- Email: [email protected]
2 signaling pathway
Accepted Manuscript Title: Cucurbitacin-I induces hypertrophy in H9c2 cardiomyoblasts through activation of autophagy via MEK/ERK1/2 signaling pathway Author: Yao Wu Hongying Chen Ruli Li Xiaoxiao Wang He Li Juanjuan Xin Zhiqiang Liu Sisi Wu Wei Jiang Ling Zhu PII: DOI: Reference:
S0378-4274(16)33296-9 http://dx.doi.org/doi:10.1016/j.toxlet.2016.11.003 TOXLET 9632
To appear in:
Toxicology Letters
Received date: Revised date: Accepted date:
15-9-2016 3-11-2016 6-11-2016
Please cite this article as: Wu, Yao, Chen, Hongying, Li, Ruli, Wang, Xiaoxiao, Li, He, Xin, Juanjuan, Liu, Zhiqiang, Wu, Sisi, Jiang, Wei, Zhu, Ling, Cucurbitacin-I induces hypertrophy in H9c2 cardiomyoblasts through activation of autophagy via MEK/ERK1/2 signaling pathway.Toxicology Letters http://dx.doi.org/10.1016/j.toxlet.2016.11.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Cucurbitacin-I induces hypertrophy in H9c2 cardiomyoblasts through activation of autophagy via MEK/ERK1/2 signaling pathway Yao Wua,b, Hongying Chenb, Ruli Lib, XiaoxiaoWangb, He Lia, Juanjuan Xinb, Zhiqiang Liub, Sisi Wub, Wei Jiang1b, Ling Zhu2a a
School of Preclinical and Forensic Medicine, Sichuan University, Chengdu 610041, P.R. China;
b
Molecular Medicine Research Center, State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu 610041, Sichuan, P.R. China.
1
Corresponding author: Wei Jiang, PhD, MD. Professor. E-mail address:
[email protected] 2
Corresponding author: Ling Zhu, PhD, MD. Professor. Tel.: 86-28-85501278; FAX.
+86-28-85503204; E-mail address: [email protected].
Graphical abstract
Highlights
1. Cucurbitacin-I, a triterpenoids, has diverse pharmacological and biological activities. 2. Cucurbitacin-I induced cardiotoxicity (hypertrophy and death) in H9c2 cells. 3. Cucurbitacin-I induced strong autophagy, hypertrophy and apoptosis in H9c2 cells. 4. Cucurbitacin-I induced cardiotoxicity via an ERK-autophagy dependent pathway.
Abstract Cucurbitacin-I, a natural triterpenoids initially identified in medicinal plants, shows a potent anticancer effect on a variety of cancer cell types. Nevertheless, the cardiotoxicity of cucurbitacin-I has not heretofore been reported. In this study, the mechanisms of cucurbitacin-I-induced cardiotoxicity were examined by investigating the role of MAPK-autophagy-dependent pathways. After being treated with 0.1-0.3μM cucurbitacin-I for 48 h, H9c2 cells showed a gradual decrease in the cell viabilities, a gradual increase in cell size, and mRNA expression of ANP and BNP (cardiac hypertrophic markers). Cucurbitacin-I concentration-dependent apoptosis of H9c2 cells were also observed. The increased apoptosis of H9c2 cells were paralleling with the gradually strong autophagy levels. Furthermore, an autophagy inhibitor, 3-MA, was used to block the cucurbitacin-I-stirred autophagy, and then the hypertrophy and apoptosis induced by 0.3μM cucurbitacin-I were significantly attenuated. In addition, cucurbitacin-I exposure also activated the MAPK signaling pathways, including ERK1/2, JNK, and p38 kinases. Interestingly, only the ERK inhibitor U0126, but not the JNK inhibitor SP600125 and p38 MAPK inhibitor SB203580, weakened the induction of 0.3μM cucurbitacin-I in hypertrophy, autophagy and apoptosis. Our findings suggest that cucurbitacin-I can increase the
autophagy levels of H9c2 cells, most likely, through the activation of an ERK-autophagy dependent pathway, which results in the hypertrophy and apoptosis of cardiomyocytes.
