CTT1 overexpression increases the replicative lifespan of MMS-sensitive Saccharomyces cerevisiae deficient in KSP1

Mechanisms of Ageing and Development 164 (2017) 27–36

Contents lists available at ScienceDirect

Mechanisms of Ageing and Development journal homepage: www.elsevier.com/locate/mechagedev

Original Article

CTT1 overexpression increases the replicative lifespan of MMS-sensitive Saccharomyces cerevisiae deficient in KSP1 Wei Zhao a,b , Hua-Zhen Zheng a,b,1 , Tao Zhou a,b , Xiao-Shan Hong c , Hong-Jing Cui a,b , Zhi-Wen Jiang a,b , Hui-ji Chen a,b , Zhong-Jun Zhou d , Xin-Guang Liu a,b,e,∗ a

Institute of Aging Research, Guangdong Medical University, Dongguan 523808, China Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, Dongguan 523808, China c Institute of Gynecology, Women and Children’s Hospital of Guangdong Province, Guangzhou 511442, China d Department of Biochemistry, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong e Institute of Biochemistry and Molecular Biology, Guangdong Medical University, Dongguan 523808, China b

a r t i c l e

i n f o

Article history: Received 7 October 2016 Received in revised form 6 March 2017 Accepted 22 March 2017 Available online 25 March 2017 Keywords: CTT1 KSP1 MMS Replicative lifespan

a b s t r a c t Ksplp is a nuclear-localized Ser/Thr kinase that is not essential for the vegetative growth of yeast. A global gene function analysis in yeast suggested that Ksplp was involved in the oxidative stress response; however, the underlying mechanism remains unclear. Here, we showed that KSP1-deficient yeast cells exhibit hypersensitivity to the DNA alkylating agent methyl methanesulphonate (MMS), and treatment of the KSP1-deficient strain with MMS could trigger abnormal mitochondrial membrane potential and upregulate reactive oxygen species (ROS) production. In addition, the mRNA expression level of the catalase gene CTT1 (which encodes cytosolic catalase) and total catalase activity were strongly down-regulated in the KSP1-deleted strain compared with those in wild-type cells. Moreover, the KSP1 deficiency also leads to a shortened replicative lifespan, which could be restored by the increased expression of CTT1. On the other hand, KSP1-overexpressed (KSP1OX) yeast cells exhibited increased resistance towards MMS, an effect that was, at least in part, CTT1 independent. Collectively, these findings highlight the involvement of Ksplp in the DNA damage response and implicate Ksplp as a modulator of the replicative lifespan. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Ksplp is a Ser/Thr kinase that is localized in the nucleus and is not essential for the vegetative growth of yeast (Fleischmann et al., 1996). A previous study has suggested that Ksplp participates in the fine-tuning of TORC1 (target of rapamycin complex 1) activity to regulate pseudohyphal growth (PHG) and autophagy (Bharucha et al., 2008; Umekawa and Klionsky, 2012). KSP1 deletion mutants exhibited an increased growth rate under the rapamycin-stressed condition but slightly decreased invasive growth ability under the invasive growth condition (Laxman and Tu, 2011). Overexpression

Abbreviations: DCFH-DA, dichloro-dihydro-fluorescein diacetate; MMS, methyl methanesulphonate; PCR, polymerase chain reaction; PHG, pseudohyphal growth; ROS, reactive oxygen species; RLS, replicative lifespan; TORC1, target of rapamycin complex 1. ∗ Corresponding author at: Institute of Aging Research, Guangdong Medical University, Dongguan 523808, Guangdong Province, China. E-mail address: [email protected] (X.-G. Liu). 1 This author contributed equally to this work and should be considered co-first author. http://dx.doi.org/10.1016/j.mad.2017.03.008 0047-6374/© 2017 Elsevier B.V. All rights reserved.

of KSP1 partially suppresses the temperature-sensitive defect of the prp20-10 yeast mutant, and the protein kinase activity is essential for suppressing the activity of Ksplp (Fleischmann et al., 1996). However, the molecular mechanisms governing these processes are largely uncharacterized. Ksp1p has been identified as an interactor of yeast Nar1p in highthroughput screening (Ptacek et al., 2005). Previously, we have shown that Nar1p plays a role in the oxidative stress response and replicative lifespan modulation (Zhao et al., 2014). A global gene function analysis in yeast has suggested that KSP1 might participate in the oxidative stress response, but its mechanism remains uncertain (Brown et al., 2006). Oxidative stress occurs due to the imbalance between antioxidant systems and various prooxidants (Ayer et al., 2014). The oxidative stress theory of aging suggests that ROS cause oxidative damage to several macromolecules, including DNA (Harman, 1956). A growing body of evidence has indicated that mitochondrial and nuclear DNA damage could trigger genomic instability, which has long been implicated as the main causal factor of aging ˜ et al., 2016). On the (Burhans and Weinberger, 2011; Bautista-Nino other hand, DNA damage could also induce intracellular ROS pro-

28

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

duction (Rowe et al., 2008; Kang et al., 2012), suggesting a complex interaction between DNA damage and ROS. The budding yeast Saccharomyces cerevisiae possesses both enzymatic (such as catalase, superoxide dismutase, and glutathione reductase) and non-enzymatic (such as glutathione, thioredoxin, and glutaredoxin) defence systems to detoxify ROS (Jamieson, 1998). Notably, unlike human cells (which possess only one catalase), budding yeast cells possess two different types of catalase enzymes, catalase A (located in the peroxisome) and catalase T (located in the cytosol), encoded by the CTA1 and CTT1 genes, respectively (Cohen et al., 1988; Hartig and Ruis, 1986). The main physiological role of catalase A is suggested to be to remove H2 O2 produced by fatty acid ␤-oxidation, while catalase T is considered to play a much broader role in the oxidative stress response and aging in yeast (Jamieson, 1998; Martins and English, 2014; Rona et al., 2015). MMS is an alkylating agent that interacts directly with DNA and has been used to study the intracellular DNA-damage response and ROS generation (Salmon et al., 2004; Rowe et al., 2008; Kim et al., 2011). In this study, we found that KSP1-deficiency leads to sensitivity to MMS and a decreased replicative lifespan, and these effects were accompanied by a reduced CTT1 mRNA expression level and altered catalase activities. By contrast, wild-type yeast that overexpress KSP1 exhibit an increased resistance towards the DNA damage agent MMS, an effect that was, at least in part, CTT1 independent. These findings highlight the involvement of Ksplp in the DNA damage response and aging in yeast.

