- Email: [email protected]
killed virus boost strategy
Veterinary Immunology and Immunopathology 154 (2013) 121–128
Contents lists available at SciVerse ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
CTLA4 mediated targeting enhances immunogenicity against PRRSV in a DNA prime/killed virus boost strategy Yalan Wang a,b,c , Haiyan Zhao a,b,c , Zhitao Ma a,b,c , Yongqiang Wang d , Wen-hai Feng a,b,c,∗ a
State Key Laboratory of Agrobiotechnology, China Agricultural University, Beijing 100193, China Ministry of Agriculture Key Laboratory of Soil Microbiology, China Agricultural University, Beijing 100193, China Department of Microbiology and Immunology, College of Biological Sciences, College of Veterinary Medicine, China Agricultural University, Beijing 100193, China d Key Laboratory of Animal Epidemiology and Zoonosis, Ministry of Agriculture, College of Veterinary Medicine, China Agricultural University, Beijing 100193, China b c
a r t i c l e
i n f o
Article history: Received 25 January 2013 Received in revised form 27 April 2013 Accepted 14 May 2013 Keywords: PRRSV Vaccine GP5 CTLA4 Heterologous prime-boost
a b s t r a c t Porcine reproductive and respiratory syndrome virus (PRRSV) is the causative agent of porcine reproductive and respiratory syndrome (PRRS), causing heavy economic losses to the swine industry all over the world. As current vaccination strategies could only confer limited and incomplete protection against PRRSV infection, a safe and efficient PRRSV vaccine is urgently needed. Vaccination with cytotoxic-T-lymphocyte-associated protein 4 (CTLA4) and antigen fusion expression plasmid which could target antigens to antigen presenting cells (APCs) has shown promising improvement of immunogenicity to antigens. In the present study, a fusion expression plasmid of CTLA4 and PRRSV GP5 was constructed. PRRSV-specific antibodies, neutralizing antibodies (NAs), cytokines of IFN␥ and IL4, and the lymphocyte proliferation activity were analyzed in mice immunized with the constructed plasmids. Immunization of mice with the CTLA4 targeted plasmid leads to a significant enhancement of humoral and cellular immune responses. Moreover, this effect could be further augmented when the mice were boosted with a killed PRRSV vaccine after DNA vaccine priming. Our data imply that both the APC-target and heterologous prime-boost strategies could be used to improve the immune efficacy of vaccines against PRRSV in pigs in the future. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Porcine reproductive and respiratory syndrome (PRRS) characterized by severe reproductive failure in sows and
∗ Corresponding author at: State Key Laboratory of Agrobiotechnology, Department of Microbiology and Immunology, College of Biological Sciences, China Agricultural University, Beijing 100193, China. Tel.: +86 10 62733335; fax: +86 10 62732012. E-mail address: [email protected] (W.-h. Feng). 0165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2013.05.008
respiratory distress in piglets is an important viral disease of pigs. It was first reported in 1987 in the US (Conzelmann et al., 1993), and then spread all over the world. Most recently, there have been devastating outbreaks of atypical PRRS in China, which is characterized by high fever, high morbidity, and high mortality in pigs of all ages (Goyal, 1993; Li et al., 2007; Tian et al., 2007; Tong et al., 2007; Zhou et al., 2008). However, until now there are no effective vaccines to prevent and control this disease. The causative agent, porcine reproductive and respiratory syndrome virus (PRRSV), is a positive-sense
122
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
single-stranded enveloped RNA virus, which belongs to the family Arteriviridae (Rossow, 1998). The viral genome is approximately 15.4 kb in size and contained 10 openreading frames (ORFs) (Dea et al., 2000; Firth et al., 2011). The ORF5-encoded major envelope glycoprotein (GP5) can induce neutralizing antibodies (Lopez and Osorio, 2004), and contains two T-cell epitopes (Vashisht et al., 2008). Accumulating evidences have shown that GP5 is the leading target for the development of genetic engineering vaccines against PRRSV. Several studies of GP5-based vaccines of PRRSV have been reported, including DNA vaccine co-expressing GP5 and M proteins (Jiang et al., 2006), recombinant adenovirus expressing GP5 by fusion with GP3 and/or GP4 of PRRSV (Jiang et al., 2008), and synthetic GP5 plasmid engineered with the codon usage optimized for mammalian cell expression (Li et al., 2009). Multiple strategies have been exploited to augment the induction of effective immunity following DNA vaccination, for example co-expression of cytokines and antigens of PRRSV, including ubiqutin (Hou et al., 2008), GM-CSF (Wang et al., 2009), and CD40L (Cao et al., 2010). One of the interesting approaches to improve the potency of DNA vaccine is to direct antigens to APCs. Cytotoxic-T-lymphocyte-associated protein 4 (CTLA4) expressed on activated T cells binds to B7-expressing cells, including antigen-presenting cells (APC). Fusion of antigens with CTLA-4 enhanced both humoral and the cellular immune responses to a model DNA vaccine (Boyle et al., 1998). Targeting influenza HA to APCs by fusion antigen with CTLA4 could greatly increase the antibody response, and more importantly, enhance protection from viral challenges (Deliyannis et al., 2000). DNA vaccine encoding CTLA4 and gp120 augmented HIV gp120-specific responses (Nayak et al., 2003). Immunization with plasmid fusion expression CTLA4 and hepatitis B surface antigen also improved both Th1 and Th2 responses (Zhou et al., 2010). Another particularly promising approach is the “primeboost” strategy. Several studies used DNA vaccine prime and recombinant viral vector, purified protein or killed virus boost elicited enhanced immune response compared with the use of only one of the vaccine alone. A polyvalent, multigene DNA prime and protein boost HIV vaccine induced broadly reactive neutralizing antibody and high levels of cellular immune response in human (Wang et al., 2008a). DNA prime-viral vector boost approach was able to elicit immune response against SHIV in a non-human primate model (Amara et al., 2001; Shiver et al., 2002). The humoral and cellular immune responses elicited by Hepatitis B DNA vaccine could be enhanced by protein boost (Xiao-wen et al., 2005). Heterologous HA DNA vaccine prime followed by inactivated flu vaccine boost was more effective in eliciting protective antibody response than the use of DNA or inactive vaccine alone (Wang et al., 2008b). In the current study, we constructed a targeted plasmid encoding PRRSV GP5 fused to the extracellular domain of porcine CTLA4, and evaluated its immunogenicity in BALB/c mice. Also, we used the heterologous prime-boost strategy to investigate whether priming with DNA and boosting with killed PRRSV vaccine could further enhance the immune response.
2. Materials and methods 2.1. Cells and virus Porcine alveolar macrophages (PAMs) which support the growth of PRRSV were obtained by postmortem lung lavage of 8-week-old specific pathogen free (SPF) pigs. PAMs were maintained in RPMI1640 supplemented with 10% fetal bovine serum at 37 ◦ C with 5% CO2 . Peripheral blood was collected from SPF pigs, and peripheral blood mononuclear cells (PBMC) were isolated by FicollPaque (Sigma) density gradient centrifugation following the manufacturer’s procedure. PBMC were cultured in RPMI 1640 supplemented with 10% pig serum plus 25% L929 cell culture supernatant at 37 ◦ C in a humidified 5% CO2 atmosphere. Hela cells were cultured in RPMI 1640 supplemented with 10% FBS. The PRRSV strain HV is a highly pathogenic PRRSV (HP-PRRSV) isolate (GenBank accession no. JX317648). The virus was propagated and titrated in PAMs and then stored at −80 ◦ C.
2.2. Preparation of killed vaccine The PRRSV isolate HV was used for vaccine preparation. The virus was purified by ultracentrifugation as described previously (Vanhee et al., 2009). The purified virus was inactivated by ultraviolet light (UV) at 254 nm for 30 min (Darnell et al., 2004; Dee et al., 2011). Before inoculation, the inactivated virus was emulsified with an equal volume of incomplete Freund’s adjuvant (IFA).
2.3. Construction of plasmids To amplify GP5 gene, total virus RNA was extracted from PRRSV HV isolate using TRIzol following the instruction of the manufacture. RT–PCR was performed to amplify the GP5 gene of PRRSV with the primers (sense: GP5-1, antisense: GP5-2) listed in Table 1. For porcine CTLA4 (pCTLA4), total RNA was isolated from porcine PBMC stimulated for 24 h with concanavalin A (5 g/ml) (Tachedjian et al., 2003). Primer sequences (sense: CTLA4-1, antisense: CTLA4-2) used for the amplification were the same as previously described (Vaughan et al., 2000). The extracellular region of pCTLA4 was PCRamplified using a sequenced clone of pCTLA4 as a template. The sense primer (CTLA4-1) was identical with the fulllength sequence. The antisense primer (CTLA4-3) was based on 11 amino acids immediately adjacent to the transmembrane region, linked to a flexible linker of sequence encoding GlyGlySerGlyGly (GGSGG) and a restriction site for BamH I. All the primers were listed in Table 1. The two fragments of GP5 of PRRSV and extracellular regions of porcine CTLA4 were inserted into pVAX vector, respectively, to generate the recombinant pVAX-5 and pVAX-CTLA4 plasmids. To construct the fusion plasmid, DNA fragment of GP5 was placed down-stream of the extracellular domain of CTLA-4 gene in frame of pVAXCTLA4 and joined by a GGSGG flexible linker, named
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
123
Table 1 Primer sequences for amplification of procine CTLA4 gene and GP5 gene. Name
Sequence (5 → 3 )
Amplified gene
GP5-1
CGGGATCCATGTTGGGGAAATGCTTGACC BamHI GGAATTCCTAGAGACGACCCCATTGTTC EcoRI TTGAAGCTTAGCCATGGCTTGCTCTGGA HindIII TAATGAATTCTCAATTGATGGGAATAAAATAAG EcoRI CGGGATCCACCACCGGAGCCACCATCAGAATCTGGGCATGGTTCTG BamHI L (GGSGG) linker
ORF5 with stop cordon
GP5-2 CTLA4-1 CTLA4-2 CTLA4-3
procine CTLA4 with stop cordon
extracellular domain of procine CTLA4 without stop cordon
Bold italic = Restriction enzyme site; underline = GlyGlySerGlyGly (GGSGG) linker.
pVAX-CTLA4-5. All nucleotide sequences introduced into vectors were verified by DNA sequencing.
mice were sacrificed and splenocytes were harvested for lymphocyte proliferation assay.
2.4. Transfection and indirect immunofluorescence assay (IIFA)
2.7. Indirect ELISA (iELISA)
Hela cells were seeded onto 6-well tissue culture plates, and transfection was performed using TurboFect Transfection Reagent (Thermo Scientific) until the cells reached approximately 70–90% confluence. Forty-eight hours after transfection, the cells were fixed and GP5 expression was detected using the indirect immunofluorescence assay (IFA) with anti-GP5 serum diluted at 1:2000 (made in our lab) as the primary antibody and a fluorescein isothiocyanate (FITC) conjugated goat anti-rabbit IgG (H + L) (1:200; Sigma) as the secondary antibody.