Abbreviations MAPKmitogen-activated protein kinase ANP atrial natriuretic peptide BNP brain natriuretic peptide 3-MA 3-methyladenine DMSO Dimethyl sulfoxide WGA wheat germ agglutinin
Keywords Cucurbitacin-I, cardiomyocyte hypertrophy, MEK/ERK1/2, autophagy, U0126
1. Introduction Cancer remains an important public health concern in the world (Ramaswami R et al., 2013). Although surgical resection and radiation remain the most common strategy for cancer therapy, anticancer agents are equally important for its convenient and efficient when used alone or in combination with surgery or radiotherapy (Huitink JM and Teoh WH, 2013; Saijo N et al., 2003). Therefore, developing new effective anticancer drugs is still an important strategy in tumor therapy (Saijo N et al., 2003). However, cardiotoxicity, a common complication of many anti-cancer agents, remains a major limitation and potential risk of cardiac dysfunction, strongly impacting the quality of life and the overall survival (Saijo N et al., 2003; Double J et al., 2002; Curigliano G et al., 2012). Cardiotoxicity may occur during or shortly after treatment (within days or weeks), or it may become evident a long period after completion of anticancer therapy (Curigliano G et al., 2012).A variety
of
antitumor
drugs
including
anthracyclines,
antimetabolites,
cyclophosphamide and newer targeted agents have been eventually confirmed to cause cardiomyopathy (Curigliano G et al., 2012; Stortecky S and Suter TM, 2010). Strategies to prevent or mitigate cardiac damage from anticancer drugs are needed to provide the best cancer care (Saijo N et al., 2003; Double J et al., 2002; Stortecky S and Suter TM, 2010). Cucurbitacin-I, a natural triterpenoid (Fig. 1) purified from the fruit extract of cucurbitaceae family plants, such as cucumber, has been used in traditional medicine for its antipyretic, analgesic, anti-inflammatory and antimicrobial actions (Lee DH et al., 2010). Recently, accompanied by discoveries showing that cucurbitacins are the strong signal transducers and activators of transcription-3 (STAT3) inhibitors, the antitumor effect of cucurbitacins has received more and more attention (Lee DH et al., 2010; Alghasham AA, 2013). As one of the 12 categories of cucurbitacins, cucurbitacin-I has a potent anticancer effect on several types of cancer cells, including breast cancer, lung cancer, and glioma, which is comparable to cucurbitacin-B and –D, both of them suppress the proliferation of a variety of cancer cells in vitro and in vivo
(Lee DH et al., 2010; Alghasham AA, 2013; Chen X et al., 2012). Cucurbitacins-induced toxicities in patients present with symptoms including diarrhea, ematemesis, hypotension and gastrointestinal mucosal injury (Ho CH et al., 2013), while it is still not clear whether cucurbitacins induce cardiac toxicity, which is a common side effect of other anticancer agents (Alghasham AA, 2013; Chen X et al., 2012; Ho CH et al., 2013). Autophagy, an evolutionarily conserved catabolic degradative process, plays a vital role in cardiac physiology and is critical to the survival of both tumor cells and heart cells (White E et al., 2015; Li DL and Hill JA, 2014). Autophagy has been proved to be a mechanism that various cancer cells withstand metabolic stress and cancer therapy cytotoxicity, and it is a promising target for cancer therapy (White E et al., 2015). Many of the chemotherapeutics currently in clinical use alter autophagy levels in cancer cells or cardiomyocytes, and autophagy plays an important role in cardiotoxicity caused by these drugs (Li DL and Hill JA, 2014). Elucidation of the biology of autophagy will help prevent or treat chemotherapy-induced cardiotoxicity (White E et al., 2015; Li DL and Hill JA, 2014). Additionally, development of future autophagy-targeting anti-cancer drugs warrants caution for cardiac side effects, especially when used in combination with other drugs known to affect autophagy levels (Curigliano G et al., 2016; White E et al., 2015; Li DL and Hill JA, 2014). Yuan G (Yuan G et al., 2014), Zhang T (Zhang T et al., 2012) and their colleagues have observed that cucurbitacin-I induced robust autophagy in a variety of cancer cells. Little is known presently about whether cucurbitacin-I exposure induces the cardiomyocyte autophagy in the setting of chemotherapy, and whether autophagy plays an important role in the cucurbitacin-I-induced cardiac toxicity (Alghasham AA, 2013; Chen X et al., 2012). In the current study, the myoblast cell line H9c2 cells, derived from embryonic rat heart, were challenged by cucurbitacin-I to study its potential mechanism of inducing autophagy-dependent cardiotoxicity.