2. Materials and methods 2.1. Yeast strains and culture conditions The wild-type yeast strain used in this paper was the haploid strain BY4742. The ksp1 mutant strain, KSP1 overexpression and CTT1 overexpression strains were derived from BY4742 (listed in Table 1). The ksp1 mutants were generated by polymerase chain reaction (PCR)-mediated gene disruption, and the KSP1 gene was replaced by the selectable marker URA3 (Baudin et al., 1993). First, we used the gene-specific primers(5 -GTTAGTGCAATATTTT TTTCTTACAATTTTTTGA AACTCGAGATTGTACTGAGAGTGCAC-3 ,5 AAGAAAATAATAAGCAACATAACAGAGGGAATAGGTGCGCCTGTGCGGTATTTCACACCG-3 ) and the plasmid pRS306 as the template to amplify the URA3 cassette. Second, the purified PCR products were transformed into the BY4742 strain using the modified LiAc/SS carrier DNA/PEG method. The transformed cells were then plated on SD/-URA (0.67% yeast nitrogen base, 2% glucose, and the appropriate amino acid) selective plates. The grown colonies were further confirmed by PCR. The KSP1 overexpression yeast strain (KSP1OX) was made by integrating an extra KSP1 copy with its endogenous promoter in BY4742; thus, the expression of KSP1 would be driven by its natural promoter (Stearns et al., 1990). First, 535 bp upstream from the KSP1 ORF and 371 bp downstream from the KSP1 ORF sequence (containing the entire coding region of KSP1) were amplified from yeast genomic DNA using the SpeI-tagged primer KSP1-S (5 CGCACTAGTCACGTGACCCGGATATTGTT-3 ) and SalI-tagged primer KSP1-A (5 -CGTGTCGACCGACGTATACTGGTACATGA-3 ). The PCR reaction products were cloned into the pRS303 vector. Integration of KSP1 was accomplished by transforming cells with plasmid pRS303KSP1 digested with EcoRI. Transformants were selected on SD/-HIS (0.67% yeast nitrogen base, 2% glucose, and the appropriate amino acid) agar media (Clontech). The grown colonies were further confirmed by PCR.

To delete the CTT1 gene in the KSP1OX yeast strain, first, a deletion cassette carrying KanMX was obtained by PCR directed on the template plasmid pUG6 using the gene-specific primers 5 -TTGTCTCATGCCAATAAGATCAATCAGCTCAGCTTCACAACAGCTGAAGCTTCGTACGC-3 and 5 -GAGATATAATTACGAATAATTATGAATAAATAGTGCTGCCGCATAGGCCACTAGTGGATCTG-3 . Second, the purified PCR products were transformed into KSP1OX using standard techniques, and then the transformed cells were plated on the SD/-HIS (0.67% yeast nitrogen base, 2% glucose, and the appropriate amino acid) agar media (Clontech) containing the kanamycin derivative G-418 at 200 mg/L. The grown colonies were further confirmed by PCR. YPD medium containing 1% Difco yeast extract, 2% Difco peptone, and 2% dextrose glucose was used for yeast cell culture, the solid YPD plate containing 2% agar. 2.2. Plasmid construction and yeast transformation A high-copy yeast expression vector pAUR123 with a strong promoter, ADH1, was used to ensure overexpression of CTT1 or KSP1. For the construction of plasmid pAUR123CTT1, the CTT1 ORF was amplified from wild-type yeast genomic DNA using PCR and primers containing SalI sites (5 -TATGTCGACATGAACGTGTTCGGTAAAAAA-3 ) and XbaI sites (5 -GC GTCTAGATTAATTGGCACTTGCAATGG-3 ). For the construction of plasmid pAUR123KSP1, the KSP1 ORF was amplified from the wild-type yeast genomic DNA and primers containing SalI sites (5 -CGCGTCGACATGACTTTAGATTACGAGAT-3 ) and HpaI sites (5 -CGCGTT AACTTAGTCTTGTTGCTGTAAAAT-3 ). The PCR reaction products were cloned into the empty pAUR123. The recombinant plasmids were transformed into the E. coli strain DH5␣. DNA sequencing analysis of these plasmids was performed by Sangon (Shanghai, China). The plasmids pAUR123KSP1 and pAUR123CTT1 were introduced into ksp1 or wild-type cells, respectively, as reported previously (Ito et al., 1983). The transformants were screened on YPD medium plates containing 0.2 ␮g/mL Aureobasidin A (AbA) at 30 ◦ C for 2 days. A transformant that introduced pAUR123 was also prepared as a control strain. These overexpression strains were verified by PCR. 2.3. Growth rate determination The growth rates were determined in the cell culture plates using the Bioscreen C machine (Growth Curves USA) (TaukTornisielo et al., 2007; Delaney et al., 2013). First, a single colony was inoculated into YPD medium and was grown overnight at 30 ◦ C with shaking. Next, 2.5 ␮l of the culture was inoculated into 147.5 ␮l of fresh YPD medium or MMS-added YPD medium in culture plates, the plates were constantly shaken at 30 ◦ C for more than 48 h, and finally the optical density (OD) values were recorded at 600nm every 120 min. The experiment was repeated three times, and the averages were used to generate the growth curves. Statistical significance was calculated by the Friedman Test. p < 0.05 was considered to be a significant difference. 2.4. Spot assay The traditional spot assays were used to monitor the resistance of yeast to MMS. Briefly, 5 ml of YPD medium was inoculated with a colony of yeast, followed by culture overnight at 30 ◦ C. Next, the overnight culture was inoculated into 5 ml of fresh YPD and was grown to the exponential phase. Cells were washed once with 1 M sorbitol, and the concentration was adjusted to an OD600 of 0.1. The cells were then diluted with sterile PBS in a 5-fold series, and 5 ␮l of each dilution was spotted onto solid medium with or without

