings indicate that Aa MacA has a higher oligomeric propensity than Ec MacA and suggest that Ec MacA would form the same oligomer as Aa MacA if the local concentration of Ec MacA increased by anchorage to the membrane in vivo. Electron microscopic study using Aa MacA supports the hexameric assembly of MacA To define the oligomerization number of Aa MacA, we performed electron microscopy with the oligomeric Aa MacA protein. Unfortunately, the Aa MacA molecules only showed clustered sunflower-like shapes (Supplementary Fig. S5), probably due to a high affinity of the protein for carbon support. To gain better images, we generated a mutant form of Aa MacA in which the N-terminal and C-terminal flexible regions were truncated. Interestingly, a significant portion of the truncated Aa MacA protein was shifted to the monomeric form, indicating that the N-terminal and C-terminal regions partly

Fig. 4. Aa MacA is an oligomeric protein, as revealed by sizeexclusion chromatography and electron microscopy. (a) Aa MacA is hexameric in solution. Elution profiles of Ec MacA, Aa MacA, and Ec AcrA on a size-exclusion column are shown with estimated molecular weights. Prior to the experiment, the column was precalibrated with standard molecular weight markers. Aa MacA appears as a distinctively higher-order oligomer as compared with Ec AcrA and Ec MacA proteins. (b) Electron microscopic picture of a deletion mutant Aa MacA (residues 38–318), which lacks the N-terminal and C-terminal regions. The oligomeric form of the Aa MacA mutant protein was isolated using size-exclusion chromatography (Supplementary Fig. S6) and was negatively stained. The images in the upper row show putative top views of the MacA hexamer. The class average of the top view from negatively stained Aa MacA (residues 38–318) is shown on the left of the bottom row (averaged electron microscopy image). The averaged image shows six centers of masses arranged on a ring with low density in its center. The image on the right shows the experimentally phased electron density map of the corresponding region of Aa MacA with a similar orientation of the averaged image (a view of the Aa MacA electron density map). The bar at the bottom indicates 10 nm. The selected raw images are shown in Supplementary Fig. S7.

1292 contribute to oligomerization for at least Aa MacA (Supplementary Fig. S6). The electron microscopic picture of the oligomeric form of the truncated Aa MacA mutant showed two kinds of ring shapes that are compatible with the top or bottom view of the hexameric structure observed in Ec MacA and Aa MacA crystals (Fig. 4b). Taken together, these results suggested that the funnel-like hexameric structure observed in both MacA crystals reflects the solution state of Aa MacA. Moreover, it is likely that Ec MacA would form a hexameric assembly as shown in the crystal when Ec MacA is anchored to the inner membrane in vivo. The role of conserved residues in β-barrel domain in the oligomerization of MacA As mentioned above, the Thr293, Tyr275, and Glu231 residues within the β-barrel domain are also

Crystal Structure of MacA

strictly conserved among the MacA proteins (Fig. 5a). These three residues are involved in the interactions between the β-barrel domains, forming a closed six-membered ring in head-to-tail fashion (Figs. 3d and 5a). This finding suggested that the three residues may contribute to the oligomerization of the protein. Because Aa MacA protein is hexameric in solution, we generated two mutant Aa MacA proteins (E227A and E227A/Y291A, which correspond to E231A and E231A/Y275A of Ec MacA, respectively) to test the role of the residues in oligomerization. The substitution mutant Aa MacA proteins were partly or mostly eluted as lowerorder oligomers during size-exclusion chromatography (Fig. 5b), indicating that the Glu and Tyr residues play an important role in the hexamerization of Aa MacA, as expected from the crystal structure. This result further confirms that the hexameric structure in the Aa MacA crystal exhibits the solution state, not a crystallographic artifact. We speculate that the different domain orientation of the β-barrel domain of MacA, with respect to those of AcrA and MexA, may result from the interprotomer interaction mediated by the MacA-specific residues, providing an insight into the differences in their cognate partner in vivo. To examine the functional importance of the residues involved in the hexamerization of MacA in vivo, we constructed E. coli strains deleted for acrA and acrB genes that conditionally overexpress the wildtype MacB and mutant MacA proteins harboring an amino acid substitution of E231A or Y275A. These strains were tested for their degree of resistance to a 14-membered macrolide antibiotic, erythromycin, by measuring the minimal inhibitory concentration (MIC) of the antibiotic. The E. coli strain deleted for acrA and acrB genes (BW25113ΔacrAacrB) was used because the drug transport activity of the MacA– MacB–TolC pump was easily observed in the absence of the major efflux pump AcrA–AcrB– TolC.6 As shown in Table 1, the result showed that E. coli cells expressing the mutant MacA proteins Fig. 5. The interface between The interface between βbarrel domains, formed by MacA-specific residues. (a) A close-up view of the interface between β-barrel domains and sequence alignment. The boxed region in Fig. 3a is shown. Residues Glu231, Tyr275, and Thr293, which are involved in hydrogen bonds, are shown as sticks and are all strictly conserved, as shown in the sequence alignment of MacA from different species. The residues are strictly conserved only among the MacA proteins, not in AcrA and MexA. (b) Top: One-third of the Aa MacA mutant E227A protein is eluted as a monomer or dimer (70 kDa) in the size-exclusion chromatographic column (Superdex 200 HR 10/30). Bottom: Most of the Aa MacA doublemutant E227A/Y291A protein is eluted as a lower-order oligomer in the size-exclusion chromatographic column. The peaks indicated by 210-kDa, 120-kDa, and 70-kDa arrows are estimated as hexamer, trimer, and dimer or monomer, respectively. SDS-PAGE analyses of the fractions are shown. The numbers correspond to the fractions indicated on each chromatogram. Glu227 and Tyr291 residues of Aa MacA correspond to Glu231 and Tyr275 residues of Ec MacA, respectively.