2. Materials and methods 2.1. Materials Cucurbitacin-I, Dimethyl sulfoxide (DMSO) and 3-methyladenine (3-MA) were purchased from Sigma-Aldrich Chemicals (St Louis, MO, USA); WGA, Alexa FluorR 488 conjugate, TRIzol Reagent, lipofectamin TM2000, and the fluorescein isothiocyanate (FITC) Annexin V and propidium iodide (PI) kit for apoptosis detection from Invitrogen (Carlsbad, CA, USA); iScriptTM cDNA Synthesis Kit and iQTM SYBR® Green Supermix from Bio-Rad Laboratories, Inc. (Hercules, CA, USA); Hoechst 33258 from KeyGen Biotech. CO. Ltd (Shang Hai, China); anti-Extracellular signal regulated protein kinase (ERK), anti-phosphor-ERK (Thr202/Tyr204), anti-c-Jun NH2-terminal kinase (JNK), anti-phosphor-JNK, anti-p38, anti-phosphor-p38, anti-caspase3, anti-LC3B and anti-β-actin antibodies from
Cell
Signaling
Technologies
(Beverly,
MA,
USA);
4’6’-diamidino-2-phenylindole (DAPI) from Roche (Roche Applied Science, Indianapolis, IN, USA), U0126-EtOH (a ERK inhibitor) from Selleckchem (Houston, TX, USA), SP600125 (a JNK inhibitor), and SB203580 (a p38 Mitogen-Activated Protein Kinase ( MAPK) inhibitor) were from Calbiochem (Cambridge, MA, USA). All pairs of PCR primers were synthesized by Shenggong Biotechnology (Shanghai, China). Other chemicals and reagents were of analytical grade. 2.2. Cardiac H9c2 cell cultures and treatments The H9c2 cell line is a subclone of the original clonal cardiomyoblast, which is derived from embryonic rat heart tissue and holds lots of cardiomyocyte characteristics (Hescheler J et al., 1991). All cells used were derived from an initial CRL-1446 cell culture of the American Type Culture Collection (CRL-1446; ATCC, Rockville, MD). Cells were cultured in Dulbecco’s modified Eagle’s medium, supplementing with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin, in a humidified incubator containing 95% air and 5% CO2 at 37 °C, with media refreshed every 3 days. Cells cultured at about 80% confluence were treated with cucurbitacin-I (dissolved in DMSO). For inhibitor experiments, cells
were pre-incubated with the selective autophagy inhibitor 3-MA (10 mM), the ERK inhibitor U0126 (10 μM), the JNK inhibitor SP600125 (20 μM), or the p38 MAPK inhibitor SB203580 (20 μM) for 1 h, respectively, and then treated with cucurbitacin-I for 48 h. Control cells were treated with an equal amount of DMSO (0.1% v/v).