Purified PRRSV antigen was used as iELISA antigen and coated in 96-well plates at the concentration of 10 g/ml. The plates were blocked with 5% skimmed milk in PBST. The sera of mice were diluted at 1:100 in PBST with 2% skimmed milk and added into the plates. After incubation for 2 h at 37 ◦ C, the wells were washed three times, and then reacted with 100 l of a 1:5000 dilution of horseradish peroxidaseconjugated goat-anti-mouse lgG for 1 h at 37 ◦ C. After being washed three times with PBST, the wells were incubated with substrate solution tetramethyl benzidine (TMB) at 37 ◦ C for 15 min, and then were stopped with 2 M H2 SO4 . The OD was read at 450 nm using an ELISA reader.
2.5. Western blot analysis 2.8. Serum neutralization assay For western blot analysis, at 48 h after transfection, the extracts of Hela cells were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS -PAGE) and transferred to polyvinyl difluoride (PVDF) membranes (Millipore). After blocking, the membranes were incubated for 1 h with the anti-GP5 serum diluted at 1:2000, followed by incubation for 1 h at room temperature with goat anti-rabbit IgG (Santa Cruz Biotechnology). The antibodies were visualized by use of the ECL reagent (Millipore) according to the manufacturer’s instructions. 2.6. Inoculation of mice Nine groups of female BALB/c mice (6-week old) were immunized three times at two weeks interval. As shown in Table 2, group 1 was immunized with 100 l sterile PBS (pH 7.4) and group 2 to 4 were intramuscularly injected with 100 l sterile PBS (pH 7.4) containing 100 g different plasmids per mice for three times. Group 5 to 7 were immunized with plasmids at day 0 and day 14, and then boosted subcutaneously at day 28 with 15 g of killed PRRSV vaccine per mice. Group 8 was immunized with killed PRRSV vaccine at 0 and 14 day, and boosted with plasmid of pVAX-CTLA4-5 at day 28. Group 9 was injected with killed PRRSV vaccine for three times. Serum samples were collected before each immunization and before sacrificed for serological tests. At day 7 after the third immunization,
Serum samples were heat inactivated at 56 ◦ C for 30 min prior to performing the serum neutralization assay. Two fold serially diluted sera (50 l) were mixed with an equal volume of 100 TCID50 of the PRRSV HV isolate and incubated for 1 h at 37 ◦ C. Then the mixture was added to PAMs in 96-well tissue culture plates. After 40 h, the culture plate was fixed for 10 min with cold methanol-acetone (1:1). The presence of virus was detected by indirect immunofluorescence assay. Neutralization titers were expressed as the reciprocal of the highest dilution that inhibited 90% of the virus present in the control wells. 2.9. Lymphocyte proliferation assay Mice were sacrificed and single lymphocyte suspensions were prepared from spleens on day 7 after the third immunization. The cells were seeded in 96-well plates at 3 × 105 cells/well in RPMI-1640 plus 10% of fetal bovine serum (FBS) and incubated at 37 ◦ C and 5% CO2 for 48 h, with 500 ng/ml of ionomycin and 50 ng/ml PMA as a positive control, 10 g/ml of the purified PRRSV as specific antigen, 5 g/ml of BSA as irrelevant antigen control, or no antigen as a negative control. T cell proliferation was performed by MTT method according to the previously described protocols (Lillehoj, 1986). Lymphocyte proliferation was expressed as the stimulation index (SI), which
124
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
Table 2 Immunization schedule. Groups
(1)PBS (2)pVAX (3)pVAX-5 (4)pVAX-CTLA4-5 (5)pVAX + KV (6)pVAX-5 +KV (7)pVAX-CTLA4-5 +KV (8)KV + pVAX-CTLA4-5 (9)KV + KV
Candidate vaccines Priming 1st (0d)
Priming2st (14d)
Boosting (28d)
PBS pVAX pVAX-5 pVAX-CTLA4-5 pVAX pVAX-5 pVAX-CTLA4-5 killed virus with IFA killed virus with IFA
PBS pVAX pVAX-5 pVAX-CTLA4-5 pVAX pVAX-5 pVAX-CTLA4-5 killed virus with IFA killed virus with IFA
PBS pVAX pVAX-5 pVAX-CTLA4-5 killed virus with IFA killed virus with IFA killed virus with IFA pVAX-CTLA4-5 killed virus with IFA
The schedule of immunization of BABL/C mice with DNA plasmids and killed virus vaccine in different prime-boost regimens.
was defined as the ratio of the average OD495 value of stimulated wells to that of un-stimulated wells. 2.10. Real-Time PCR Splenocytes (1 × 106 /ml) were cultured in 24-well plates for 18 h at 37 ◦ C in the presence of 5% CO2 , and stimulated with 10 g/ml purified PRRSV. Total RNA was extracted from cells using TRIzol reagent (Invitrogen). Real-time PCR was performed to measure the mRNA expression level of mouse IFN␥ and IL4 following the manufacturer’s instructions of the ABI ViiA7 real-time PCR system. The IFN␥ and IL4 gene expressions were normalized to HPRT and presented as fold induction relative to the control. The specific primers used were the same as described previously (Liu et al., 2005): For IL4: sense: GAATGTACCAGGAGCCATATC; antisense: CTCAGTACTACGAGTAATCCA. For IFN␥: sense: AACGCTACACACTGCATCTTGG; antisense: CAAGACTTCAAAGAGTCTGAGG. For HPRT: sense: GTTGGATACAGGCCAGACTTTGTTG; antisense: GATTCAACTTGCGCTCATCTTAGGC. 2.11. Statistics The difference in the level of humoral and cellular immune responses between different groups was evaluated by Student’s t-test. P-values of <0.05 were considered statistically significant. 3. Results 3.1. Construction and expression of pVAX-GP5 and pVAX-CTLA4-5 Two eukaryotic expression plasmids were constructed as described in Methods (Fig. 1). The pVAX-GP5 plasmid encoded the glycosylated membrane protein of PRRSV GP5. For pVAX-CTLA4-5, the coding region of GP5 was fused to the C-terminal of extracellular domain of porcine CTLA4 with a GGSGG linker. In vitro expressions of pVAX-GP5 and pVAX-CTLA45 were evaluated by western blot analysis and IIFA at 48 h post-transfection. As shown in Fig. 2a, two protein bands of 26 kDa and 40 kDa consistent with the predicted sizes of GP5 and CTLA4-GP5 proteins were clearly
Fig. 1. Schematic diagrams of plasmids used for expression analysis in vitro or directly for DNA immunization. The construction of each plasmid is based on pVAX. pCMV: Human cytomegalovirus immediateearly promoter/enhancer; ORF5: ORF5 gene from the HP-PRRSV HV strain; CTLA4: extracellular domain of porcine CTLA4; L: GlyGlySerGlyGly (GGSGG) linker.
observed in the extracts of cells transfected with pVAX-GP5 or pVAX-CTLA4-5, whereas no specific protein band was found in lysates of cells transfected with the empty vector. Meanwhile, indirect immunofluorescence assay also revealed the presence of expressed proteins in the transfected cells (Fig. 2b). As shown in Fig. 2b, Hela cells transfected with the plasmids of pVAX-GP5 or pVAXCTLA4-5 could be stained with GP5-specific serum, but cells transfected with pVAX could not be stained, proving that the plasmids of pVAX-GP5 and pVAX-CTLA4-5 were well expressed in Hela cells. 3.2. Humoral immune response in mice 3.2.1. Serum PRRSV-specific IgG response Seven days after the third immunization, mouse serum antibodies were detected against PRRSV using the purified PRRSV as antigens. Serological analysis showed that BALB/c mice vaccinated with the fusion expression plasmid of pVAX-CTLA4-5 elicited a higher level of PRRSV-specific antibody compared with mice inoculated with DNA vaccine expressed pVAX or pVAX-GP5. Killed virus vaccine boost significantly increased PRRSV-specific antibodies. Mice in groups of pVAX-5 + KV and pVAX-CTLA4-5 + KV which immunized with pVAX-5 or pVAX-CTLA4-5 priming and killed PRRSV vaccine boosting had higher serum antibody titer than mice immunized with plasmids or killed vaccine alone. The strongest anti-PRRSV antibody response was achieved in KV + KV group which immunized with killed PRRSV vaccine for three times. This indicates that
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
125
Fig. 2. Identification of expression of vaccine constructs in vitro. (a) Western blot analysis of Hela cells transfected with pVAX (lane 1), pVAX-GP5 (lane 2), and pVAX-CTLA4-GP5 (lane 3), respectively. Rabbit anti-GP5 serum was used for western blot. Protein standards are shown on the left side of panel. (b) iIFA analysis of Hela cells transfected with different plasmid using rabbit anti-GP5 serum.
killed vaccine is very efficient in eliciting humoral immune response (Fig. 3). 3.2.2. Anti-PRRSV neutralizing antibody We further evaluated the ability of sera from immunized mice to neutralize HP-PRRSV strain HV in vitro by using serum neutralization assays. As shown in Table 3, mice immunized with the fusion plasmid pVAX-CTLA4-5 developed higher PRRSV-specific mean neutralizing antibody titer (1:24) than mice in group of pVAX-GP5 (1:13.3) at 7 days after the third immunization (P < 0.01). The highest level of neutralizing antibodies (1:64) was observed in the group of pVAX-CTLA4-5 + KV (mean = 1:32) followed by the groups of pVAX-CTLA4-5 (mean = 1:24) and pVAX-GP5 + KV (mean = 1:21.3). In the mice of pVAX + KV group, the level of neutralizing antibodies is very low.
Although the PRRSV-specific antibody titers in the groups of KV + pVAX-CTLA4-5 and KV + KV were extremely high, the levels of neutralizing antibody were low. These results indicated that APC-targeted DNA vaccine pVAX-CTLA4-5 elicited more effective humoral immune responses than pVAX-GP5. Moreover, immunization with the DNA vaccine as priming and killed virus vaccine as boosting was more powerful in generating humoral immune responses compared to the responses induced by the DNA vaccine or killed virus vaccine alone. 3.3. Lymphocyte proliferation response To further investigate the cell-mediated immune response, the lymphocyte-proliferation assay was performed at day 7 after the third immunization. As shown in Fig. 4, all of the groups developed significant enhanced proliferation responses when compared with the control Table 3 Neutralizing antibodies in mice immunized with different prime-boost regimens. Groups
PBS pVAX pVAX-5 pVAX-CTLA4-5 pVAX + KV pVAX-5 + KV pVAX-CTLA4-5 + KV KV + pVAX-CTLA4-5 KV + KV Fig. 3. Humoral immune response in mice. Serum samples were collected at 7 days after the third immunization and antibodies to PRRSV were detected with ELISA using a single dilution (1:100). Data represent the mean ± S.D. for 6 mice.