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

29

Table 1 The Saccharomyces cerevisiae strains used in this work. Strain name

Genotype

Comments

Source

BY4742 ksp1 ctt1 KSPOX KSPOXctt1 ksp1pAUR123CTT1 ksp1pAUR123 WTpAUR123 WTpAUR123CTT1

MATa his31 leu20 lys20 ura30 BY4742 ksp1:URA3 BY4742 ctt1:KanMX BY4742 KSP1OX:HIS3 BY4742 KSP1OX:HIS3 ctt1:KanMX BY4742 ksp1:URA3CTT1OX BY4742 ksp1:URA3pAUR123 BY4742 pAUR123 BY4742 CTT1OX

WT Deletion of KSP1 in BY4742 Deletion of CTT1 in BY4742 Overespression KSP1 in BY4742 Deletion of CTT1 in KSP1OX pAUR123CTT1 was transformed into ksp1 Empty vector pAUR123 was transformed into ksp1 Empty vector pAUR123 was transformed into WT pAUR123CTT1 was transformed into WT

Gift from Matt Kaeberlein This study This study This study This study This study This study This study This study

Fig. 1. KSP1-deleted cells are sensitive to MMS. Growth curves for the wild-type and ksp1 strains were measured by the Bioscreen C MBR machine in YPD medium with or without 0.015% MMS (A). p < 0.05 indicated a significant difference. The exponential-phase wild-type and ksp1 cells were 5-fold serially diluted in sterile PBS and then were spotted onto YPD or MMS-added solid YPD plates. The plates were kept at 30 ◦ C until colonies formed (B). pAUR123: empty plasmid, pAUR123KSP1: KSP1 overexpression plasmid.

the stress agent, and growth was allowed for approximately 3 days at 30 ◦ C. 2.5. Replicative lifespan assay The replicative lifespan assay was used to count the total number of daughter cells generated by individual mother cells (Steffen et al., 2009). Briefly, the appropriate number of cells derived from a single colony were patched on the solid YPD plate used for the RLS assay, and then the individual cells were patched along a vertical line on the YPD plate and kept at 30 ◦ C for about 2 h. Next, virgin daughters were selected for RLS analysis. The daughter cells were removed using a fibre-optic needle under the microscope. The total number of daughter cells generated by the mother cells was recorded. Statistical significance was calculated by the Wilcoxon rank-sum test. p < 0.05 was considered to be a significant difference. 2.6. Real-time PCR Exponential-phase cells were incubated with 0.015% MMS at 30 ◦ C for 1 h, and then total RNA was extracted using the Yeast

RNAiso Kit (Takara), followed by reverse transcription using the 1 st Strand cDNA Synthesis Kit (Takara) according to the manufacturer’s instructions. Real-time quantitative PCR was performed using the PCR LightCycler480 and the SYBR GREEN Premix kit (Takara). The mRNA expression level of the target genes was quantified relative to that of the housekeeping gene PRP8. The gene-specific primers for RT-PCR are listed in Table 2. Each experiment was repeated three times. Statistical significance was calculated by Student’s t test. p < 0.05 was considered to be a significant difference. 2.7. Analysis of ROS production and mitochondrial membrane potential The dichloro-dihydro-fluorescein diacetate (DCFH-DA) assay was used to determine and detect the intracellular ROS level as described before (Chen et al., 2003). Briefly, DCFH-DA was deesterified to DCFH and then was further oxidized to fluorescent DCF by intracellular ROS. First, a single yeast colony was inoculated into 5 ml of YPD, and the colony was grown at 30 ◦ C overnight. The culture was then inoculated into 5 ml of fresh YPD medium with or without 0.015% MMS and was incubated for 12 h. Second, the cul-