2.3. Cell viability assays After treatment with different concentrations of cucurbitacin-I, H9c2 cells were washed with PBS, and then adhesive cells harvested and stained with Annexin-V-FITC/ PI kit (Invitrogen, USA) and Hoechst 33258 following the manufacturer’s instructions. The cells apoptosis were analyzed by a CytoFLEX flow cytometer (Beckman Coulter) (Zhu Y et al., 2011), and the cell viabilities were detected by a Celigo® Image cytometer (Nexcelom, USA) (Chan LL et al., 2016). The data were analyzed by using CytExpert software (TreeStar, Ashand, OR, USA) and the Celigo® system (Chan LL et al., 2016) provided a gross quantitative analysis for each fluorescence channel and individual well, including total number of cells by Hoechst-33258-positive nucleus counting, the number of apoptotic cells by Annexin-V-positive cell counting, and the number of dead cells by PI-positive nucleus counting (Zhu Y et al., 2011; Chan LL et al., 2016).
2.4. Measurement of cell size H9c2 cardiomyocytes were grown on collagen-coated coverslips. After different treatments with cucurbitacin-I or 3-MA alone, or in combination, the cells were fixed with 4% paraformaldehyde for 30 min. After stained with Alexa Fluor 488-conjugated WGA (Molecular Probes, Invitrogen, USA) (5.0 µg/mL) for 30 min at 37°C to visualize cytomembrane, at least 100 cardiomyocytes in each group were collected and measured the surface area in three independent experiments by use of Image J program (NIH) (Wang X et al., 2014).
2.5. Fluoresecence Microscope Imaging of Autophagy after GFP-LC3 Transient Transfection H9c2 cells were transfected with a pEGFP-LC3 plasmid following the
manufacturer’s instructions by using lipofectamine 2000 (Invitrogen) (Wang X et al., 2014). After treatments, the cells were fixed with 4% paraformaldehyde. Autophagy was detected by calculating the percentage of GFP-LC3-positive autophagic vacuoles or cells with LC3 punctate dots. The GFP-LC3 punctate dot structures in individual live H9c2 cells were imaged by using a fluorescence microscope. Twenty fields of 600×magnification with 20 to 30 GFP-labeled green cells per field were counted in each condition.
2.6. Quantitative Real-Time PCR (qPCR) Assays Total RNA was extracted from H9c2 cells by using the TRIzol Reagent (Chen H et al., 2013). To evaluate the mRNA expression levels of hypertrophic markers including atrial natriuretic peptide(ANP) and brain natriuretic peptide (BNP), reverse transcription was performed with the iScriptTM cDNA Synthesis Kit (Bio-Rad; Hercules, CA, USA) following the manufacturer’s protocol. GAPDH was used for normalization of the results. The primers sequences (forward and reverse) were as follows: ANP: CAAAGGCTGAGAGAGAAACCA, GCCAGGAAG AGGAAGA A GC; BNP: GAGACAAGAGAGAGCAGGACA, AAAGCAGGAGCAGAATC ATC; GAPDH: TGCCACTCAGAAGACTGTGG, GTCCTCAGTGTAGCCAGGA.
2.7. Western blotting analysis Western blot assay was performed following the method described previously (Chen H et al., 2013). H9c2 cells were lyzed at 4°C and then the supernatants collected after centrifugation. The protein concentration was measured by Bradford assay (Bio-Rad). Protein lysate was loaded on and separated by the 10% or 12% SDS-PAGE, and then transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were probed with antibodies against caspase3, LC3B, p-ERK, ERK, p-p38, p-38, p-JNK, JNK and β-actin, respectively. Signals were amplified and observed with horseradish peroxidase (HRP)-conjugated secondary antibody (Santa Cruz, CA, U.S.A., 1:1000 dilution) and enhanced chemiluminescence. An ECL Western Blot Detection System (EMD Millipore, MA, U.S.A.) was used to detect
densitometry. All experiments were repeated at least three times.
2.8. Statistical analysis Results were presented as mean ± SEM. Comparisons were performed by using unpaired Student’s t test and groups of three or more were analyzed by using one-way ANOVA, followed by the Newman-Keuls multiple comparison tests. A P value<0.05 was considered statistically significant.