Crystal Structure of MacA

1293

Table 1. Effects of the overexpression of wild-type or mutant MacA proteins on E. coli strain BW25113ΔacrAacrB's resistance to erythromycin Overexpression of MacA MIC (μg/ml erythromycin)

None Wild type E231A Y275A 2.5

20

2.5

2.5

The raw data for MIC and expression levels of MacA and MacB proteins are shown in Supplementary Fig. S8.

were as sensitive as E. coli cells harboring an empty vector (pKAN6) to the antibiotic erythromycin (MIC = 2.5 μg/ml), whereas E. coli cells expressing the wild-type MacA exhibited significantly higher resistance to the antibiotic (MIC = 2.5 μg/ml). These results indicate that these amino acid residues are important in forming a functional complex of the pump and suggest that MacA is a hexameric protein or has a propensity for hexamerization, where the oligomeric structure is important for its function.

Discussion In Gram-negative bacteria, the type I protein secretion system and tripartite drug efflux pumps have MFP as an essential component. In this study, we presented the first three-dimensional structures of the MFPs that are associated with the ABC-type

transporter. The overall structure of the MacA monomer showed a structure similar to those of AcrA and MexA, despite the different domain orientations. The funnel-like hexameric structures were found in both MacA crystals, and Aa MacA behaved as a highorder oligomer during size-exclusion chromatography and produced consistently a six-membered ring in electron microscopic pictures. The conserved residues specific for MacA that were involved in hexamer formation in the crystals played a crucial role in the oligomerization of Aa MacA in solution and in the antibiotic resistance of E. coli cells in vivo. Taken together, our results indicated that the hexameric structure of MacA reflects the solution state of MacA and is functionally important in vivo. Although Ec AcrA–AcrB–TolC and its homologue P. aeruginosa MexA–MexB–OprM pumps have been extensively studied, how MFPs connect TolC and the inner membrane transporters and how the central channel of TolC is open still need to be elucidated. Herein, we observed a striking similarity between the α-helical barrel of the TolC trimer and the α-helical barrel of the MacA hexamer. This similarity tempted us to propose models for MacA– TolC binding. The current appealing model of the AcrA–AcrB–TolC pump was based on direct binding between AcrB and TolC,36,37 where AcrA wraps the outside of the α-helical barrel of TolC.38 The MacA hexamer structure itself suggests a tip-to-tip