30

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

Table 2 The real-time PCR primers used in this study. Gene

Primers

Sequence

PRP8

Forward Reverse

TCATGGCTGCGTCTGAAGTA GGCTCAAACCCTTCCGATAG

SOD1

Forward Reverse

AATCCGAGCCAACCACTGTC CGACGCTTCTGCCTACAACG

SOD2

Forward Reverse

GCATTACACCAAGCACCAT CTCGTCCAGACTGCCAAAC

CTT1

Forward Reverse

GATTCCGTTCTACAAGCCAGAC GGAGTATGGACATCCCAAGTTTC

CTA1

Forward Reverse

CCAACAGGACAGACCCATTC TTACCCAAAACGCGGTAGAG

GPX1

Forward Reverse

ATCCATTCCCCTTCAACTCC TCCAGACTTCCCGCTTAC

GPX2

Forward Reverse

AAAAGCCAAAAAGCAGGTTTACT CCAAGGACGATGGTTTTGTT

GPX3

Forward Reverse

TAAAGGGAAAAGTGGTGC TTCATAATGGGGAAAGTCA

GSH1

Forward Reverse

GACACCGATGTGGAAACTGA CCCTTTTTGGCATAGGATTG

GSH2

Forward Reverse

CACAGAGCAGGAAATAGCG TTGGAGCCAGATAATTGAGT

TRX2

Forward Reverse

AAAGTTTGCAGAACAATATTCTGACG TTGGCACCGACGACTCTGGTAACC

YAP1

Forward Reverse

ATGATGTCGTTCCATCTAAGGAAGG CAACCCCTCTTTCTGAACATTTTGC

MSN2

Forward Reverse

CGTCCGTTATTGCGAAAGTG CTGTGGGAAATGGTGATAGA

MSN4

Forward Reverse

AAGGTACTGCCACTACTGAG CATACTATAACCGCTCAGAG

HOG1

Forward Reverse

GCCTTGGCTCATCCTTATTC GTACATCATAACACGCCAGG

HAP1

Forward Reverse

AGACTCGAAATCGGGTGGTA CTTGCATCGGAGCAGAACCT

ZAP1

Forward Reverse

ACAATACGGCTGGAGCAACT TCGTTGTTAGTTAGATCGGC

tured cells were harvested, incubated with 5 ␮M DCFH-DA at 30 ◦ C in the dark for 1 h, and then centrifuged at 3000 rpm for 10 min. Finally, the pellet was washed three times with precooled PBS to remove free reagent, and the mean green fluorescence intensity was determined by flow cytometry (BD FACSCanto II). Fluorescent compound rhodamine 123 was used to measure the mitochondrial membrane potential in intact yeast cells as described previously (Ludovico et al., 2001). Briefly, rhodamine 123 is a cationic dye, which is incorporated specifically into the mitochondria according to the mitochondrial membrane potential. The mitochondrial membrane potential of the yeast was analysed after 30 min of incubation with 10 ␮M rhodamine 123 at 30 ◦ C in the dark. The mean green fluorescence intensity was determined by flow cytometry (BD FACSCanto II). Statistical significance was determined using Student’s t test. p < 0.05 was considered to be a significant difference. 2.8. Enzyme activity assay To determine the intracellular catalase activity and intracellular H2 O2 content, a single yeast colony was inoculated into 5 ml of YPD and was grown to the exponential phase at 30 ◦ C. Next, the yeast cells were harvested immediately and suspended in precooled 50 mM PBS containing protease inhibitor cocktail (Roche). The cells were then broken with glass beads by vigorous shak-

Fig. 2. MMS treatment induces increased ROS levels and mitochondria hyperpolarization in ksp1. Wild-type cells and ksp1 cells were treated with or without 0.15% MMS (only in YPD medium). After 12 h, the cells were stained with DCFH-DA to detect ROS production (A) or with rhodamine123 to measure the mitochondrial membrane potential (B). The mean fluorescence intensity was quantified by flow cytometry, and the results are given as the mean fluorescence value. p < 0.05 was considered to be a significant difference, p < 0.01 was considered to be a highly significant difference.

ing, the supernatant was collected by centrifugation (13,000 rpm, 15 min, 4 ◦ C), and the protein concentration was determined using a commercial Bradford Protein Assay Kit (Sangon Biotech). The catalase activity and hydrogen peroxide content were quantified using separate commercial assay kits (Beyotime Biotechnology). 3. Results 3.1. KSP1-deleted cells are sensitive to MMS MMS is a DNA-alkylating agent that methylates DNA at 7deoxyguanine and 3-deoxyadenine, causing DNA damage that activates the DNA damage response. To investigate the possible mechanisms of KSP1 in the DNA damage response in yeast, we made a ksp1 mutant yeast strain by homologous recombination and tested the effects of MMS-induced DNA damage on the growth of the ksp1 mutant. As shown in Fig. 1A, there was no apparent difference in the growth ability between wild-type cells and mutant cells in liquid YPD medium. However, when the cells were treated with 0.015% MMS, the ksp1 cells grew slower than wild-type cells,

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

31

the ksp1 cells exhibited defective growth compared with wildtype cells (Fig. 1B). In addition, the growth defect of the ksp1 cells upon treatment with MMS can be rescued by complementation of the mutants with the wild-type copy of KSP1, although not quite as well as the wild-type cells. 3.2. Accumulation of ROS and mitochondrial hyperpolarization in ksp1

Fig. 3. KSP1-deficiency decreases the replicative lifespan. The mean lifespans are shown in parentheses, and N is the total number of mother cells used for the RLS assay. Statistical significance was calculated by the Wilcoxon rank-sum test, and p < 0.05 indicated a significant difference.

MMS also could induce the formation of ROS in yeast. To verify whether there is a change in the intracellular ROS level, we further monitored the ROS level using the DCFH-DA method in vivo in wild-type and ksp1 cells. Our data showed that, although the intracellular ROS levels were not obviously changed between the ksp1 and wild-type controls before treatment with MMS, the difference became increasingly larger after cells were stressed with MMS for 12 h (Fig. 2A). Likewise, treatment with 0.015% MMS also resulted in a strong induction of mitochondrial hyperpolarization in ksp1 cells (Fig. 2B). 3.3. KSP1 deficiency decreases the replicative lifespan

indicating that the deletion of KSP1 might lead to down-regulated DNA damage repair ability. The hypersensitivity to MMS of the ksp1 cells was further confirmed by the results of the spot assay,

The enhanced sensitivity of ksp1 cells to MMS indicated the impaired intracellular DNA-damage response or oxidative stress response. Given that the DNA-damage response and oxidative

Fig. 4. ksp1 cells have decreased catalase expression. The relative expression levels of canonical antioxidative genes, including SOD1, SOD2, CTT1, CTA1, GSH1, GSH2, GPX1, GPX2, GPX3, and TRX2 in wild-type and ksp1 strains under the unstressed condition and MMS-stressed condition (A), all data were expressed as the fold-change relative to that of unstressed wild-type cells, which were set to 1. To simplify, a dashed horizontal line crossing YY axis at 1.0 was used to substitute the bars for the wild-type cells (* represents p < 0.05 vs. unstressed wild-type;  represents p < 0.05 vs. MMS-stressed wild-type;  represents p < 0.01 vs. MMS-stressed wild-type). Catalase activity of the wild-type and ksp1 cells before and after treatment with MMS (B). Intracellular H2 O2 levels in ksp1 and wild-type cells before and after treatment with MMS (C). Expression levels of CTT1 transcription factors under the unstressed condition and MMS-stressed condition (D), all data were expressed as the fold-change relative to that of unstressed wild-type cells, which were set to 1. To simplify, a dashed horizontal line crossing YY axis at 1.0 was used to substitute the bars for the wild-type cells (* represents p < 0.05 vs. unstressed wild-type; ** represents p < 0.01 vs. unstressed wild-type;  represents p < 0.01 vs. MMS-stressed wild-type). p < 0.05 was considered to be a significant difference, p < 0.01 was considered to be a highly significant difference.