Results
3.1. Cytotoxic effects of cucurbitacin-I on cultured H9c2 cardiomyoblasts To evaluate the cytotoxicity of cucurbitacin-I in cultured H9c2 cells, the viability of the H9c2 cells was tested via Celigo® system after treatment with different concentrations of cucurbitacin-I for 48 h. As shown in Fig. 2A, cucurbitacin-I triggered cell mortality significantly at 0.3-1 μM, with a gradually increase in cell mortality of 1.93-fold, 5.06-fold, and 7.22-fold, compared with the control cells (all P < 0.01), respectively. To get more insights into the H9c2 cell death by cucurbitacin-I, effect of cucurbitacin-I on H9c2 cell apoptosis and secondary necrosis were investigated by flow cytometry. As shown in the right lower quadrant and upright quadrant, treatment of Cu-I at 0.3-1 μM resulted in a significant increase in FITC+PI+ and FITC+ cell population (7.31%, 7.90% and 17.47%, respectively), whereas very few Annexin-V and PI positive (FITC+PI+, late phase apoptosis and necrosis) and Annexin-V positive (FITC+, early phase apoptosis) cells were detected in control cultures (2.22%) (Fig. 2B and 2C). These results indicate that cytotoxic actions of cucurbitacin-I on H9c2 cells in a concentration-dependent manner. Therefore, cucurbitacin-I at a concentration of 0.3 μM was employed for further experimentation to assess its impact on H9c2 cells.
3.2.Cucurbitacin-I induces hypertrophic responses in H9c2 cardiomyoblasts The hypertrophic response of cardiomyocytes is characterized by an augmented cell size and the induced expression of hypertrophic markers, such as ANP and BNP (Chen H et al., 2013). In order to verify whether cucurbitacin-I induces cardiomyocyte hypertrophy, we cultured H9c2 cells for 48 h with or without cucurbitacin-I treatment. H9c2 cells were visualized with an inverted microscope after treatment with cucurbitacin-I at different concentrations (Fig. 3A). Compared with the control cells, H9c2 cell surface area was notably increased by 1.52-fold and 2.90-fold at 0.1 μM and 0.3 μM, respectively (both P< 0.01, Fig. 3B). Furthermore, real time-PCR assay indicated that cucurbitacin-I treatment (0.3μM) markedly elevated both ANP and BNP mRNA levels in H9c2 cells (Fig. 3C and 3D). To get more insights into the cucurbitacin-I-induced hypertrophic responses in H9c2 cells, we further investigated the cell surface area after staining with Alexa Fluor 488-conjugated WGA. We observed that 0.1 and 0.3 μM (but not 0.01 μM) cucurbitacin-I treatments significantly induced larger cell surface area by 1.41-fold and 2.90-fold (both P<0.01), respectively, compared with DMSO-treated control cells (Fig. 3E and 3F). Collectively, these results showed that cucurbitacin-I induced hypertrophic responses in cardiomyoblasts in a concentration-dependent manner.
3.3. Cucurbitacin-I deteriorates cardiac hypertrophy in H9c2 cardiomyoblasts through activation of autophagy We examined the activation of autophagy and apoptosis induced by cucurbitacin-I exposure. As shown in Fig.4A and 4B, the ratios of LC3-II/β-actin in H9c2 cells gradually increased by increasing cucurbitacin-I concentrations from 0.01 to 0.3 μM (3.91-fold, P< 0.01) compared with control cells. To further reveal the functional relationship between cucurbitacin-I and apoptosis, we detected active caspase-3 levels.