Fig. 6. Structural model of the tripartite MacAB–TolC complex. Structural model of the tripartite MacAB–TolC complex. (a) The MacA-bridging model. MacA exhibits the hexameric arrangement observed in the crystal. Because the numbers lining the α-barrel of TolC and MacA are the same, the MacA hexamer docks to TolC by tip-to-tip interaction. The intersections of TolC and MacA are shown. The periplasmic part of MacB is accommodated by the hollow formed by the lipoyl and β-barrel domains. This model does not allow for a direct interaction between TolC and MacB. The complex spans the entire periplasmic space, inner membrane (IM), and outer membrane (OM). The periplasmic parts of the complex, except MacB, are approximately 200 Å long. (b) Crystal packing interaction between the two hexameric units of the full-length Aa MacA (residues 20–394) with the electron density map. Only α-hairpin domains are shown in the upper hexameric unit for simplicity. The crystallographic 6-fold and 2-fold axes are indicated by arrows. (c) The MacA-wrapping model. MacA makes a higher-order oligomer, which is induced by binding to TolC or MacB in vivo. Because the higher oligomeric form of MacA provides the wider α-barrel, the MacA oligomer can wrap the lower part of the α-barrel and the periplasmic part of MacB. In this model, direct contact of the two membrane proteins is allowed, as in the currently prevailing model for the AcrAB–TolC pump. The periplasmic parts of the complex, except MacB, provide a length (∼ 140 Å) shorter than that in the MacA-bridging model.

Crystal Structure of MacA

1294 binding between MacA and TolC, of which the diameters of the α-helical barrels are identical (MacA-bridging model; Fig. 6a). Consistent with the MacA-bridging model, the crystal packing of Aa MacA from the electron density map showed an intermeshing cogwheel-to-cogwheel interaction (Fig. 6b), which suggests the cogwheel-to-cogwheel interaction between MacA and TolC. The crystal packing interaction shows a propensity for head-tohead arrangement between the two six-membered α-helical barrels. The crystal packing interaction between the α-helical domains of two MacA proteins may mimic the interaction between MacA and TolC in vivo because it is expected that the periplasmic entrance region of TolC in the open state is similar to the funnel stem region of MacA. Alternatively to the MacA-bridging model, a higher oligomeric form of MacA could be induced to envelop the α-helical barrel of TolC in vivo, which is analogous to the currently prevailing model for the AcrA–AcrB–TolC pump (MacA-wrapping model; Fig. 6c). In this model, TolC is in direct contact with MacB, and the higher oligomeric form of MacA wraps the junction of TolC and MacB, which induces the opening of the TolC channel. A recent study reported a direct binding of TolC to MacB using a pull-down assay in vitro, although the interaction was much weaker than those of MacA with both MacB and TolC.22 Since MacA is structurally and functionally homologous to AcrA, the MacA– MacB–TolC pump should be compatible with the MacA-wrapping model similar to that of the AcrA– AcrB–TolC pump. If this MacA-wrapping model were correct, the hexameric assembly of MacA might just mimic a functional assembly in which a similar coiled-coil packing can be expected. Given the results presented in this study, we cannot conclude which model is proper for the MacA–MacB–TolC pump. However, the two models could compromise if the MacA-bridging model might represent a transport intermediate and the MacA-wrapping model might represent the final assembly for the MacA– MacB–TolC pump, or vice versa. Further studies are needed to build an exact model for the molecular mechanism of the MacAB–TolC pump. In conclusion, the hexameric structure of MacA was determined, providing insight into the oligomeric state of MacA and a binding model to TolC and MacB. Furthermore, the hexameric structures shed light on the elucidation of the functions of MFPs and the assembly mechanisms of the drug efflux pumps and type I secretion system that are widely distributed in bacterial species, including pathogens.

Materials and Methods Overexpression and purification of recombinant MacA proteins DNA fragments encoding Ec MacA (residues 32–371) and Aa MacA (residues 20–394) were ligated into the NcoI

and XhoI sites of the pPROEX-HTA vector (Invitrogen, USA). The expression and purification of Aa MacA have been previously described,29 and the recombinant Ec MacA proteins were expressed and purified using the same method. The purified proteins were concentrated using Centriprep (Millipore, USA) and stored frozen at −80 °C until use for crystallization and electron microscopy in Supplementary Fig. S5. To generate the truncated Aa MacA (residues 38–318) protein for the electron microscopy in Fig. 4b, a DNA fragment encoding the corresponding region was amplified and ligated into the same restriction enzyme sites of the pPROEX-HTA vector. The substitution mutants of Aa MacA (E227A and E227A/Y291A) were generated by QuikChange method (Invitrogen). Crystallization, data collection, and structure determination Crystallization and preliminary X-ray analysis of Aa MacA (residues 20–394) have been published previously.29 Briefly, the crystal belongs to space group P622 with cell parameters a = 109.2 Å, b = 109.2 Å, and c = 255.4 Å. Phasing statistics for Aa MacA are summarized in Supplementary Table S1, and the partially refined model for Aa MacA is presented in Supplementary Material. The MAD map of Ec MacA (25 mg/ml) was crystallized in a precipitation solution containing 1 M potassium sodium tartrate tetrahydrate and 0.1 M 4morpholineethanesulfonic acid (pH 6.5) at 14 °C. The data