32

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

Fig. 5. Overexpression of CTT1 restores the RLS of ksp1. Activity of catalase (A) and intracellular H2 O2 levels (B) in wild-type and ksp1pAUR123CTT1 yeast strains. Overexpression of CTT1 restored the replicative lifespan of ksp1 (C). The mean lifespans are shown in parentheses, and N is the total number of mother cells used for the RLS assay. p < 0.05 was considered to be a significant difference, p < 0.01 was considered to be a highly significant difference. pAUR123: empty plasmid, pAUR123CTT1: CTT1 overexpression plasmid.

Fig. 6. Overexpression KSP1 increases the resistance to MMS. The KSP1 mRNA expression level in the KSP1OX strain was analysed by qPCR (A). Growth curves for the wildtype and KSP1OX strains were measured using the Bioscreen C MBR machine in YPD medium with or without 0.015% MMS (B). p < 0.05 indicated a significant difference, p < 0.01 indicated a highly significant difference. The exponential-phase wild-type and KSP1OX cells were 5-fold serially diluted in sterile PBS and were spotted onto YPD or MMS-added solid YPD plates, which were kept at 30 ◦ C until colonies formed (C). Overexpression KSP1 in wild-type yeast does not alter the replicative lifespan (D).

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

33

Fig. 7. CTT1 deletion reduces the MMS resistance of the KSP1 overexpression strain. Growth curves for the wild-type, ctt1, and KSP1OXctt1 strains were measured using the Bioscreen C MBR machine in YPD medium with or without 0.015% MMS (A). p < 0.05 indicated a significant difference. The exponential-phase wild-type, ctt1, and KSP1OXctt1 cells were 5-fold serially diluted with sterile PBS and were spotted onto YPD or MMS-added solid YPD plates, which were kept at 30 ◦ C until colonies formed (B).

stress response play important roles in the senescence process in yeast, we investigated the replicative lifespan of the ksp1 cells on the YPD plate. Our results showed that the mean replicative lifespan of the KSP1 mutants (19, N = 100) decreased approximately 21% compared with that of wild-type cells (24, N = 120) (p < 0.05) (Fig. 3).

3.4. KSP1-deleted cells have decreased catalase expression Given that the KSP1-deleted cells exhibited the accumulation of intracellular ROS when treated with MMS, we analysed the expression of several canonical antioxidative enzymes in the ksp1 cells by qPCR under unstressed condition and the MMS-stressed condition (Fig. 4A), such as superoxide dismutases (SOD1, SOD2), cytosolic catalase T (CTT1), peroxisomal/mitochondrial catalase A (CTA1), glutathione biosynthesis enzymes (GSH1, GSH2), glutathione peroxidases (GPX1, GPX2 and GPX3), and thioredoxin 2 (TRX2). We found that most of the investigated genes were upregulated in both ksp1 and wild-type cells after treatment with MMS, and it might be the adaptive response of the yeast to oxidative stress induced by MMS. In addition, we noted that some of the investigated genes were up-regulated in ksp1 cells compared with that in wild-type cells under both unstressed and MMSstressed conditions; only CTT1 was down-regulated.

We next quantified the catalase activity and intracellular H2 O2 content in the ksp1 cells and wild-type cells. As expected, the catalase activity was reduced (Fig. 4B), and accordingly, the intracellular H2 O2 level was increased in ksp1 cells under the unstressed and MMS-stressed conditions compared with that in the wild-type cells (Fig. 4C). The altered gene expression profile and elevated intracellular H2 O2 levels indicate oxidative stress in ksp1 cells. It has been reported that CTT1 could be induced by H2 O2 in wildtype cells (Marchler et al., 1993), as the positive control, we treated wild-type cells with 3 mM H2 O2 for one hour, was therefore used. The results showed that the CTT1 mRNA level and total catalase activity were significantly increased in wild-type cells after treatment with H2 O2 . However, the CTT1 mRNA level and total catalase activity were slightly increased in ksp1 cells after treatment with H2 O2 (the difference was not significant, p > 0.05) (Fig. S1). The transcriptional response of CTT1 is mediated by multiple transcription factors such as Msn2p/Msn4p, Hog1p, Hap1p, Yap1p, and Zap1p. Thus, we examined the expression pattern of these transcription factors by qPCR under unstressed condition and the MMS-stressed condition (Fig. 4D). The results revealed that, under the unstressed condition, the expression of YAP1 was up-regulated while that of ZAP1, HAP1 and MSN4 were down-regulated in ksp1 cells compared with that in wild-type. After treatment with MMS

34

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

for one hour, the transcript levels of these regulators were found to not be altered in MMS-stressed ksp1 cells compared with that in MMS-stressed wild-type, except MSN4. 3.5. Overexpression of CTT1 restores the RLS of the ksp1 strain It has been reported that catalase inactivation could shorten the RLS of budding yeast (Van Zandycke et al., 2002). To find out whether the shortened replicative lifespan of the ksp1 mutant cells correlated with a change in expression of catalase, first, we transformed yeast cells with a high-copy-number vector pAUR123 harbouring the cloned CTT1. In this case, the catalase activity was drastically increased in the transformants (Fig. 5A), and the intracellular H2 O2 level was significantly decreased in the ksp1 pAUR123CTT1 yeast strain (Fig. 5B). Next, we analysed the RLS of the ksp1pAURCTT1 yeast strain. Surprisingly, the mean RLS of catalase-overexpressed ksp1 cells was comparable to that of the wild-type cells. As shown in Fig. 5C, overexpression of CTT1 in ksp1 cells increased the ksp1 RLS by approximately 32% (25, N = 160) (p < 0.05). 3.6. Overexpression of KSP1 increases the resistance to MMS We next looked at the effect of KSP1 overexpression on the yeast resistance to MMS. First, we made the KSP1 overexpression (KSP1OX) strain by homologous recombination. In this way, the expression of KSP1 would be driven by its natural promoter. qPCR showed that the KSP1 mRNA expression level in the KSP1OX strain was about three-fold higher relative to that of the wild-type strain (Fig. 6A). Both the growth curve analysis (Fig. 6B) and spot assay (Fig. 6C) showed that there was no apparent difference in the growth ability between wild-type and KSP1OX cells in liquid YPD medium; however, when treated with 0.015% MMS, the KSP1OX cells grew faster than the wild-type cells, indicating that the overexpression of KSP1 might lead to up-regulated DNA damage repair ability when treated with MMS. Given that the ksp1 cells exhibited decreased RLS, we next analysed the RLS of the KSP1OX cells, and the data showed that there was no significant difference between the wild-type and KSP1OX cells (Fig. 6D). 3.7. CTT1 deletion reduces the MMS resistance of the KSP1 overexpression strain To investigate whether CTT1 played a role in the tolerance of KSP1OX cells to MMS, we generated the KSP1OXctt1 strain in which the CTT1 gene was deleted by homologous recombination. Very surprisingly, the KSP1OXctt1 strain exhibited similar MMS resistance as that of the wild-type cells (Fig. 7A, B), while the KSP1OX strain displayed enhanced resistance to MMS compared with that of wild-type cells (Fig. 6B, C). 4. Discussion Although it has been suggested that KSP1 is involved in the oxidative stress response in yeast, the potential mechanisms have not been reported yet. In this paper, we demonstrate that KSP1 deletion results in hypersensitivity to the DNA damage reagent MMS and shortened the replicative lifespan in yeast. Furthermore, the shortened replicative lifespan associated with KSP1 deficiency can be rescued by CTT1 overexpression. MMS is a widely used DNA damage reagent that directly damages DNA and triggers the formation of ROS (Friedberg et al., 1995). A previous study showed that mtDNA is a preferred target for MMS-induced DNA damage (Pirsel and Bohr, 1993), which can lead