Candidate vaccines <1:8
1:8
1:16
1:32
1:64
mean
6 6 0 0 2 0 0 3 2
0 0 2 0 4 0 0 1 1
0 0 4 3 0 4 2 2 3
0 0 0 3 0 2 3 0 0
0 0 0 0 0 0 1 0 0
NR NR 13.3 24 NR 21.3 32 NR NR
NR: no result. Serum samples were collected before the mice sacrificed and the PRRSV-specific neutralizing antibodies were determined using a serum-neutralization assay. The results were calculated with the mean of all detectable neutralizing antibodies titers in mice within a group.
126
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
pVAX-CTLA4-5 + KV than that in mice from pVAX, pVAXGP5, or pVAX-CTLA4-5 groups (Fig. 5b). However, there was no difference in the expression level of the IL4 among them. Mice priming with killed vaccine twice and boosting with pVAX-CTLA4-5 plasmid elicited high levels of IL4. The highest level of IL4 was observed in mice from the group of KV + KV which was immunized with killed PRRSV vaccine for three times. These results suggested that DNA vaccine with the fusion expression of CTLA4 and PRRSV GP5 stimulated Th1 responses more efficiently, while killed PRRSV vaccine stimulated Th2 responses more efficiently. And boosting with killed virus vaccine after DNA vaccine priming significantly enhanced both Th1 and Th2 responses. 4. Discussion
Fig. 4. Lymphocyte proliferation response in mice immunized with different vaccines. Seven days after the third immunization, mice were sacrificed and the splenocytes were isolated and stimulated with purified PRRSV antigen (10 g/ml). After 48 h stimulation, MTT was added and the OD values were determined after 4 h incubation. Data were shown as mean ± S.D.
group of mice immunized with pVAX. The stimulation index was significant higher (P = 0.009) in mice immunized with pVAX-CTLA4-5 than in mice immunized with pVAXGP5. Both pVAX-GP5 + KV and pVAX-CTLA4-5 + KV groups elicited significantly higher cell proliferation than groups of pVAX-GP5 and pVAX-CTLA4-5 that were only immunized with DNA vaccines. Mice in the groups of KV+ pVAXCTLA4-5 and KV + KV induced significantly higher levels of lymphocyte-proliferation compared with mice immunized with PBS, but it was substantially lower than mice in the group of pVAX-CTLA4-5 + KV. These results suggested that fusion expression of CTLA4 to GP5 was more efficiently presenting GP5 to APCs to elicit higher antigen-specific T cell response. Moreover, boosting with killed virus after two priming with DNA vaccine significantly enhanced the level of lymphocyte-proliferation. 3.4. Th1-type and Th2-type cytokine responses Quantitative real-time PCR was performed to analyze the mRNA expression levels of Th1 cytokine of IFN␥ and Th2 cytokine of IL4. As shown in Fig. 5a, the expression level of IFN␥ from mice immunized with pVAX-CTLA4-5 was significantly increased, while the production of IFN␥ in the group of pVAX-GP5 was insignificant compared with the control group. Priming with DNA and boosting with the killed PRRSV vaccine remarkably increased the level of IFN␥. Mice in groups of pVAX-GP5 + KV and pVAX-CTLA4-5 + KV had significant higher levels of IFN␥ than the groups of pVAX-GP5 and pVAX-CTLA4-5 which used DNA vaccine alone. Both of the mice in group of KV+ pVAX-CTLA4-5 and KV + KV also elicited high levels of IFN␥. However, the highest level of IFN␥ was produced in the group of pVAX-CTLA4-5 + KV, which was nearly 30 fold of the control group of pVAX. The expression of IL-4 was significantly enhanced after boosting with the killed virus in mice from groups of pVAX + KV, pVAX-GP5 + KV, and
An ideal PRRSV vaccine should be able to generate neutralizing antibodies and induce a high level of cellular immune response. There are two types of commercial vaccines of PRRSV: MLV and killed vaccines. However, both of them have inherent drawbacks. Killed vaccine is weak in immunogenicity and they cannot always provide protective immunity against PRRSV infection (Meng, 2000). The modified live vaccine has a risk of reverting to virulence although they could confer protection against clinical diseases (Meng, 2000; Nielsen et al., 2001). Thus, there is an urgent need to develop more efficacious vaccines against PRRSV. In this report, we used APC-target and heterologous “prime-boost” strategies to enhance the efficacy of vaccines against PRRSV. We designed and constructed CTLA4 and GP5 of PRRSV fusion expression plasmid and evaluated its immunogenicity in mice. The results showed that an enhanced humoral and cellular immune response could be elicited in mice immunized with CTLA4 and PRRSV GP5 fusion expression plasmid compared with DNA plasmid encoding GP5 alone. We demonstrated that the CTLA4 fusion expression plasmid induced increased PRRSV-specific antibodies compared to non-targeted DNA vaccination. Our results are in agreement with a previous report (Tachedjian et al., 2003), who demonstrated that gene gun delivery of DNA vector that expressing a CTLA4ovalbumin (OVA) fusion antigen enhanced OVA-specific humoral immune response. Similarly, vaccination of sheep with a DNA vaccine expressing pro cathepsin B antigen from the Fasciola hepatica fused to CTLA-4 increased the speed and magnitude of the antibody response (Kennedy et al., 2006). VN antibodies is very important for the protective immunity against PRRSV, as it could inhibit PRRSV replication in porcine alveolar macrophages (PAM) by blocking attachment to/and internalization in the cell (Delputte et al., 2004). As shown in Table 3, the mean titer of neutralizing antibody was also increased after vaccination with a DNA vaccine expressing GP5 of PRRSV fused to CTLA4. The APC-target strategy also enhanced the cellular immune response as well as the humoral immune response. There was a significant increase of lymphocyte proliferation activity in the group inoculated CTLA4 fusion expression plasmid. The production of IFN␥ was increased in the group immunized with fusion expression plasmid of pVAX-CTLA4-5, while the level expression of IL4 did not
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
127
Fig. 5. Real-time PCR for cytokine gene expression. Mice splenocytes were collected at 7 days after the last immunization and stimulated with purified PRRSV antigen (10 g/ml). After 18 h of stimulation, total RNA was isolated and IFN␥ and IL4 levels were analyzed using RT-PCR. HPRT mRNA served as an internal reference. (a) The relative expression of Th1-type cytokine of IFN␥ and (b) the relative expression of Th2-type cytokine of IL4.
increase. These results suggested that the Th1-type but not Th2-type immune response might be enhanced when the CTLA4-target strategy was used. Although the mechanism of the CTLA4 as a molecular adjuvant is unclear, there are several possible explanations for the improved efficacy of DNA vaccines. As CTLA4 has high affinity to its B7 ligands on APC, antigen fusion expression to CTLA4 could be targeted to APCs. The increased level of the antigen up-taking and presenting by CTLA4 targeting may improve the efficacy of DNA vaccine (Deliyannis et al., 2000). To further enhance the immune response against PRRSV, we also tried the heterologous prime–boost vaccination regimen. Mice were primed twice with DNA plasmids and boosted with a heterologous vaccine, a killed PRRSV vaccine. From the results we could see that after we boosted the mice with heterologous killed PRRSV vaccine, both the levels of PRRSV-specific antibodies and the neutralizing antibodies were significantly increased. Cellular immune response was analyzed by lymphocyte proliferation response and cytokine assay. After the mice were primed with fusion expression plasmid of pVAX-CTLA45 and boosted with killed PRRSV vaccine, the lymphocyte proliferation activity increased 2-folds and the expression level of IFN␥ increased nearly 6-folds compared with the group immunized with DNA vaccine of pVAX-CTLA45 alone. The production of IL4 was also increased after KV boosting, but there is no difference among groups primed with or without recombinant plasmid vaccine. Mice in groups of KV + pVAX-CTLA4-5 and KV + KV elicited high levels of PRRSV-specific antibody, but it was not efficient to elicit cellular immune response, which is indicated that killed virus vaccine was efficient in eliciting humoral immune response although it may not be efficient in eliciting cellular immune response It is interesting that in groups of KV + pVAX-CTLA4-5 and KV + KV, PRRSV-specific antibody is significantly induced, while the neutralizing antibody level is very low. Although DNA vaccination is an effective way to generate humoral and cell-mediated responses (Shedlock and Weiner, 2000), the immunogenicity of DNA vaccine is low
when used alone. It is believed that DNA vaccine appears to be an excellent priming agent and is less efficient for boosting (Lu, 2009). It might be due to the low level but persistent expression of antigens in vivo. Antigen specific memory T cells were selectively increased and the affinity of T cells to MHC molecules could be higher after multiple exposures to limited amounts of antigens. Thus, in the heterologous “prime-boost” regimen, DNA vaccines have the ability to generate high-affinity T cells, and T cell responses are greatly amplified after the following boosting (Woodland, 2004). Traditional inactivated PRRSV vaccine which contains whole antigen of PRRSV could elicit humoral immune response but is not efficient to elicit T cell response. We used heterologous “prime-boost” vaccination regimen that combined the strengths of DNA vaccine and conventional killed vaccine and effectively elicited cellular and humoral immune responses, suggesting that immunogenicity could be improved when both of the APC-target and heterologous “prime-boost” strategies are used. In summary, we demonstrated that CTLA4 fused with GP5 of PRRSV could enhance GP5 immunogenicity. Furthermore, priming with DNA vaccine and boosting with killed virus vaccine improved the immune response against PRRSV. When we combined the APC-target and heterologous prime-boost strategies, both the humoral and cellular immune responses were significantly enhanced, implying that these two strategies could be used for the generation of new vaccines against PRRSV in pigs. Acknowledgements This work was supported by the Faculty Starting Grant and State Key Laboratory of Agrobiotechnology (Grants 2010SKLAB06-1 and 2012SKLAB01-6), China Agricultural University, China. References Amara, R.R., Villinger, F., Altman, J.D., Lydy, S.L., O’Neil, S.P., Staprans, S.I., Montefiori, D.C., Xu, Y., Herndon, J.G., Wyatt, L.S., Candido, M.A., Kozyr, N.L., Earl, P.L., Smith, J.M., Ma, H.L., Grimm, B.D., Hulsey, M.L., Miller, J., McClure, H.M., McNicholl, J.M., Moss, B., Robinson, H.L., 2001.