Table 2. X-ray data collection and refinement statistics Data set Source Wavelength (Å) Temperature (°C) Resolution limit (Å) Space group Unit cell dimensions (Å) a, b, c (Å) α, β, γ (°) Reflections Unique Redundancy Rsym (%) Completeness (%) I/σ Refinement Resolution range (Å) R-factor (%) Rfree (%)b,d Average B value (Å2) Rmsd for bonds (Å) Rmsd for angles (°) Disordered residues in asymmetric unitc (number/fraction) Ramachandran plot (%) Most favored Additionally favored Generously favored Disallowed a

Beamline 6C at PLS 1.0000 18a 50–3.0 (3.11–3.00)b P321 128.5, 128.5, 110.3 90, 90, 120 19,873 2.4 (2.0)b,c 12.3 (33.8)b 92.3 (84.9)b 7.0 (2.0)b 50–3.0 28.0 34.4 33.7 0.00921 1.5913 147/21.6% 75.1 19.1 4.3 1.4

We failed to find a proper freezing condition; thus, the data set was collected at room temperature. b The numbers in parentheses are statistics for the highestresolution shell. c Redundancy was relatively low because the unfrozen crystal was rapidly decayed by X-ray radiation. d Rfree was calculated with 5% of the data set.

Crystal Structure of MacA set was collected on beamline 6C at Pohang Accelerator Laboratory with a CCD detector Quantum 210 (ADSC) at room temperature. The diffraction data were processed and scaled with the HKL2000 package.39 The crystal belongs to the space group P321 with cell dimensions of a = 128.5 Å, b = 128.5 Å, and c = 110.3 Å. Initial phases were determined with the molecular replacement package MOLREP40 using the coordinates of the partially refined Aa MacA structure as search model. Model building was performed using the program Coot,41 and models were refined using the program CNS.42 Crystallographic data statistics for Ec MacA are summarized in Table 2. All figures were prepared with PyMOL.43 Size-exclusion chromatography To determine the molecular weight of proteins, 0.1 ml of each protein (1 mg/ml) was injected into Superdex S-200 HR 10/30 (GE Healthcare) at a flow rate of 0.5 ml/min, which was preequilibrated with 20 mM Tris buffer (pH 8.0) containing 150 mM NaCl.

1295 MacAY275A-R (5′-GAAAATAGCGTCGTTAACCT). To construct pMacAB1 Y275A, the coding region of macA containing an amino acid substitution at position 275 from Y to A was amplified using PCR. The resulting PCR DNA was digested with HpaI and PstI and ligated into the same sites in pMacAB1. The primers used were MacA-Y275A-F (5′-AGGTTAACGACGCTATTTTCGCCTACGCCCGTTTTGAAGTCCC; mutated nucleotides in bold) and pKAN6PstI-R (5′-CGCAACGTTGTTG- CCATTGC). Measurement of MIC Cultures grown overnight in LB containing 100 μg/ml kanamycin were diluted 1:100 in the same medium. At OD600 = 0.1, the expression of MacA and MacB proteins was induced by adding 1% arabinose to the cultures, and then they incubated further for 2–3 h. Approximately 104 of the induced cells was then added to test tubes containing LB-100 μg/ml kanamycin + 0.1% arabinose and erythromycin at increasing concentrations. Cultures were grown for 16–24 h, and the lowest concentration of erythromycin that completely inhibited growth was designated as the MIC.