to abnormal mitochondrial function, such as mitochondria hyperpolarization (Kitanovic et al., 2009). Our data showed that MMS treatment resulted in the strong induction of intracellular ROS production and mitochondrial hyperpolarization in the KSP1 deletion mutant, implying a defect in the ROS scavenging system and DNA repair response. Budding yeast possess a complex defence system to protect cells against ROS and DNA damage. We showed that the catalase gene CTT1 mRNA expression level and total catalase activity were strongly down-regulated in the ksp1 strain. Accordingly, the intracellular H2 O2 level was increased in ksp1 compared with that in wild-type cells. Saccharomyces cerevisiae has two catalases to breakdown H2 O2 : peroxisomal/mitochondrial catalase A, Cta1p, and cytosolic catalase T, Ctt1p. Ctt1p is considered to be a more general antioxidant involved in the oxidative stress response in yeast (Godon et al., 1998; Jamieson, 1998). CTT1 expression could be induced by many stresses, such as oxidative, calorie restriction and heat stress (Bissinger et al., 1989; Wieser et al., 1991; Ruis and Hamilton, 1992; Marchler et al., 1993). Previous studies have reported that the transcription of CTT1 is governed by various transcription factors such as Msn2p/Msn4p, Hog1p, Hap1p, Yap1p, and Zap1p (Winkler et al., 1988; Schuller et al., 1994; Martinez-Pastoret al. 1996; Lee et al., 1999; Wu et al., 2008). Our qPCR results revealed that ZAP1, HAP1 and MSN4 were down-regulated in ksp1 cells under the unstressed condition; however, in cells treated with MMS, there was only a single downregulated transcription factor, MSN4, in ksp1 cells. It is possible that the decreased CTT1 expression may be associated with altered levels of transcription factors in ksp1 cells, although we do not know why these transcription factors were differentially expressed in ksp1 cells. Considering that Ksplp is a nuclear-localized Ser/Thr kinase, another potential cause of the decreased CTT1 mRNA level in ksp1 cells could be that KSP1 deficiency might influence the phosphorylation of its substrate, a certain transcription factor, which affected the expression of CTT1. Although previous protein microarrays have identified approximately 187 putative substrates for Ksp1p, no confirmed targets involved in the transcription of CTT1 have been reported presently (Bharucha et al., 2008). Catalase activity was also suggested to play a role in the longevity of Drosophila melanogaster, Caenorhabditis elegans and Saccharomyces cerevisiae (Orr and Sohal, 1994; Taub et al., 1999; Van Zandycke et al., 2002). Both the mean lifespan and maximum lifespan were decreased in ctt1 cells when grown on glucose media. Thus, we further examined the replicative lifespan of ksp1 on rich YPD medium (2% glucose), and ksp1 exhibited a significant reduction in mean lifespan compared with that of the wild type. Based on the free radical theory of aging (Harman, 1956; Ayer et al., 2014; Ludovico and Burhans, 2014), one possible reason for the shortened lifespan in ksp1 might be the decreased expression of antioxidant proteins and excess hydrogen peroxide, which would result in altered cell redox homeostasis and oxidative stress, causing a decreased replicative lifespan. Prior studies have shown that CTT1 overexpression could increase the chronological life span of calorie-restricted Saccharomyces cerevisiae deficient in Sod1p (Rona et al., 2015). Given that CTT1 plays an important role in longevity and the oxidative stress response in yeast, we wondered whether overexpression of CTT1 could restore the replicative lifespan of ksp1. As expected, overexpression of CTT1 effectively rescued the shortened replicative lifespan observed in ksp1. To further explore the role of KSP1 in oxidative stress and the DNA damage response, a KSP1 overexpression strain (KSP1OX) was created by homologous recombination. Remarkably, overexpression of KSP1 enhanced MMS tolerance compared with that of wild-type cells but did not impact the RLS.