128
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
Control of a mucosal challenge and prevention of AIDS by a multiprotein DNA/MVA vaccine. Science 292, 69–74. Boyle, J.S., Brady, J.L., Lew, A.M., 1998. Enhanced responses to a DNA vaccine encoding a fusion antigen that is directed to sites of immune induction. Nature 392, 408–411. Cao, J., Wang, X., Du, Y., Li, Y., Jiang, P., 2010. CD40 ligand expressed in adenovirus can improve the immunogenicity of the GP3 and GP5 of porcine reproductive and respiratory syndrome virus in swine. Vaccine 28, 7514–7522. Conzelmann, K.K., Visser, N., Van Woensel, P., Thiel, H.J., 1993. Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the arterivirus group. Virology 193, 329–339. Darnell, M.E., Subbarao, K., Feinstone, S.M., Taylor, D.R., 2004. Inactivation of the coronavirus that induces severe acute respiratory syndrome, SARS-CoV. J. Virol. Methods 121, 85–91. Dea, S., Gagnon, C.A., Mardassi, H., Pirzadeh, B., Rogan, D., 2000. Current knowledge on the structural proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North American and European isolates. Arch. Virol 145, 659–688. Dee, S., Otake, S., Deen, J., 2011. An evaluation of ultraviolet light (UV254) as a means to inactivate porcine reproductive and respiratory syndrome virus on common farm surfaces and materials. Vet. Microbiol. 150, 96–99. Deliyannis, G., Boyle, J.S., Brady, J.L., Brown, L.E., Lew, A.M., 2000. A fusion DNA vaccine that targets antigen-presenting cells increases protection from viral challenge. Proc. Natl. Acad. Sci. U. S. A. 97, 6676–6680. Delputte, P.L., Meerts, P., Costers, S., Nauwynck, H.J., 2004. Effect of virus-specific antibodies on attachment, internalization and infection of porcine reproductive and respiratory syndrome virus in primary macrophages. Vet. Immunol. Immunopathol. 102, 179–188. Firth, A.E., Zevenhoven-Dobbe, J.C., Wills, N.M., Go, Y.Y., Balasuriya, U.B., Atkins, J.F., Snijder, E.J., Posthuma, C.C., 2011. Discovery of a small arterivirus gene that overlaps the GP5 coding sequence and is important for virus production. J. Gen. Virol. 92, 1097–1106. Goyal, S.M., 1993. Porcine reproductive and respiratory syndrome. J. Vet. Diagn. Invest. 5, 656–664. Hou, Y.H., Chen, J., Tong, G.Z., Tian, Z.J., Zhou, Y.J., Li, G.X., Li, X., Peng, J.M., An, T.Q., Yang, H.C., 2008. A recombinant plasmid co-expressing swine ubiquitin and the GP5 encoding-gene of porcine reproductive and respiratory syndrome virus induces protective immunity in piglets. Vaccine 26, 1438–1449. Jiang, Y., Xiao, S., Fang, L., Yu, X., Song, Y., Niu, C., Chen, H., 2006. DNA vaccines co-expressing GP5 and M proteins of porcine reproductive and respiratory syndrome virus (PRRSV) display enhanced immunogenicity. Vaccine 24, 2869–2879. Jiang, W., Jiang, P., Wang, X., Li, Y., Du, Y., 2008. Enhanced immune responses of mice inoculated recombinant adenoviruses expressing GP5 by fusion with GP3 and/or GP4 of PRRS virus. Virus Res. 136, 50–57. Kennedy, N.J., Spithill, T.W., Tennent, J., Wood, P.R., Piedrafita, D., 2006. DNA vaccines in sheep: CTLA-4 mediated targeting and CpG motifs enhance immunogenicity in a DNA prime/protein boost strategy. Vaccine 24, 970–979. Li, Y., Wang, X., Bo, K., Tang, B., Yang, B., Jiang, W., Jiang, P., 2007. Emergence of a highly pathogenic porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China. Vet. J. 174, 577–584. Li, B., Xiao, S., Wang, Y., Xu, S., Jiang, Y., Chen, H., Fang, L., 2009. Immunogenicity of the highly pathogenic porcine reproductive and respiratory syndrome virus GP5 protein encoded by a synthetic ORF5 gene. Vaccine 27, 1957–1963. Lillehoj, H.S., 1986. Immune response during coccidiosis in SC and FP chickens. I. In vitro assessment of T cell proliferation response to stage-specific parasite antigens. Vet. Immunol. Immunopathol. 13, 321–330. Liu, L., Zhou, X., Liu, H., Xiang, L., Yuan, Z., 2005. CpG motif acts as a ‘danger signal’ and provides a T helper type 1-biased microenvironment for DNA vaccination. Immunology 115, 223–230. Lopez, O.J., Osorio, F.A., 2004. Role of neutralizing antibodies in PRRSV protective immunity. Vet. Immunol. Immunopathol. 102, 155–163. Lu, S., 2009. Heterologous prime-boost vaccination. Curr. Opin. Immunol. 21, 346–351. Meng, X.J., 2000. Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Vet. Microbiol. 74, 309–329.
Nayak, B.P., Sailaja, G., Jabbar, A.M., 2003. Enhancement of gp120-specific immune responses by genetic vaccination with the human immunodeficiency virus type 1 envelope gene fused to the gene coding for soluble CTLA4. J. Virol. 77, 10850–10861. Nielsen, H.S., Oleksiewicz, M.B., Forsberg, R., Stadejek, T., Botner, A., Storgaard, T., 2001. Reversion of a live porcine reproductive and respiratory syndrome virus vaccine investigated by parallel mutations. J. Gen. Virol. 82, 1263–1272. Rossow, K.D., 1998. Porcine reproductive and respiratory syndrome. Vet. Pathol. 35, 1–20. Shedlock, D.J., Weiner, D.B., 2000. DNA vaccination: antigen presentation and the induction of immunity. J. Leukoc. Biol. 68, 793–806. Shiver, J.W., Fu, T.M., Chen, L., Casimiro, D.R., Davies, M.E., Evans, R.K., Zhang, Z.Q., Simon, A.J., Trigona, W.L., Dubey, S.A., Huang, L., Harris, V.A., Long, R.S., Liang, X., Handt, L., Schleif, W.A., Zhu, L., Freed, D.C., Persaud, N.V., Guan, L., Punt, K.S., Tang, A., Chen, M., Wilson, K.A., Collins, K.B., Heidecker, G.J., Fernandez, V.R., Perry, H.C., Joyce, J.G., Grimm, K.M., Cook, J.C., Keller, P.M., Kresock, D.S., Mach, H., Troutman, R.D., Isopi, L.A., Williams, D.M., Xu, Z., Bohannon, K.E., Volkin, D.B., Montefiori, D.C., Miura, A., Krivulka, G.R., Lifton, M.A., Kuroda, M.J., Schmitz, J.E., Letvin, N.L., Caulfield, M.J., Bett, A.J., Youil, R., Kaslow, D.C., Emini, E.A., 2002. Replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity. Nature 415, 331–335. Tachedjian, M., Boyle, J.S., Lew, A.M., Horvatic, B., Scheerlinck, J.P., Tennent, J.M., Andrew, M.E., 2003. Gene gun immunization in a preclinical model is enhanced by B7 targeting. Vaccine 21, 2900–2905. Tian, K., Yu, X., Zhao, T., Feng, Y., Cao, Z., Wang, C., Hu, Y., Chen, X., Hu, D., Tian, X., Liu, D., Zhang, S., Deng, X., Ding, Y., Yang, L., Zhang, Y., Xiao, H., Qiao, M., Wang, B., Hou, L., Wang, X., Yang, X., Kang, L., Sun, M., Jin, P., Wang, S., Kitamura, Y., Yan, J., Gao, G.F., 2007. Emergence of fatal PRRSV variants: unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS One 2, e526. Tong, G.Z., Zhou, Y.J., Hao, X.F., Tian, Z.J., An, T.Q., Qiu, H.J., 2007. Highly pathogenic porcine reproductive and respiratory syndrome, China. Emerg. Infect. Dis. 13, 1434–1436. Vanhee, M., Delputte, P.L., Delrue, I., Geldhof, M.F., Nauwynck, H.J., 2009. Development of an experimental inactivated PRRSV vaccine that induces virus-neutralizing antibodies. Vet. Res. 40, 63. Vashisht, K., Goldberg, T.L., Husmann, R.J., Schnitzlein, W., Zuckermann, F.A., 2008. Identification of immunodominant T-cell epitopes present in glycoprotein 5 of the North American genotype of porcine reproductive and respiratory syndrome virus. Vaccine 26, 4747–4753. Vaughan, A.N., Malde, P., Rogers, N.J., Jackson, I.M., Lechler, R.I., Dorling, A., 2000. Porcine CTLA4-Ig lacks a MYPPPY motif, binds inefficiently to human B7 and specifically suppresses human CD4+ T cell responses costimulated by pig but not human B7. J. Immunol. 165, 3175–3181. Wang, S., Kennedy, J.S., West, K., Montefiori, D.C., Coley, S., Lawrence, J., Shen, S., Green, S., Rothman, A.L., Ennis, F.A., Arthos, J., Pal, R., Markham, P., Lu, S., 2008a. Cross-subtype antibody and cellular immune responses induced by a polyvalent DNA prime-protein boost HIV-1 vaccine in healthy human volunteers. Vaccine 26, 3947–3957. Wang, S., Parker, C., Taaffe, J., Solorzano, A., Garcia-Sastre, A., Lu, S., 2008b. Heterologous HA DNA vaccine prime–inactivated influenza vaccine boost is more effective than using DNA or inactivated vaccine alone in eliciting antibody responses against H1 or H3 serotype influenza viruses. Vaccine 26, 3626–3633. Wang, X., Li, J., Jiang, P., Li, Y., Zeshan, B., Cao, J., 2009. GM-CSF fused with GP3 and GP5 of porcine reproductive and respiratory syndrome virus increased the immune responses and protective efficacy against virulent PRRSV challenge. Virus Res. 143, 24–32. Woodland, D.L., 2004. Jump-starting the immune system: prime-boosting comes of age. Trends Immunol. 25, 98–104. Xiao-wen, H., Shu-han, S., Zhen-lin, H., Jun, L., Lei, J., Feng-juan, Z., Yanan, Z., Ying-jun, G., 2005. Augmented humoral and cellular immune responses of a hepatitis B DNA vaccine encoding HBsAg by protein boosting. Vaccine 23, 1649–1656. Zhou, Y.J., Hao, X.F., Tian, Z.J., Tong, G.Z., Yoo, D., An, T.Q., Zhou, T., Li, G.X., Qiu, H.J., Wei, T.C., Yuan, X.F., 2008. Highly virulent porcine reproductive and respiratory syndrome virus emerged in China. Transbound. Emerg. Dis. 55, 152–164. Zhou, C., Peng, G., Jin, X., Tang, J., Chen, Z., 2010. Vaccination with a fusion DNA vaccine encoding hepatitis B surface antigen fused to the extracellular domain of CTLA4 enhances HBV-specific immune responses in mice: implication of its potential use as a therapeutic vaccine. Clin. Immunol. 137, 190–198.