Electron microscopy Accession code Purified samples were applied to glow-discharged carbon-coated grids, rinsed, and stained with 2% uranyl acetate. Images were recorded on a 2000 × 2000 CCD camera using a Tecnai F20 field emission gun electron microscope operating at 200 kV (FEI). Image processing and two-dimensional analysis were performed using the EMAN software suite.44 Particles were selected semiautomatically from individual digital micrographs. These images were refined iteratively by particle classification and averaging based on multivariate statistical analysis. The top view, which is the average of 48 particle images, was chosen from class averages. Construction of E. coli strains and plasmids for overexpression of mutant MacA proteins BW25113ΔacrAB was constructed by deleting the open reading frame (ORF) of acrAB in the genomic DNA of BW25113 (lacIq rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBADAH33 ΔrhaBADLD78) using the procedure described by Datsenko and Wanner.45 The PCR primers used were acrA-H1P1 (5′-ACTTTTGACCATTGACCAATTTGAAATCGGACACTCGAGGTTTACATATGATTCCGGGGATCCGTCGACC) and acrB-H2P2 (5′-TTACGCGGCCTTAGTGATTACACGTTGTATCAATGATGATCGACAGTATGTGTAGGCTGGAGCTGCTTCG), and pKD13 was used as template.45 Plasmid pMacAB1 was constructed by subcloning the NdeI and PstI fragments containing the coding region for MacA and MacB from pUMacAB6 into the same sites in pKAN6E-IF1. Plasmid pKAN6E-IF1 was constructed by digesting pKAN6-IF146 with EcoRI and NotI and by ligating the vector DNA after filling in the ends using Klenow DNA polymerase I. To construct pMacAB1E231A, the coding region of macA containing an amino acid substitution at position 231 from E to A was amplified using recombinant PCR method. The resulting PCR DNA was digested with EcoRI and HpaI and ligated into the same sites in pMacAB1. The primers used were MacA-F (5′ATCATATGAAAAAGCGGAAAACCGT), MacAE231A-R (5′-AGAAACCTGCGCTTTTACCA), MacAE231A-F (5′TGGTAAAAGCGCAGGTTTCTGCAGCGGATGTAATCCACCTGAA; mutated nucleotides in bold), and

The coordinates of the E. coli MacA structure have been deposited in the Protein Data Bank (Protein Data Bank code 3FPP).

Acknowledgements We thank Dr. Atsushi Nakagawa at Osaka University for critical reading of the manuscript. This study made use of beamline 6C at Pohang Accelerator Laboratory (Pohang, Korea). This work was supported by Korea Research Foundation grants KRF-2006-312-C00355 (to N. -C. Ha) and KRF-2006-005-J03503 (to M. -H. Jeong). This work was also supported by Molecular Imaging and GRL “Theragnosis” grants from the Korea Government (to H. Jeon). We thank the Advanced Analysis Center at the Korea Institute of Science and Technology for access to transmission electron microscopy. A grant from the 21C Frontier Microbial Genomics and Application Center Program of the Ministry of Education, Science and Technology, Republic of Korea (to K. Lee) partly supported this work.

Supplementary Data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jmb.2009.02.048

References 1. Koronakis, V., Eswaran, J. & Hughes, C. (2004). Structure and function of TolC: the bacterial exit duct for proteins and drugs. Annu. Rev. Biochem. 73, 467–489.