As shown in Fig. 4C, after being treated with cucurbitacin-I at concentrations of 0.1 and 0.3 μM , cleaved caspase 3 levels of H9c2 cells markedly increased resulting in the elevated cleaved caspase-3/β-actin ratios to 24.11% (P<0.05) and 57.22% (P<0.01), respectively, by comparing with control cells. Interestingly, when we used an autophagy inhibitor 3-MA (10 mM) to block the augmented autophagy levels induced by cucurbitacin-I, the significant decrease in surface area of H9c2 cells was observed (Fig. 4D-H). Compared with H9c2 cells treated with 0.3 μM cucurbitacin-I alone, cells pre-incubated with 10mM 3-MA for 30 min and then co-incubated with 0.3 μM cucurbitacin-I for 48h showed a decrease in LC3-II/β-actin ratio by 56.91% (P<0.01, Fig. 4D and 4E), in cleaved caspase-3/β-actin ratio by 54.62% (P<0.01, Fig. 4F), and in cell surface area by 31.59% (P< 0.05, Fig. 4G and 4H), respectively. Taken together, these results suggested that cucurbitacin-I induced cardiac hypertrophy and apoptosis in an autophagy dependent manner.
3.4. Cucurbitacin-I induces considerable activation of MAPK signaling pathway in H9c2 cardiomyoblasts The onset of cardiac hypertrophy essentially depends upon activation of MAPKs, including ERK1/2, JNK, and p38 kinases (Liang Y and Sheikh F, 2016). Thus, we examined the MAPK activation induced by cucurbitacin-I in H9c2 cells by detecting the levels of phosphorylated MAPKs. As shown in Fig. 5A-D, after 48 hours of incubation with 0.3 μM cucurbitacin-I, the ratios of phosphorylated ERK1/2, JNK and p38 MAPK to total MAPKs in H9c2 cells were increased with 1.37-fold, 1.08-fold, and 0.44-fold, respectively, by comparing with those in control cells (all P<0.01). Our results indicated that cucurbitacin-I exposure strongly activated MAPKs in H9c2 cells.
3.5. The ERK inhibitor U0126 supplementation suppresses both autophagy and apoptosis induced by Cucurbitacin-I exposure in
H9c2 cardiomyoblasts To further reveal which MAPK subfamily, ERK1/2, JNK or p38 kinase, was involved in cucurbitacin-I-induced autophagy and cell apoptosis, we detected autophagy levels and apoptosis in H9c2 cells in the presence of pharmacological inhibitors of the three MAPK family members. 20 μM U0126 (a specific MEK/ERK1/2 inhibitor) was pre-incubated with H9c2 cells for 1 h, and then cucurbitacin-I (0.3 μM) was added for another 48 h. Our results showed notably reduced cell apoptosis and cucurbitacin-I-stirred LC3-II conversion (Fig.6A), with decrease in cleaved caspase-3/β-actin ratios by 19.73% (P<0.05) and LC3-II/β-actin ratios by 47.3% (P<0.01), compared with cells challenged by 0.3 μM cucurbitacin-I alone, respectively. However, pre-incubation with a special p38 MAPK inhibitor, SB203580 (20 μM), or a special JNK inhibitor, SP600125 (20 μM), showed no obvious effect on cucurbitacin-I -induced autophagy and cell apoptosis in H9c2 cells, compared with cucurbitacin-I alone treated cells (Fig.6B and 6C). These results suggested that cucurbitacin-I-stirred ERK activation played an important role in its induction of autophagy and apoptosis in cardiomyocytes.