Contents lists available at SciVerse ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
CTLA4 mediated targeting enhances immunogenicity against PRRSV in a DNA prime/killed virus boost strategy Yalan Wang a,b,c , Haiyan Zhao a,b,c , Zhitao Ma a,b,c , Yongqiang Wang d , Wen-hai Feng a,b,c,∗ a
State Key Laboratory of Agrobiotechnology, China Agricultural University, Beijing 100193, China Ministry of Agriculture Key Laboratory of Soil Microbiology, China Agricultural University, Beijing 100193, China Department of Microbiology and Immunology, College of Biological Sciences, College of Veterinary Medicine, China Agricultural University, Beijing 100193, China d Key Laboratory of Animal Epidemiology and Zoonosis, Ministry of Agriculture, College of Veterinary Medicine, China Agricultural University, Beijing 100193, China b c
a r t i c l e
i n f o
Article history: Received 25 January 2013 Received in revised form 27 April 2013 Accepted 14 May 2013 Keywords: PRRSV Vaccine GP5 CTLA4 Heterologous prime-boost
a b s t r a c t Porcine reproductive and respiratory syndrome virus (PRRSV) is the causative agent of porcine reproductive and respiratory syndrome (PRRS), causing heavy economic losses to the swine industry all over the world. As current vaccination strategies could only confer limited and incomplete protection against PRRSV infection, a safe and efficient PRRSV vaccine is urgently needed. Vaccination with cytotoxic-T-lymphocyte-associated protein 4 (CTLA4) and antigen fusion expression plasmid which could target antigens to antigen presenting cells (APCs) has shown promising improvement of immunogenicity to antigens. In the present study, a fusion expression plasmid of CTLA4 and PRRSV GP5 was constructed. PRRSV-specific antibodies, neutralizing antibodies (NAs), cytokines of IFN␥ and IL4, and the lymphocyte proliferation activity were analyzed in mice immunized with the constructed plasmids. Immunization of mice with the CTLA4 targeted plasmid leads to a significant enhancement of humoral and cellular immune responses. Moreover, this effect could be further augmented when the mice were boosted with a killed PRRSV vaccine after DNA vaccine priming. Our data imply that both the APC-target and heterologous prime-boost strategies could be used to improve the immune efficacy of vaccines against PRRSV in pigs in the future. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Porcine reproductive and respiratory syndrome (PRRS) characterized by severe reproductive failure in sows and
∗ Corresponding author at: State Key Laboratory of Agrobiotechnology, Department of Microbiology and Immunology, College of Biological Sciences, China Agricultural University, Beijing 100193, China. Tel.: +86 10 62733335; fax: +86 10 62732012. E-mail address: [email protected] (W.-h. Feng). 0165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2013.05.008
respiratory distress in piglets is an important viral disease of pigs. It was first reported in 1987 in the US (Conzelmann et al., 1993), and then spread all over the world. Most recently, there have been devastating outbreaks of atypical PRRS in China, which is characterized by high fever, high morbidity, and high mortality in pigs of all ages (Goyal, 1993; Li et al., 2007; Tian et al., 2007; Tong et al., 2007; Zhou et al., 2008). However, until now there are no effective vaccines to prevent and control this disease. The causative agent, porcine reproductive and respiratory syndrome virus (PRRSV), is a positive-sense
122
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
single-stranded enveloped RNA virus, which belongs to the family Arteriviridae (Rossow, 1998). The viral genome is approximately 15.4 kb in size and contained 10 openreading frames (ORFs) (Dea et al., 2000; Firth et al., 2011). The ORF5-encoded major envelope glycoprotein (GP5) can induce neutralizing antibodies (Lopez and Osorio, 2004), and contains two T-cell epitopes (Vashisht et al., 2008). Accumulating evidences have shown that GP5 is the leading target for the development of genetic engineering vaccines against PRRSV. Several studies of GP5-based vaccines of PRRSV have been reported, including DNA vaccine co-expressing GP5 and M proteins (Jiang et al., 2006), recombinant adenovirus expressing GP5 by fusion with GP3 and/or GP4 of PRRSV (Jiang et al., 2008), and synthetic GP5 plasmid engineered with the codon usage optimized for mammalian cell expression (Li et al., 2009). Multiple strategies have been exploited to augment the induction of effective immunity following DNA vaccination, for example co-expression of cytokines and antigens of PRRSV, including ubiqutin (Hou et al., 2008), GM-CSF (Wang et al., 2009), and CD40L (Cao et al., 2010). One of the interesting approaches to improve the potency of DNA vaccine is to direct antigens to APCs. Cytotoxic-T-lymphocyte-associated protein 4 (CTLA4) expressed on activated T cells binds to B7-expressing cells, including antigen-presenting cells (APC). Fusion of antigens with CTLA-4 enhanced both humoral and the cellular immune responses to a model DNA vaccine (Boyle et al., 1998). Targeting influenza HA to APCs by fusion antigen with CTLA4 could greatly increase the antibody response, and more importantly, enhance protection from viral challenges (Deliyannis et al., 2000). DNA vaccine encoding CTLA4 and gp120 augmented HIV gp120-specific responses (Nayak et al., 2003). Immunization with plasmid fusion expression CTLA4 and hepatitis B surface antigen also improved both Th1 and Th2 responses (Zhou et al., 2010). Another particularly promising approach is the “primeboost” strategy. Several studies used DNA vaccine prime and recombinant viral vector, purified protein or killed virus boost elicited enhanced immune response compared with the use of only one of the vaccine alone. A polyvalent, multigene DNA prime and protein boost HIV vaccine induced broadly reactive neutralizing antibody and high levels of cellular immune response in human (Wang et al., 2008a). DNA prime-viral vector boost approach was able to elicit immune response against SHIV in a non-human primate model (Amara et al., 2001; Shiver et al., 2002). The humoral and cellular immune responses elicited by Hepatitis B DNA vaccine could be enhanced by protein boost (Xiao-wen et al., 2005). Heterologous HA DNA vaccine prime followed by inactivated flu vaccine boost was more effective in eliciting protective antibody response than the use of DNA or inactive vaccine alone (Wang et al., 2008b). In the current study, we constructed a targeted plasmid encoding PRRSV GP5 fused to the extracellular domain of porcine CTLA4, and evaluated its immunogenicity in BALB/c mice. Also, we used the heterologous prime-boost strategy to investigate whether priming with DNA and boosting with killed PRRSV vaccine could further enhance the immune response.
2. Materials and methods 2.1. Cells and virus Porcine alveolar macrophages (PAMs) which support the growth of PRRSV were obtained by postmortem lung lavage of 8-week-old specific pathogen free (SPF) pigs. PAMs were maintained in RPMI1640 supplemented with 10% fetal bovine serum at 37 ◦ C with 5% CO2 . Peripheral blood was collected from SPF pigs, and peripheral blood mononuclear cells (PBMC) were isolated by FicollPaque (Sigma) density gradient centrifugation following the manufacturer’s procedure. PBMC were cultured in RPMI 1640 supplemented with 10% pig serum plus 25% L929 cell culture supernatant at 37 ◦ C in a humidified 5% CO2 atmosphere. Hela cells were cultured in RPMI 1640 supplemented with 10% FBS. The PRRSV strain HV is a highly pathogenic PRRSV (HP-PRRSV) isolate (GenBank accession no. JX317648). The virus was propagated and titrated in PAMs and then stored at −80 ◦ C.
2.2. Preparation of killed vaccine The PRRSV isolate HV was used for vaccine preparation. The virus was purified by ultracentrifugation as described previously (Vanhee et al., 2009). The purified virus was inactivated by ultraviolet light (UV) at 254 nm for 30 min (Darnell et al., 2004; Dee et al., 2011). Before inoculation, the inactivated virus was emulsified with an equal volume of incomplete Freund’s adjuvant (IFA).
2.3. Construction of plasmids To amplify GP5 gene, total virus RNA was extracted from PRRSV HV isolate using TRIzol following the instruction of the manufacture. RT–PCR was performed to amplify the GP5 gene of PRRSV with the primers (sense: GP5-1, antisense: GP5-2) listed in Table 1. For porcine CTLA4 (pCTLA4), total RNA was isolated from porcine PBMC stimulated for 24 h with concanavalin A (5 g/ml) (Tachedjian et al., 2003). Primer sequences (sense: CTLA4-1, antisense: CTLA4-2) used for the amplification were the same as previously described (Vaughan et al., 2000). The extracellular region of pCTLA4 was PCRamplified using a sequenced clone of pCTLA4 as a template. The sense primer (CTLA4-1) was identical with the fulllength sequence. The antisense primer (CTLA4-3) was based on 11 amino acids immediately adjacent to the transmembrane region, linked to a flexible linker of sequence encoding GlyGlySerGlyGly (GGSGG) and a restriction site for BamH I. All the primers were listed in Table 1. The two fragments of GP5 of PRRSV and extracellular regions of porcine CTLA4 were inserted into pVAX vector, respectively, to generate the recombinant pVAX-5 and pVAX-CTLA4 plasmids. To construct the fusion plasmid, DNA fragment of GP5 was placed down-stream of the extracellular domain of CTLA-4 gene in frame of pVAXCTLA4 and joined by a GGSGG flexible linker, named
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
123
Table 1 Primer sequences for amplification of procine CTLA4 gene and GP5 gene. Name
Sequence (5 → 3 )
Amplified gene
GP5-1
CGGGATCCATGTTGGGGAAATGCTTGACC BamHI GGAATTCCTAGAGACGACCCCATTGTTC EcoRI TTGAAGCTTAGCCATGGCTTGCTCTGGA HindIII TAATGAATTCTCAATTGATGGGAATAAAATAAG EcoRI CGGGATCCACCACCGGAGCCACCATCAGAATCTGGGCATGGTTCTG BamHI L (GGSGG) linker
ORF5 with stop cordon
GP5-2 CTLA4-1 CTLA4-2 CTLA4-3
procine CTLA4 with stop cordon
extracellular domain of procine CTLA4 without stop cordon
Bold italic = Restriction enzyme site; underline = GlyGlySerGlyGly (GGSGG) linker.
pVAX-CTLA4-5. All nucleotide sequences introduced into vectors were verified by DNA sequencing.
mice were sacrificed and splenocytes were harvested for lymphocyte proliferation assay.
2.4. Transfection and indirect immunofluorescence assay (IIFA)
2.7. Indirect ELISA (iELISA)
Hela cells were seeded onto 6-well tissue culture plates, and transfection was performed using TurboFect Transfection Reagent (Thermo Scientific) until the cells reached approximately 70–90% confluence. Forty-eight hours after transfection, the cells were fixed and GP5 expression was detected using the indirect immunofluorescence assay (IFA) with anti-GP5 serum diluted at 1:2000 (made in our lab) as the primary antibody and a fluorescein isothiocyanate (FITC) conjugated goat anti-rabbit IgG (H + L) (1:200; Sigma) as the secondary antibody.