Crystal Structure of MacA

1296 2. Lewis, K. (2000). Translocases: a bacterial tunnel for drugs and proteins. Curr. Biol. 10, R678–R681. 3. Zgurskaya, H. I. & Nikaido, H. (1999). Bypassing the periplasm: reconstitution of the AcrAB multidrug efflux pump of Escherichia coli. Proc. Natl Acad. Sci. USA, 96, 7190–7195. 4. Thanabalu, T., Koronakis, E., Hughes, C. & Koronakis, V. (1998). Substrate-induced assembly of a contiguous channel for protein export from E. coli: reversible bridging of an inner-membrane translocase to an outer membrane exit pore. EMBO J. 17, 6487–6496. 5. Hirakata, Y., Srikumar, R., Poole, K., Gotoh, N., Suematsu, T., Kohno, S. et al. (2002). Multidrug efflux systems play an important role in the invasiveness of Pseudomonas aeruginosa. J. Exp. Med. 196, 109–118. 6. Tikhonova, E. B., Devroy, V. K., Lau, S. Y. & Zgurskaya, H. I. (2007). Reconstitution of the Escherichia coli macrolide transporter: the periplasmic membrane fusion protein MacA stimulates the ATPase activity of MacB. Mol. Microbiol. 63, 895–910. 7. Kobayashi, N., Nishino, K., Hirata, T. & Yamaguchi, A. (2003). Membrane topology of ABC-type macrolide antibiotic exporter MacB in Escherichia coli. FEBS Lett. 546, 241–246. 8. Nikaido, H. (1994). Prevention of drug access to bacterial targets: permeability barriers and active efflux. Science, 264, 382–388. 9. Ma, D., Cook, D. N., Alberti, M., Pon, N. G., Nikaido, H. & Hearst, J. E. (1993). Molecular cloning and characterization of acrA and acrE genes of Escherichia coli. J. Bacteriol. 175, 6299–6313. 10. Ma, D., Cook, D. N., Alberti, M., Pon, N. G., Nikaido, H. & Hearst, J. E. (1995). Genes acrA and acrB encode a stress-induced efflux system of Escherichia coli. Mol. Microbiol. 16, 45–55. 11. Fralick, J. A. (1996). Evidence that TolC is required for functioning of the Mar/AcrAB efflux pump of Escherichia coli. J. Bacteriol. 178, 5803–5805. 12. Koronakis, V., Sharff, A., Koronakis, E., Luisi, B. & Hughes, C. (2000). Crystal structure of the bacterial membrane protein TolC central to multidrug efflux and protein export. Nature, 405, 914–919. 13. Akama, H., Kanemaki, M., Yoshimura, M., Tsukihara, T., Kashiwagi, T., Yoneyama, H. et al. (2004). Crystal structure of the drug discharge outer membrane protein, OprM, of Pseudomonas aeruginosa: dual modes of membrane anchoring and occluded cavity end. J. Biol. Chem. 279, 52816–52819. 14. Federici, L., Du, D., Walas, F., Matsumura, H., Fernandez-Recio, J., McKeegan, K. S. et al. (2005). The crystal structure of the outer membrane protein VceC from the bacterial pathogen Vibrio cholerae at 1.8 Å resolution. J. Biol. Chem. 280, 15307–15314. 15. Husain, F., Humbard, M. & Misra, R. (2004). Interaction between the TolC and AcrA proteins of a multidrug efflux system of Escherichia coli. J. Bacteriol. 186, 8533–8536. 16. Tikhonova, E. B. & Zgurskaya, H. I. (2004). AcrA, AcrB, and TolC of Escherichia coli form a stable intermembrane multidrug efflux complex. J. Biol. Chem. 279, 32116–32124. 17. Lobedanz, S., Bokma, E., Symmons, M. F., Koronakis, E., Hughes, C. & Koronakis, V. (2007). A periplasmic coiled-coil interface underlying TolC recruitment and the assembly of bacterial drug efflux pumps. Proc. Natl Acad. Sci. USA, 104, 4612–4617. 18. Okusu, H., Ma, D. & Nikaido, H. (1996). AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-

19.

20. 21.

22.

23.

24.

25. 26.

27.

28. 29.

30.

31.

32.

33.

34.