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

Considering the potential relationship between KSP1 and CTT1, we next asked whether the observed increased resistance towards MMS upon overexpression of KSP1 depended on CCT1. To this end, we deleted the CTT1 gene in the KSP1OX strain genome, and surprisingly, the KSP1OXctt1 strain exhibited similar MMS resistance as that of wild-type cells, so we speculated that the KSP1overexpression-increased MMS resistance of wild-type cells might occur in a CTT1-dependent manner. However, because CTT1 deletion by itself (ctt1) is sensitive to MMS (Fig. 7A, B), it might be that CTT1 deletion reduces the MMS resistance of KSP1OX in an independent way. Furthermore, as KSP1OX increases the resistance of ctt1 (the KSP1OXctt1 strain exhibited similar MMS resistance as that of wild-type cells), these observations support that CCT1 is not required for KSP1 overexpression to increase resistance towards MMS and is, at least in part, CTT1 independent. In conclusion, we first demonstrated that the loss of Ksp1p results in reduced tolerance to the DNA damage reagent MMS, as well as in a shortened replicative lifespan that could be restored by CTT1 overexpression. Meanwhile, overexpressed KSP1 in wildtype yeast could enhance MMS tolerance compared with wild-type cells, an effect that was, at least in part, CTT1 independent. These results suggested a possible relationship between KSP1 and CTT1, although no definitive mechanism has been elucidated. It will be informative for future research to explore the role of KSP1 in the DNA damage response and aging.

Acknowledgements This work was supported by the China National Natural Science Foundation (31101051, 81671399), the Ordinary University Innovation Team Construction Project of Guangdong Province (2015KCXTD022), the Unique Innovative Projects in Ordinary University of Guangdong Province (2015KTSCX049), Dongguan International Science & Technology Cooperation (including Hong Kong, Macao and Taiwan) Project (201650812001), the Science & Technology Innovation Fund of Guangdong Medical University (STIF201102). We are grateful to Brian K. Kennedy (Buck Institute), Matt Kaeberlein and Brian M. Wasko (University of Washington) for technical assistance.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.mad.2017.03. 008.

References Ayer, A., Gourlay, C.W., Dawes, I.W., 2014. Cellular redox homeostasis: reactive oxygen species and replicative ageing in Saccharomyces cerevisiae. FEMS Yeast Res. 14, 60–72. Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F., Cullin, C., 1993. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 21, 3329–3330. ˜ P.K., Portilla-Fernandez, E., Vaughan, D.E., Danser, A.H., Roks, A.J., Bautista-Nino, 2016. DNA damage: a main determinant of vascular aging. Int. J. Mol. Sci. 17. Bharucha, N., Ma, J., Dobry, C.J., Lawson, S.K., Yang, Z., Kumar, A., 2008. Analysis of the yeast kinome reveals a network of regulated protein localization during filamentous growth. Mol. Biol. Cell 19, 2708–2717. Bissinger, P.H., Wieser, R., Hamilton, B., Ruis, H., 1989. Control of Saccharomyces cerevisiae catalase T gene (CTT1) expression by nutrient supply via the RAS-cyclic AMP pathway. Mol. Cell. Biol. 9, 1309–1315. Brown, J.A., Sherlock, G., Myers, C.L., 2006. Global analysis of gene function in yeast by quantitative phenotypic profiling. Mol. Syst. Biol. 2, 0001. Burhans, W.C., Weinberger, M., 2011. DNA damage and DNA replication stress in yeast models of aging. Subcell. Biochem. 57, 187–206. Chen, S.R., Dunigan, D.D., Dickman, M.B., 2003. Bcl-2 family members inhibit oxidative stress-induced programmed cell death in Saccharomyces cerevisiae. Free Rad. Biol. Med. 34, 1315–1325.