Purified PRRSV antigen was used as iELISA antigen and coated in 96-well plates at the concentration of 10 g/ml. The plates were blocked with 5% skimmed milk in PBST. The sera of mice were diluted at 1:100 in PBST with 2% skimmed milk and added into the plates. After incubation for 2 h at 37 ◦ C, the wells were washed three times, and then reacted with 100 l of a 1:5000 dilution of horseradish peroxidaseconjugated goat-anti-mouse lgG for 1 h at 37 ◦ C. After being washed three times with PBST, the wells were incubated with substrate solution tetramethyl benzidine (TMB) at 37 ◦ C for 15 min, and then were stopped with 2 M H2 SO4 . The OD was read at 450 nm using an ELISA reader.
2.5. Western blot analysis 2.8. Serum neutralization assay For western blot analysis, at 48 h after transfection, the extracts of Hela cells were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS -PAGE) and transferred to polyvinyl difluoride (PVDF) membranes (Millipore). After blocking, the membranes were incubated for 1 h with the anti-GP5 serum diluted at 1:2000, followed by incubation for 1 h at room temperature with goat anti-rabbit IgG (Santa Cruz Biotechnology). The antibodies were visualized by use of the ECL reagent (Millipore) according to the manufacturer’s instructions. 2.6. Inoculation of mice Nine groups of female BALB/c mice (6-week old) were immunized three times at two weeks interval. As shown in Table 2, group 1 was immunized with 100 l sterile PBS (pH 7.4) and group 2 to 4 were intramuscularly injected with 100 l sterile PBS (pH 7.4) containing 100 g different plasmids per mice for three times. Group 5 to 7 were immunized with plasmids at day 0 and day 14, and then boosted subcutaneously at day 28 with 15 g of killed PRRSV vaccine per mice. Group 8 was immunized with killed PRRSV vaccine at 0 and 14 day, and boosted with plasmid of pVAX-CTLA4-5 at day 28. Group 9 was injected with killed PRRSV vaccine for three times. Serum samples were collected before each immunization and before sacrificed for serological tests. At day 7 after the third immunization,
Serum samples were heat inactivated at 56 ◦ C for 30 min prior to performing the serum neutralization assay. Two fold serially diluted sera (50 l) were mixed with an equal volume of 100 TCID50 of the PRRSV HV isolate and incubated for 1 h at 37 ◦ C. Then the mixture was added to PAMs in 96-well tissue culture plates. After 40 h, the culture plate was fixed for 10 min with cold methanol-acetone (1:1). The presence of virus was detected by indirect immunofluorescence assay. Neutralization titers were expressed as the reciprocal of the highest dilution that inhibited 90% of the virus present in the control wells. 2.9. Lymphocyte proliferation assay Mice were sacrificed and single lymphocyte suspensions were prepared from spleens on day 7 after the third immunization. The cells were seeded in 96-well plates at 3 × 105 cells/well in RPMI-1640 plus 10% of fetal bovine serum (FBS) and incubated at 37 ◦ C and 5% CO2 for 48 h, with 500 ng/ml of ionomycin and 50 ng/ml PMA as a positive control, 10 g/ml of the purified PRRSV as specific antigen, 5 g/ml of BSA as irrelevant antigen control, or no antigen as a negative control. T cell proliferation was performed by MTT method according to the previously described protocols (Lillehoj, 1986). Lymphocyte proliferation was expressed as the stimulation index (SI), which
124
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
Table 2 Immunization schedule. Groups
(1)PBS (2)pVAX (3)pVAX-5 (4)pVAX-CTLA4-5 (5)pVAX + KV (6)pVAX-5 +KV (7)pVAX-CTLA4-5 +KV (8)KV + pVAX-CTLA4-5 (9)KV + KV
Candidate vaccines Priming 1st (0d)
Priming2st (14d)
Boosting (28d)
PBS pVAX pVAX-5 pVAX-CTLA4-5 pVAX pVAX-5 pVAX-CTLA4-5 killed virus with IFA killed virus with IFA
PBS pVAX pVAX-5 pVAX-CTLA4-5 pVAX pVAX-5 pVAX-CTLA4-5 killed virus with IFA killed virus with IFA
PBS pVAX pVAX-5 pVAX-CTLA4-5 killed virus with IFA killed virus with IFA killed virus with IFA pVAX-CTLA4-5 killed virus with IFA
The schedule of immunization of BABL/C mice with DNA plasmids and killed virus vaccine in different prime-boost regimens.
was defined as the ratio of the average OD495 value of stimulated wells to that of un-stimulated wells. 2.10. Real-Time PCR Splenocytes (1 × 106 /ml) were cultured in 24-well plates for 18 h at 37 ◦ C in the presence of 5% CO2 , and stimulated with 10 g/ml purified PRRSV. Total RNA was extracted from cells using TRIzol reagent (Invitrogen). Real-time PCR was performed to measure the mRNA expression level of mouse IFN␥ and IL4 following the manufacturer’s instructions of the ABI ViiA7 real-time PCR system. The IFN␥ and IL4 gene expressions were normalized to HPRT and presented as fold induction relative to the control. The specific primers used were the same as described previously (Liu et al., 2005): For IL4: sense: GAATGTACCAGGAGCCATATC; antisense: CTCAGTACTACGAGTAATCCA. For IFN␥: sense: AACGCTACACACTGCATCTTGG; antisense: CAAGACTTCAAAGAGTCTGAGG. For HPRT: sense: GTTGGATACAGGCCAGACTTTGTTG; antisense: GATTCAACTTGCGCTCATCTTAGGC. 2.11. Statistics The difference in the level of humoral and cellular immune responses between different groups was evaluated by Student’s t-test. P-values of <0.05 were considered statistically significant. 3. Results 3.1. Construction and expression of pVAX-GP5 and pVAX-CTLA4-5 Two eukaryotic expression plasmids were constructed as described in Methods (Fig. 1). The pVAX-GP5 plasmid encoded the glycosylated membrane protein of PRRSV GP5. For pVAX-CTLA4-5, the coding region of GP5 was fused to the C-terminal of extracellular domain of porcine CTLA4 with a GGSGG linker. In vitro expressions of pVAX-GP5 and pVAX-CTLA45 were evaluated by western blot analysis and IIFA at 48 h post-transfection. As shown in Fig. 2a, two protein bands of 26 kDa and 40 kDa consistent with the predicted sizes of GP5 and CTLA4-GP5 proteins were clearly
Fig. 1. Schematic diagrams of plasmids used for expression analysis in vitro or directly for DNA immunization. The construction of each plasmid is based on pVAX. pCMV: Human cytomegalovirus immediateearly promoter/enhancer; ORF5: ORF5 gene from the HP-PRRSV HV strain; CTLA4: extracellular domain of porcine CTLA4; L: GlyGlySerGlyGly (GGSGG) linker.
observed in the extracts of cells transfected with pVAX-GP5 or pVAX-CTLA4-5, whereas no specific protein band was found in lysates of cells transfected with the empty vector. Meanwhile, indirect immunofluorescence assay also revealed the presence of expressed proteins in the transfected cells (Fig. 2b). As shown in Fig. 2b, Hela cells transfected with the plasmids of pVAX-GP5 or pVAXCTLA4-5 could be stained with GP5-specific serum, but cells transfected with pVAX could not be stained, proving that the plasmids of pVAX-GP5 and pVAX-CTLA4-5 were well expressed in Hela cells. 3.2. Humoral immune response in mice 3.2.1. Serum PRRSV-specific IgG response Seven days after the third immunization, mouse serum antibodies were detected against PRRSV using the purified PRRSV as antigens. Serological analysis showed that BALB/c mice vaccinated with the fusion expression plasmid of pVAX-CTLA4-5 elicited a higher level of PRRSV-specific antibody compared with mice inoculated with DNA vaccine expressed pVAX or pVAX-GP5. Killed virus vaccine boost significantly increased PRRSV-specific antibodies. Mice in groups of pVAX-5 + KV and pVAX-CTLA4-5 + KV which immunized with pVAX-5 or pVAX-CTLA4-5 priming and killed PRRSV vaccine boosting had higher serum antibody titer than mice immunized with plasmids or killed vaccine alone. The strongest anti-PRRSV antibody response was achieved in KV + KV group which immunized with killed PRRSV vaccine for three times. This indicates that
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
125
Fig. 2. Identification of expression of vaccine constructs in vitro. (a) Western blot analysis of Hela cells transfected with pVAX (lane 1), pVAX-GP5 (lane 2), and pVAX-CTLA4-GP5 (lane 3), respectively. Rabbit anti-GP5 serum was used for western blot. Protein standards are shown on the left side of panel. (b) iIFA analysis of Hela cells transfected with different plasmid using rabbit anti-GP5 serum.
killed vaccine is very efficient in eliciting humoral immune response (Fig. 3). 3.2.2. Anti-PRRSV neutralizing antibody We further evaluated the ability of sera from immunized mice to neutralize HP-PRRSV strain HV in vitro by using serum neutralization assays. As shown in Table 3, mice immunized with the fusion plasmid pVAX-CTLA4-5 developed higher PRRSV-specific mean neutralizing antibody titer (1:24) than mice in group of pVAX-GP5 (1:13.3) at 7 days after the third immunization (P < 0.01). The highest level of neutralizing antibodies (1:64) was observed in the group of pVAX-CTLA4-5 + KV (mean = 1:32) followed by the groups of pVAX-CTLA4-5 (mean = 1:24) and pVAX-GP5 + KV (mean = 1:21.3). In the mice of pVAX + KV group, the level of neutralizing antibodies is very low.
Although the PRRSV-specific antibody titers in the groups of KV + pVAX-CTLA4-5 and KV + KV were extremely high, the levels of neutralizing antibody were low. These results indicated that APC-targeted DNA vaccine pVAX-CTLA4-5 elicited more effective humoral immune responses than pVAX-GP5. Moreover, immunization with the DNA vaccine as priming and killed virus vaccine as boosting was more powerful in generating humoral immune responses compared to the responses induced by the DNA vaccine or killed virus vaccine alone. 3.3. Lymphocyte proliferation response To further investigate the cell-mediated immune response, the lymphocyte-proliferation assay was performed at day 7 after the third immunization. As shown in Fig. 4, all of the groups developed significant enhanced proliferation responses when compared with the control Table 3 Neutralizing antibodies in mice immunized with different prime-boost regimens. Groups
PBS pVAX pVAX-5 pVAX-CTLA4-5 pVAX + KV pVAX-5 + KV pVAX-CTLA4-5 + KV KV + pVAX-CTLA4-5 KV + KV Fig. 3. Humoral immune response in mice. Serum samples were collected at 7 days after the third immunization and antibodies to PRRSV were detected with ELISA using a single dilution (1:100). Data represent the mean ± S.D. for 6 mice.