antibiotic-resistance (Mar) mutants. J. Bacteriol. 178, 306–308. Mokhonov, V. V., Mokhonova, E. I., Akama, H. & Nakae, T. (2004). Role of the membrane fusion protein in the assembly of resistance–nodulation–cell division multidrug efflux pump in Pseudomonas aeruginosa. Biochem. Biophys. Res. Commun. 322, 483–489. Kobayashi, N., Nishino, K. & Yamaguchi, A. (2001). Novel macrolide-specific ABC-type efflux transporter in Escherichia coli. J. Bacteriol. 183, 5639–5644. Rouquette-Loughlin, C. E., Balthazar, J. T. & Shafer, W. M. (2005). Characterization of the MacA–MacB efflux system in Neisseria gonorrhoeae. J Antimicrob Chemother, 56, 856–860. Lin, H. T., Bavro, V. N., Barrera, N. P., Frankish, H. M., Velamakanni, S., van Veen, H. W. et al. (2008). The MacB ABC transporter is a dimer whose ATPase activity and macrolide-binding capacity are regulated by the membrane fusion protein MacA. J. Biol. Chem. 283, 1145–1154. Yamanaka, H., Kobayashi, H., Takahashi, E. & Okamoto, K. (2008). MacAB is involved in the secretion of Escherichia coli heat-stable enterotoxin II. J. Bacteriol. 190, 7693–7698. Zgurskaya, H. I., Yamada, Y., Tikhonova, E. B., Ge, Q. & Krishnamoorthy, G. (2008). Structural and functional diversity of bacterial membrane fusion proteins.Biochim. Biophys. Acta; Epub ahead of print. Mikolosko, J., Bobyk, K., Zgurskaya, H. I. & Ghosh, P. (2006). Conformational flexibility in the multidrug efflux system protein AcrA. Structure, 14, 577–587. Higgins, M. K., Bokma, E., Koronakis, E., Hughes, C. & Koronakis, V. (2004). Structure of the periplasmic component of a bacterial drug efflux pump. Proc. Natl Acad. Sci. USA, 101, 9994–9999. Akama, H., Matsuura, T., Kashiwagi, S., Yoneyama, H., Narita, S., Tsukihara, T. et al. (2004). Crystal structure of the membrane fusion protein, MexA, of the multidrug transporter in Pseudomonas aeruginosa. J. Biol. Chem. 279, 25939–25942. Putman, M., van Veen, H. W. & Konings, W. N. (2000). Molecular properties of bacterial multidrug transporters. Microbiol. Mol. Biol. Rev. 64, 672–693. Piao, S., Xu, Y. & Ha, N. C. (2008). Crystallization and preliminary X-ray crystallographic analysis of MacA from Actinobacillus actinomycetemcomitans. Acta Crystallogr. Sect. F, 64, 391–393. Touze, T., Eswaran, J., Bokma, E., Koronakis, E., Hughes, C. & Koronakis, V. (2004). Interactions underlying assembly of the Escherichia coli AcrAB– TolC multidrug efflux system. Mol. Microbiol. 53, 697–706. Elkins, C. A. & Nikaido, H. (2003). Chimeric analysis of AcrA function reveals the importance of its C-terminal domain in its interaction with the AcrB multidrug efflux pump. J. Bacteriol. 185, 5349–5356. Krishnamoorthy, G., Tikhonova, E. B. & Zgurskaya, H. I. (2008). Fitting periplasmic membrane fusion proteins to inner membrane transporters: mutations that enable Escherichia coli AcrA to function with Pseudomonas aeruginosa MexB. J. Bacteriol. 190, 691–698. Gerken, H. & Misra, R. (2004). Genetic evidence for functional interactions between TolC and AcrA proteins of a major antibiotic efflux pump of Escherichia coli. Mol. Microbiol. 54, 620–631. Zgurskaya, H. I. & Nikaido, H. (1999). AcrA is a highly asymmetric protein capable of spanning the periplasm. J. Mol. Biol. 285, 409–420.

Crystal Structure of MacA 35. Zgurskaya, H. I. & Nikaido, H. (2000). Cross-linked complex between oligomeric periplasmic lipoprotein AcrA and the inner-membrane-associated multidrug efflux pump AcrB from Escherichia coli. J. Bacteriol. 182, 4264–4267. 36. Tamura, N., Murakami, S., Oyama, Y., Ishiguro, M. & Yamaguchi, A. (2005). Direct interaction of multidrug efflux transporter AcrB and outer membrane channel TolC detected via site-directed disulfide cross-linking. Biochemistry, 44, 11115–11121. 37. Bavro, V. N., Pietras, Z., Furnham, N., Perez-Cano, L., Fernandez-Recio, J., Pei, X. Y. et al. (2008). Assembly and channel opening in a bacterial drug efflux machine. Mol. Cell, 30, 114–121. 38. Andersen, C., Hughes, C. & Koronakis, V. (2000). Chunnel vision. Export and efflux through bacterial channel-tunnels. EMBO Rep. 1, 313–318. 39. Otwinosky, Z. & Minor, W. (1997). Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307–326. 40. CCP4. (1994). The CCP4 suite: programs for protein crystallography. Acta Crystallogr. Sect. D, 50, 760–763.

1297 41. Emsley, P. & Cowtan, K. (2004). Coot: model-building tools for molecular graphics. Acta Crystallogr. Sect. D, 60, 2126–2132. 42. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W. et al. (1998). Crystallography and NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr. Sect. D, 54, 905–921. 43. DeLano, W. (2002). The PyMOL User's Manual. DeLano Scientific, Palo Alto. 44. Ludtke, S. J., Baldwin, P. R. & Chiu, W. (1999). EMAN: semiautomated software for high-resolution singleparticle reconstructions. J. Struct. Biol. 128, 82–97. 45. Datsenko, K. A. & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl Acad. Sci. USA, 97, 6640–6645. 46. Yeom, J. H., Go, H., Shin, E., Kim, H. L., Han, S. H., Moore, C. J. et al. (2008). Inhibitory effects of RraA and RraB on RNase E-related enzymes imply conserved functions in the regulated enzymatic cleavage of RNA. FEMS Microbiol. Lett. 285, 10–15.