35

Cohen, G., Rapatz, W., Ruis, H., 1988. Sequence of the Saccharomyces cerevisiae CTA1 gene and amino acid sequence of catalase A derived from it. Eur. J. Biochem. 176, 159–163. Delaney, J.R., Ahmed, U., Chou, A., Sim, S., Carr, D., Murakami, C.J., Schleit, J., Sutphin, G.L., An, E.H., Castanza, A., Fletcher, M., Higgins, S., Jelic, M., Klum, S., Muller, B., Peng, Z.J., Rai, D., Ros, V., Singh, M., Wende, H.V., Kennedy, B.K., Kaeberlein, M., 2013. Stress profiling of longevity mutants identifies Afg3 as a mitochondrial determinant of cytoplasmic mRNA translation and aging. Aging Cell 12, 156–166. Fleischmann, M., Stagljar, I., Aebi, M., 1996. Allele-specific suppression of a Saccharomyces cerevisiae prp20 mutation by overexpression of a nuclear serine/threonine protein kinase. Mol. Gen. Genet. 250, 614–625. Friedberg, E.C., Walker, G., Siede, W., 1995. DNA Repair and Mutagenesis, 12. ASM Press, pp. 79. Godon, C., Lagniel, G., Lee, J., Buhler, J.M., Kieffer, S., Perrot, M., Boucherie, H., Toledano, M.B., Labarre, J., 1998. The H2 O2 stimulon in Saccharomyces cerevisiae. J. Biol. Chem. 273, 22480–22489. Harman, D., 1956. Aging: a theory based on free radical and radiation chemistry. J. Gerontol. 11, 298–300. Hartig, A., Ruis, H., 1986. Nucleotide sequence of the Saccharomyces cerevisiae CTT1 gene and deduced amino-acid sequence of yeast catalase T. Eur. J. Biochem. 160, 487–490. Ito, H., Fukuda, Y., Murata, K., Kimura, A., 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153, 163–168. Jamieson, D.J., 1998. Oxidative stress responses of the yeast Saccharomyces cerevisiae. Yeast 14, 1511–1527. Kang, M.A., So, E.Y., Simons, A.L., Spitz, D.R., Ouchi, T., 2012. DNA damage induces reactive oxygen species generation through the H2AX-Nox1/Rac1 pathway. Cell. Death. Dis. 3, e249. Kim, D.R., Gidvani, R.D., Ingalls, B.P., Duncker, B.P., McConkey, B.J., 2011. Differential chromatin proteomics of the MMS-induced DNA damage response in yeast. Proteome Sci. 9, 62. Kitanovic, A., Walther, T., Loret, M.O., Holzwarth, J., Kitanovic, I., Bonowski, F., Van Bui, N., Francois, J.M., Wolfl, S., 2009. Metabolic response to MMS-mediated DNA damage in Saccharomyces cerevisiae is dependent on the glucose concentration in the medium. FEMS Yeast Res. 9, 535–551. Laxman, S., Tu, B.P., 2011. Multiple TORC1-associated proteins regulate nitrogen starvation-dependent cellular differentiation in Saccharomyces cerevisiae. PLoS One 6, e26081. Lee, J., Godon, C., Lagniel, G., Spector, D., Garin, J., Labarre, J., Toledano, M.B., 1999. Yap1 and Skn7 control two specialized oxidative stress response regulons in yeast. J. Biol. Chem. 274, 16040–16046. Ludovico, P., Burhans, W.C., 2014. Reactive oxygen species, ageing and the hormesis police. FEMS Yeast Res. 14, 33–39. Ludovico, P., Sansonetty, F., Corte-Real, M., 2001. Assessment of mitochondrial membrane potential in yeast cell populations by flow cytometry. Microbiology 147, 3335–3343. Marchler, G., Schuller, C., Adam, G., Ruis, H., 1993. A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions. EMBO J. 12, 1997–2003. Martinez-Pastor, M.T., Marchler, G., Schuller, C., Marchler-Bauer, A., Ruis, H., Estruch, F., 1996. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). EMBO J. 15, 2227–2235. Martins, D., English, A.M., 2014. Catalase activity is stimulated by H2 O2 in rich culture medium and is required for H2 O2 resistance and adaptation in yeast. Redox Biol. 2, 308–313. Orr, W.C., Sohal, R.S., 1994. Extension of life-span by overexpression of superoxide dismutase and catalase in Drosophila melanogaster. Science 263, 1128–1130. Pirsel, M., Bohr, V.A., 1993. Methyl methanesulfonate adduct formation and repair in the DHFR gene and in mitochondrial DNA in hamster cells. Carcinogenesis 14, 2105–2108. Ptacek, J., Devgan, G., Michaud, G., Zhu, H., Zhu, X., Fasolo, J., Guo, H., Jona, G., Breitkreutz, A., Sopko, R., McCartney, R.R., Schmidt, M.C., Rachidi, N., Lee, S.J., Mah, A.S., Meng, L., Stark, M.J., Stern, D.F., De Virgilio, C., Tyers, M., Andrews, B., Gerstein, M., Schweitzer, B., Predki, P.F., Snyder, M., 2005. Global analysis of protein phosphorylation in yeast. Nature 438, 679–684. Rona, G., Herdeiro, R., Mathias, C.J., Torres, F.A., Pereira, M.D., Eleutherio, E., 2015. CTT1 overexpression increases life span of calorie-restricted Saccharomyces cerevisiae deficient in Sod1. Biogerontology 16, 343–351. Rowe, L.A., Degtyareva, N., Doetsch, P.W., 2008. DNA damage-induced reactive oxygen species (ROS) stress response in Saccharomyces cerevisiae. Free Radic. Biol. Med. 45, 1167–1177. Ruis, H., Hamilton, B., 1992. Regulation of yeast catalase genes. In molecular biology of free radical scavenging systems. Eur. J. Biochem. 160, 487–490. Salmon, T.B., Evert, B.A., Song, B., Doetsch, P.W., 2004. Biological consequences of oxidative stress-induced DNA damage in Saccharomyces cerevisiae. Nucleic Acids Res. 32, 3712–3723. Schuller, C., Brewster, J.L., Alexander, M.R., Gustin, M.C., Ruis, H., 1994. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene. EMBO J. 13, 4382–4389. Stearns, T., Ma, H., Botstein, D., 1990. Manipulating yeast genome using plasmid vectors. Methods Enzymol. 185, 280–297. Steffen, K.K., Kennedy, B.K., Kaeberlein, M., 2009. Measuring replicative life span in the budding yeast. J. Vis. Exp. 28, 1209.

36

W. Zhao et al. / Mechanisms of Ageing and Development 164 (2017) 27–36

Taub, J., Lau, J.F., Ma, C., Hahn, J.H., Hoque, R., Rothblatt, J., Chalfie, M., 1999. A cytosolic catalase is needed to extend adult lifespan in C elegans daf-C and clk-1 mutants. Nature 399, 162–166. Tauk-Tornisielo, S.M., Vieira, J.M., Govone, J.S., 2007. Use of Bioscreen C for growth of Mucor hiemalis in different carbon and nitrogen sources. Braz. J. Microbiol. 38, 113–117. Umekawa, M., Klionsky, D.J., 2012. Ksp1 kinase regulates autophagy via the target of rapamycin complex 1 (TORC1) pathway. J. Biol. Chem. 287, 16300–16310. Van Zandycke, S.M., Sohier, P.J., Smart, K.A., 2002. The impact of catalase expression on the replicative lifespan of Saccharomyces cerevisiae. Mech. Ageing Dev. 123, 365–373. Wieser, R., Adam, G., Wagner, A., Schuller, C., Marchler, G., Ruis, H., Krawiec, Z., Bilinski, T., 1991. Heat shock factor-independent heat control of transcription of the CTT1 gene encoding the cytosolic catalase T of Saccharomyces cerevisiae. J. Biol. Chem. 266, 12406–12411.

Winkler, H., Adam, G., Mattes, E., Schanz, M., Hartig, A., Ruis, H., 1988. Co-ordinate control of synthesis of mitochondrial and non-mitochondrial hemoproteins: a binding site for the HAP1 (CYP1) protein in the UAS region of the yeast catalase T gene (CTT1). EMBO J. 7, 1799–1804. Wu, C.Y., Bird, A.J., Chung, L.M., Newton, M.A., Winge, D.R., Eide, D.J., 2008. Differential control of Zap1-regulated genes in response to zinc deficiency in Saccharomyces cerevisiae. BMC Genom. 9, 370. Zhao, W., Fang, B.X., Niu, Y.J., Liu, Y.N., Liu, B., Peng, Q., Li, J.B., Wasko, B.M., Delaney, J.R., Kennedy, B.K., Suh, Y., Zhou, Z.J., Kaeberlein, M., Liu, X.G., 2014. Nar1 deficiency results in shortened lifespan and sensitivity to paraquat that is rescued by increased expression of mitochondrial superoxide dismutase. Mech. Ageing Dev. 138, 53–58.