Candidate vaccines <1:8
1:8
1:16
1:32
1:64
mean
6 6 0 0 2 0 0 3 2
0 0 2 0 4 0 0 1 1
0 0 4 3 0 4 2 2 3
0 0 0 3 0 2 3 0 0
0 0 0 0 0 0 1 0 0
NR NR 13.3 24 NR 21.3 32 NR NR
NR: no result. Serum samples were collected before the mice sacrificed and the PRRSV-specific neutralizing antibodies were determined using a serum-neutralization assay. The results were calculated with the mean of all detectable neutralizing antibodies titers in mice within a group.
126
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
pVAX-CTLA4-5 + KV than that in mice from pVAX, pVAXGP5, or pVAX-CTLA4-5 groups (Fig. 5b). However, there was no difference in the expression level of the IL4 among them. Mice priming with killed vaccine twice and boosting with pVAX-CTLA4-5 plasmid elicited high levels of IL4. The highest level of IL4 was observed in mice from the group of KV + KV which was immunized with killed PRRSV vaccine for three times. These results suggested that DNA vaccine with the fusion expression of CTLA4 and PRRSV GP5 stimulated Th1 responses more efficiently, while killed PRRSV vaccine stimulated Th2 responses more efficiently. And boosting with killed virus vaccine after DNA vaccine priming significantly enhanced both Th1 and Th2 responses. 4. Discussion
Fig. 4. Lymphocyte proliferation response in mice immunized with different vaccines. Seven days after the third immunization, mice were sacrificed and the splenocytes were isolated and stimulated with purified PRRSV antigen (10 g/ml). After 48 h stimulation, MTT was added and the OD values were determined after 4 h incubation. Data were shown as mean ± S.D.
group of mice immunized with pVAX. The stimulation index was significant higher (P = 0.009) in mice immunized with pVAX-CTLA4-5 than in mice immunized with pVAXGP5. Both pVAX-GP5 + KV and pVAX-CTLA4-5 + KV groups elicited significantly higher cell proliferation than groups of pVAX-GP5 and pVAX-CTLA4-5 that were only immunized with DNA vaccines. Mice in the groups of KV+ pVAXCTLA4-5 and KV + KV induced significantly higher levels of lymphocyte-proliferation compared with mice immunized with PBS, but it was substantially lower than mice in the group of pVAX-CTLA4-5 + KV. These results suggested that fusion expression of CTLA4 to GP5 was more efficiently presenting GP5 to APCs to elicit higher antigen-specific T cell response. Moreover, boosting with killed virus after two priming with DNA vaccine significantly enhanced the level of lymphocyte-proliferation. 3.4. Th1-type and Th2-type cytokine responses Quantitative real-time PCR was performed to analyze the mRNA expression levels of Th1 cytokine of IFN␥ and Th2 cytokine of IL4. As shown in Fig. 5a, the expression level of IFN␥ from mice immunized with pVAX-CTLA4-5 was significantly increased, while the production of IFN␥ in the group of pVAX-GP5 was insignificant compared with the control group. Priming with DNA and boosting with the killed PRRSV vaccine remarkably increased the level of IFN␥. Mice in groups of pVAX-GP5 + KV and pVAX-CTLA4-5 + KV had significant higher levels of IFN␥ than the groups of pVAX-GP5 and pVAX-CTLA4-5 which used DNA vaccine alone. Both of the mice in group of KV+ pVAX-CTLA4-5 and KV + KV also elicited high levels of IFN␥. However, the highest level of IFN␥ was produced in the group of pVAX-CTLA4-5 + KV, which was nearly 30 fold of the control group of pVAX. The expression of IL-4 was significantly enhanced after boosting with the killed virus in mice from groups of pVAX + KV, pVAX-GP5 + KV, and
An ideal PRRSV vaccine should be able to generate neutralizing antibodies and induce a high level of cellular immune response. There are two types of commercial vaccines of PRRSV: MLV and killed vaccines. However, both of them have inherent drawbacks. Killed vaccine is weak in immunogenicity and they cannot always provide protective immunity against PRRSV infection (Meng, 2000). The modified live vaccine has a risk of reverting to virulence although they could confer protection against clinical diseases (Meng, 2000; Nielsen et al., 2001). Thus, there is an urgent need to develop more efficacious vaccines against PRRSV. In this report, we used APC-target and heterologous “prime-boost” strategies to enhance the efficacy of vaccines against PRRSV. We designed and constructed CTLA4 and GP5 of PRRSV fusion expression plasmid and evaluated its immunogenicity in mice. The results showed that an enhanced humoral and cellular immune response could be elicited in mice immunized with CTLA4 and PRRSV GP5 fusion expression plasmid compared with DNA plasmid encoding GP5 alone. We demonstrated that the CTLA4 fusion expression plasmid induced increased PRRSV-specific antibodies compared to non-targeted DNA vaccination. Our results are in agreement with a previous report (Tachedjian et al., 2003), who demonstrated that gene gun delivery of DNA vector that expressing a CTLA4ovalbumin (OVA) fusion antigen enhanced OVA-specific humoral immune response. Similarly, vaccination of sheep with a DNA vaccine expressing pro cathepsin B antigen from the Fasciola hepatica fused to CTLA-4 increased the speed and magnitude of the antibody response (Kennedy et al., 2006). VN antibodies is very important for the protective immunity against PRRSV, as it could inhibit PRRSV replication in porcine alveolar macrophages (PAM) by blocking attachment to/and internalization in the cell (Delputte et al., 2004). As shown in Table 3, the mean titer of neutralizing antibody was also increased after vaccination with a DNA vaccine expressing GP5 of PRRSV fused to CTLA4. The APC-target strategy also enhanced the cellular immune response as well as the humoral immune response. There was a significant increase of lymphocyte proliferation activity in the group inoculated CTLA4 fusion expression plasmid. The production of IFN␥ was increased in the group immunized with fusion expression plasmid of pVAX-CTLA4-5, while the level expression of IL4 did not
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
127
Fig. 5. Real-time PCR for cytokine gene expression. Mice splenocytes were collected at 7 days after the last immunization and stimulated with purified PRRSV antigen (10 g/ml). After 18 h of stimulation, total RNA was isolated and IFN␥ and IL4 levels were analyzed using RT-PCR. HPRT mRNA served as an internal reference. (a) The relative expression of Th1-type cytokine of IFN␥ and (b) the relative expression of Th2-type cytokine of IL4.
increase. These results suggested that the Th1-type but not Th2-type immune response might be enhanced when the CTLA4-target strategy was used. Although the mechanism of the CTLA4 as a molecular adjuvant is unclear, there are several possible explanations for the improved efficacy of DNA vaccines. As CTLA4 has high affinity to its B7 ligands on APC, antigen fusion expression to CTLA4 could be targeted to APCs. The increased level of the antigen up-taking and presenting by CTLA4 targeting may improve the efficacy of DNA vaccine (Deliyannis et al., 2000). To further enhance the immune response against PRRSV, we also tried the heterologous prime–boost vaccination regimen. Mice were primed twice with DNA plasmids and boosted with a heterologous vaccine, a killed PRRSV vaccine. From the results we could see that after we boosted the mice with heterologous killed PRRSV vaccine, both the levels of PRRSV-specific antibodies and the neutralizing antibodies were significantly increased. Cellular immune response was analyzed by lymphocyte proliferation response and cytokine assay. After the mice were primed with fusion expression plasmid of pVAX-CTLA45 and boosted with killed PRRSV vaccine, the lymphocyte proliferation activity increased 2-folds and the expression level of IFN␥ increased nearly 6-folds compared with the group immunized with DNA vaccine of pVAX-CTLA45 alone. The production of IL4 was also increased after KV boosting, but there is no difference among groups primed with or without recombinant plasmid vaccine. Mice in groups of KV + pVAX-CTLA4-5 and KV + KV elicited high levels of PRRSV-specific antibody, but it was not efficient to elicit cellular immune response, which is indicated that killed virus vaccine was efficient in eliciting humoral immune response although it may not be efficient in eliciting cellular immune response It is interesting that in groups of KV + pVAX-CTLA4-5 and KV + KV, PRRSV-specific antibody is significantly induced, while the neutralizing antibody level is very low. Although DNA vaccination is an effective way to generate humoral and cell-mediated responses (Shedlock and Weiner, 2000), the immunogenicity of DNA vaccine is low
when used alone. It is believed that DNA vaccine appears to be an excellent priming agent and is less efficient for boosting (Lu, 2009). It might be due to the low level but persistent expression of antigens in vivo. Antigen specific memory T cells were selectively increased and the affinity of T cells to MHC molecules could be higher after multiple exposures to limited amounts of antigens. Thus, in the heterologous “prime-boost” regimen, DNA vaccines have the ability to generate high-affinity T cells, and T cell responses are greatly amplified after the following boosting (Woodland, 2004). Traditional inactivated PRRSV vaccine which contains whole antigen of PRRSV could elicit humoral immune response but is not efficient to elicit T cell response. We used heterologous “prime-boost” vaccination regimen that combined the strengths of DNA vaccine and conventional killed vaccine and effectively elicited cellular and humoral immune responses, suggesting that immunogenicity could be improved when both of the APC-target and heterologous “prime-boost” strategies are used. In summary, we demonstrated that CTLA4 fused with GP5 of PRRSV could enhance GP5 immunogenicity. Furthermore, priming with DNA vaccine and boosting with killed virus vaccine improved the immune response against PRRSV. When we combined the APC-target and heterologous prime-boost strategies, both the humoral and cellular immune responses were significantly enhanced, implying that these two strategies could be used for the generation of new vaccines against PRRSV in pigs. Acknowledgements This work was supported by the Faculty Starting Grant and State Key Laboratory of Agrobiotechnology (Grants 2010SKLAB06-1 and 2012SKLAB01-6), China Agricultural University, China. References Amara, R.R., Villinger, F., Altman, J.D., Lydy, S.L., O’Neil, S.P., Staprans, S.I., Montefiori, D.C., Xu, Y., Herndon, J.G., Wyatt, L.S., Candido, M.A., Kozyr, N.L., Earl, P.L., Smith, J.M., Ma, H.L., Grimm, B.D., Hulsey, M.L., Miller, J., McClure, H.M., McNicholl, J.M., Moss, B., Robinson, H.L., 2001.