3.6. Inhibition of MEK/ERK1/2 signaling attenuated the autophagy and hypertrophy induced by cucurbitacin-I exposure in H9c2 cardiomyoblasts MEK/ERK1/2 signaling pathway has been suggested to participate in the regulation of autophagy (Lorenz K et al., 2009) and cardioprotection (Lips DJ et al., 2004). We further examined the hypothesis that the suppression of cucurbitacin-I-stimulated MEK/ERK1/2 signaling pathway might help to alleviate cucurbitacin-I-induced cardiac hypertrophy by reducing the autophagy. GFP-LC3 is a marker for autophagic membranes, which allows the direct visualization of autophagy in cells (Pugsley HR, 2016). After transient transfection of a pEGFP-LC3 plasmid into H9c2 cells, we observed that the control and U0126 alone treated cells exhibited diffused and weak
LC3 punctate dots in the cytoplasm, while 0.3 μM cucurbitacin-I treatment alone induced numerous bright green LC3 punctate dots in the cytoplasm, with a significant increase in average number of GFP-LC3 dots per cell by 36.92% (P<0.01) compared with control cells (Fig.7A-C). Furthermore, we investigated the cell size and the mRNA expression levels of ANP and BNP to confirm the effect of U0126 on cucurbitacin-I-induced hypertrophic H9c2 cells. The cell surface area was investigated by staining with Alexa Fluor 488-conjugated WGA. Our data indicated that the surface area of cells treated with 0.3 μM cucurbitacin-I alone is 3.5-fold larger than control cells treated with DMSO (P<0.01). Furthermore, the U0126 supplementation remarkably decreased the cell surface area, with 39.33% less than that of cells treated with cucurbitacin-I alone (P< 0.05, Fig. 7D and 7E). In addition, 0.3 μM cucurbitacin-I treatment alone induced the mRNA expression levels of both ANP and BNP, with a significant increase by 4.79-fold and 6.67-fold (P< 0.01, Fig.7F and 7G), compared with the control cells, respectively. U0126 pre-incubation and then co-incubation with Cu-I (0.3 μM) significantly decreased the mRNA expression levels of ANP and BNP, with a decrease of 40.31% and 34.84% (both P< 0.05, Fig.7F and 7G), compared with cucurbitacin-I treatment alone cells, respectively. These findings indicated that cucurbitacin-I induced cardiac hypertrophy and apoptosis through a MEK/ERK1/2 signaling pathway.
Discussion Cardiovascular toxicity is a potential short- or long-term complication of various anticancer therapies (Curigliano G et al., 2012; Stortecky S and Suter TM, 2010). With recent advances in cancer chemotherapy and consequent improvements in cancer survival, drug induced toxicity to the heart has assumed greater importance (Saijo N et al., 2003; Stortecky S and Suter TM, 2010; Adão R et al., 2013). Our findings indicated that cucurbitacin-I induced cardiac hypertrophy and cell death (including apoptosis) in H9c2 myoblasts, which was comparable with the action of doxorubicin in H9c2 cells (Merten KE et al., 2006). H9c2 myoblasts was isolated and
established by selective passaging from BDIX rat heart tissue (Hescheler J et al., 1991). Watkins and colleagues (Watkins SJ et al., 2011) observed that H9c2 cells showed almost identical hypertrophic responses to those observed in primary cardiomyocytes. Therefore, these results suggested that clinical application of cucurbitacin-I for tumor therapy might associate with potential cardiotoxicity, including hypertrophy and cardiomyocyte death. Cardiac hypertrophy is an adaptive response to a wide array of intrinsic and extrinsic stimuli (Shimizu I and Minamino T, 2016). It is characterized by an increase in protein synthesis, sarcomeric reorganization and re-expression of fetal regulatory genes (Li Z et al., 2015; Shimizu I and Minamino T, 2016). Prolonged pathological cardiac hypertrophy is a major cardiovascular endpoint and is strongly associated with arrhythmias, heart failure and sudden death (Shimizu I and Minamino T, 2016; Stevens SM et al., 2013). It was the first time for us to uncover a dose-dependent side effect of cucurbitacin-I, the cardiotoxicity, by inducing cardiac hypertrophy, which has been associated with morphological changes leading to increases in cell size and death (including apoptosis). Because the re-induction of the fetal cardiac gene program is known to be a hallmark of