128
Y. Wang et al. / Veterinary Immunology and Immunopathology 154 (2013) 121–128
Control of a mucosal challenge and prevention of AIDS by a multiprotein DNA/MVA vaccine. Science 292, 69–74. Boyle, J.S., Brady, J.L., Lew, A.M., 1998. Enhanced responses to a DNA vaccine encoding a fusion antigen that is directed to sites of immune induction. Nature 392, 408–411. Cao, J., Wang, X., Du, Y., Li, Y., Jiang, P., 2010. CD40 ligand expressed in adenovirus can improve the immunogenicity of the GP3 and GP5 of porcine reproductive and respiratory syndrome virus in swine. Vaccine 28, 7514–7522. Conzelmann, K.K., Visser, N., Van Woensel, P., Thiel, H.J., 1993. Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the arterivirus group. Virology 193, 329–339. Darnell, M.E., Subbarao, K., Feinstone, S.M., Taylor, D.R., 2004. Inactivation of the coronavirus that induces severe acute respiratory syndrome, SARS-CoV. J. Virol. Methods 121, 85–91. Dea, S., Gagnon, C.A., Mardassi, H., Pirzadeh, B., Rogan, D., 2000. Current knowledge on the structural proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North American and European isolates. Arch. Virol 145, 659–688. Dee, S., Otake, S., Deen, J., 2011. An evaluation of ultraviolet light (UV254) as a means to inactivate porcine reproductive and respiratory syndrome virus on common farm surfaces and materials. Vet. Microbiol. 150, 96–99. Deliyannis, G., Boyle, J.S., Brady, J.L., Brown, L.E., Lew, A.M., 2000. A fusion DNA vaccine that targets antigen-presenting cells increases protection from viral challenge. Proc. Natl. Acad. Sci. U. S. A. 97, 6676–6680. Delputte, P.L., Meerts, P., Costers, S., Nauwynck, H.J., 2004. Effect of virus-specific antibodies on attachment, internalization and infection of porcine reproductive and respiratory syndrome virus in primary macrophages. Vet. Immunol. Immunopathol. 102, 179–188. Firth, A.E., Zevenhoven-Dobbe, J.C., Wills, N.M., Go, Y.Y., Balasuriya, U.B., Atkins, J.F., Snijder, E.J., Posthuma, C.C., 2011. Discovery of a small arterivirus gene that overlaps the GP5 coding sequence and is important for virus production. J. Gen. Virol. 92, 1097–1106. Goyal, S.M., 1993. Porcine reproductive and respiratory syndrome. J. Vet. Diagn. Invest. 5, 656–664. Hou, Y.H., Chen, J., Tong, G.Z., Tian, Z.J., Zhou, Y.J., Li, G.X., Li, X., Peng, J.M., An, T.Q., Yang, H.C., 2008. A recombinant plasmid co-expressing swine ubiquitin and the GP5 encoding-gene of porcine reproductive and respiratory syndrome virus induces protective immunity in piglets. Vaccine 26, 1438–1449. Jiang, Y., Xiao, S., Fang, L., Yu, X., Song, Y., Niu, C., Chen, H., 2006. DNA vaccines co-expressing GP5 and M proteins of porcine reproductive and respiratory syndrome virus (PRRSV) display enhanced immunogenicity. Vaccine 24, 2869–2879. Jiang, W., Jiang, P., Wang, X., Li, Y., Du, Y., 2008. Enhanced immune responses of mice inoculated recombinant adenoviruses expressing GP5 by fusion with GP3 and/or GP4 of PRRS virus. Virus Res. 136, 50–57. Kennedy, N.J., Spithill, T.W., Tennent, J., Wood, P.R., Piedrafita, D., 2006. DNA vaccines in sheep: CTLA-4 mediated targeting and CpG motifs enhance immunogenicity in a DNA prime/protein boost strategy. Vaccine 24, 970–979. Li, Y., Wang, X., Bo, K., Tang, B., Yang, B., Jiang, W., Jiang, P., 2007. Emergence of a highly pathogenic porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China. Vet. J. 174, 577–584. Li, B., Xiao, S., Wang, Y., Xu, S., Jiang, Y., Chen, H., Fang, L., 2009. Immunogenicity of the highly pathogenic porcine reproductive and respiratory syndrome virus GP5 protein encoded by a synthetic ORF5 gene. Vaccine 27, 1957–1963. Lillehoj, H.S., 1986. Immune response during coccidiosis in SC and FP chickens. I. In vitro assessment of T cell proliferation response to stage-specific parasite antigens. Vet. Immunol. Immunopathol. 13, 321–330. Liu, L., Zhou, X., Liu, H., Xiang, L., Yuan, Z., 2005. CpG motif acts as a ‘danger signal’ and provides a T helper type 1-biased microenvironment for DNA vaccination. Immunology 115, 223–230. Lopez, O.J., Osorio, F.A., 2004. Role of neutralizing antibodies in PRRSV protective immunity. Vet. Immunol. Immunopathol. 102, 155–163. Lu, S., 2009. Heterologous prime-boost vaccination. Curr. Opin. Immunol. 21, 346–351. Meng, X.J., 2000. Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Vet. Microbiol. 74, 309–329.
Nayak, B.P., Sailaja, G., Jabbar, A.M., 2003. Enhancement of gp120-specific immune responses by genetic vaccination with the human immunodeficiency virus type 1 envelope gene fused to the gene coding for soluble CTLA4. J. Virol. 77, 10850–10861. Nielsen, H.S., Oleksiewicz, M.B., Forsberg, R., Stadejek, T., Botner, A., Storgaard, T., 2001. Reversion of a live porcine reproductive and respiratory syndrome virus vaccine investigated by parallel mutations. J. Gen. Virol. 82, 1263–1272. Rossow, K.D., 1998. Porcine reproductive and respiratory syndrome. Vet. Pathol. 35, 1–20. Shedlock, D.J., Weiner, D.B., 2000. DNA vaccination: antigen presentation and the induction of immunity. J. Leukoc. Biol. 68, 793–806. Shiver, J.W., Fu, T.M., Chen, L., Casimiro, D.R., Davies, M.E., Evans, R.K., Zhang, Z.Q., Simon, A.J., Trigona, W.L., Dubey, S.A., Huang, L., Harris, V.A., Long, R.S., Liang, X., Handt, L., Schleif, W.A., Zhu, L., Freed, D.C., Persaud, N.V., Guan, L., Punt, K.S., Tang, A., Chen, M., Wilson, K.A., Collins, K.B., Heidecker, G.J., Fernandez, V.R., Perry, H.C., Joyce, J.G., Grimm, K.M., Cook, J.C., Keller, P.M., Kresock, D.S., Mach, H., Troutman, R.D., Isopi, L.A., Williams, D.M., Xu, Z., Bohannon, K.E., Volkin, D.B., Montefiori, D.C., Miura, A., Krivulka, G.R., Lifton, M.A., Kuroda, M.J., Schmitz, J.E., Letvin, N.L., Caulfield, M.J., Bett, A.J., Youil, R., Kaslow, D.C., Emini, E.A., 2002. Replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity. Nature 415, 331–335. Tachedjian, M., Boyle, J.S., Lew, A.M., Horvatic, B., Scheerlinck, J.P., Tennent, J.M., Andrew, M.E., 2003. Gene gun immunization in a preclinical model is enhanced by B7 targeting. Vaccine 21, 2900–2905. Tian, K., Yu, X., Zhao, T., Feng, Y., Cao, Z., Wang, C., Hu, Y., Chen, X., Hu, D., Tian, X., Liu, D., Zhang, S., Deng, X., Ding, Y., Yang, L., Zhang, Y., Xiao, H., Qiao, M., Wang, B., Hou, L., Wang, X., Yang, X., Kang, L., Sun, M., Jin, P., Wang, S., Kitamura, Y., Yan, J., Gao, G.F., 2007. Emergence of fatal PRRSV variants: unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS One 2, e526. Tong, G.Z., Zhou, Y.J., Hao, X.F., Tian, Z.J., An, T.Q., Qiu, H.J., 2007. Highly pathogenic porcine reproductive and respiratory syndrome, China. Emerg. Infect. Dis. 13, 1434–1436. Vanhee, M., Delputte, P.L., Delrue, I., Geldhof, M.F., Nauwynck, H.J., 2009. Development of an experimental inactivated PRRSV vaccine that induces virus-neutralizing antibodies. Vet. Res. 40, 63. Vashisht, K., Goldberg, T.L., Husmann, R.J., Schnitzlein, W., Zuckermann, F.A., 2008. Identification of immunodominant T-cell epitopes present in glycoprotein 5 of the North American genotype of porcine reproductive and respiratory syndrome virus. Vaccine 26, 4747–4753. Vaughan, A.N., Malde, P., Rogers, N.J., Jackson, I.M., Lechler, R.I., Dorling, A., 2000. Porcine CTLA4-Ig lacks a MYPPPY motif, binds inefficiently to human B7 and specifically suppresses human CD4+ T cell responses costimulated by pig but not human B7. J. Immunol. 165, 3175–3181. Wang, S., Kennedy, J.S., West, K., Montefiori, D.C., Coley, S., Lawrence, J., Shen, S., Green, S., Rothman, A.L., Ennis, F.A., Arthos, J., Pal, R., Markham, P., Lu, S., 2008a. Cross-subtype antibody and cellular immune responses induced by a polyvalent DNA prime-protein boost HIV-1 vaccine in healthy human volunteers. Vaccine 26, 3947–3957. Wang, S., Parker, C., Taaffe, J., Solorzano, A., Garcia-Sastre, A., Lu, S., 2008b. Heterologous HA DNA vaccine prime–inactivated influenza vaccine boost is more effective than using DNA or inactivated vaccine alone in eliciting antibody responses against H1 or H3 serotype influenza viruses. Vaccine 26, 3626–3633. Wang, X., Li, J., Jiang, P., Li, Y., Zeshan, B., Cao, J., 2009. GM-CSF fused with GP3 and GP5 of porcine reproductive and respiratory syndrome virus increased the immune responses and protective efficacy against virulent PRRSV challenge. Virus Res. 143, 24–32. Woodland, D.L., 2004. Jump-starting the immune system: prime-boosting comes of age. Trends Immunol. 25, 98–104. Xiao-wen, H., Shu-han, S., Zhen-lin, H., Jun, L., Lei, J., Feng-juan, Z., Yanan, Z., Ying-jun, G., 2005. Augmented humoral and cellular immune responses of a hepatitis B DNA vaccine encoding HBsAg by protein boosting. Vaccine 23, 1649–1656. Zhou, Y.J., Hao, X.F., Tian, Z.J., Tong, G.Z., Yoo, D., An, T.Q., Zhou, T., Li, G.X., Qiu, H.J., Wei, T.C., Yuan, X.F., 2008. Highly virulent porcine reproductive and respiratory syndrome virus emerged in China. Transbound. Emerg. Dis. 55, 152–164. Zhou, C., Peng, G., Jin, X., Tang, J., Chen, Z., 2010. Vaccination with a fusion DNA vaccine encoding hepatitis B surface antigen fused to the extracellular domain of CTLA4 enhances HBV-specific immune responses in mice: implication of its potential use as a therapeutic vaccine. Clin. Immunol. 137, 190–198.