cardiomycyte hypertrophy, we further investigated the effects of cucurbitacin-I on the mRNA expression of the ANP and BNP genes, (Shimizu I and Minamino T, 2016). Our findings indicated that 0.3 μM cucurbitacin-I induced significant increase in both ANP and BNP mRNA expression. However, the details of molecular pathways associated with cucurbitacin-I-induced cardiotoxicity in H9c2 cells are still open for further investigation. Autophagy is an evolutionarily conserved dynamic self-degradative process necessary for the maintenance of cellular homeostasis (Anding AL and Baehrecke EH, 2015). Experienced regulation of autophagy protects heart from various physiological and pathological stimuli via degrading and recycling of protein aggregates, lipid drops, or dysfunctional organelles (Zhenhua Li et al., 2015). LC3-II is localized in both the outer and inner membranes of the autophagosome, and usually utilizes as a special autophagosome marker (Pugsley HR, 2016). Tracking the conversion of LC3-I to LC3-II is indicative of autophagic activity (Li Z et al., 2015; Pugsley HR, 2016). We
observed that cucurbitacin-I induced strong autophagy in H9c2 cells in a concentration-dependent manner and parallel with the increase in H9c2 cell apoptosis, which was comparable with those reported by Yuan G (Yuan G et al., 2014) and Zhang T (Zhang T et al., 2012) et al., their studies showed cucurbitacin I stirred robust autophagy in cancer cells. These results suggested that cucurbitacin-I might induce strong autophagy and apoptosis in cardiac tissues when it is used in anti-tumor therapy in clinical oncology patients. We further evaluated the role of cucurbitacin-I -induced autophagy in cardiomyocyte hypetrophy and apoptosis by the use of 3-MA, an autophagy inhibitor. Compared with cucurbitacin-I treatment alone cells, 3-MA pre-incubation and then co-incubation with cucurbitacin-I notably reduced the cucurbitacin-I-induced autophagy level, and associating with a significant decrease in both cell size and apoptosis. These results indicated that cucurbitacin-I induced a detrimental autophagy in cardiomyocytes, which was closely related to the induction of hypertrophic and apoptotic phenotypes. Although STAT3 has been identified as a new autophagy regulator (Jonchère B et al., 2013), Zhang T et al. (Zhang T et al., 2012) observed that cucurbitacin-I induced strong autophagy in cancer cells in a STAT3-independent way. So we further investigated the role of a conventional or classical signaling pathway that regulates cardiac hypertrophy, MAPKs (Liang Y and Sheikh F, 2016; Zhang W et al., 2003). The MAPK signaling pathway consists of three major members, including ERK, JNK and p38 MAP kinase, which are mainly activated by stress type stimuli (Zhang W et al., 2003). JNK and p38 play a vital role in the induction of the cardiac hypertrophy (Zhang W et al., 2003). Although ERK1/2 provides critical protective effects/signals during stress-stimulation (Abdel-Daim M et al., 2010), it is not absolutely necessary for mediating cardiac hypertrophy (Zhang W et al., 2003; Kehat I and Molkentin JD, 2009).We observed that all three members of MAPKs were activated in H9c2 cells with exposure to cucurbitacin-I. However, only the blockage of ERK1/2 signaling pathway, but not the JNK and p38 MAPK, weakened the induction of cucurbitacin-I in autophagy, hypertrophy and apoptosis. Accumulating evidences have revealed that ERK1/2 induced autophagy in response to various anti-cancer/cytotoxic agents, like
the ways of soyasaponins in colon cancer cells, capsaicin in breast cancer cells and cadmium in mesangial cells (Sridharan S et al., 2011). Our results indicated that as a new anti-tumor drug, cucurbitacin-I induced autophagy, hypertrophy and apoptosis in cardiomyocytes through the activation of ERK1/2 signaling pathway. Both autophagy and apoptosis are well-controlled biological processes that play critical roles in tissue homeostasis and diseases (Nikoletopoulou V et al., 2013). Similar stimuli usually induce a complicated cross-talk between autophagy and apoptosisis (Gump JM and Thorburn A, 2011). In particular cases, excessive autophagy or autophagy-relevant proteins may contribute to cause apoptosis (Gump JM and Thorburn A, 2011). Our results suggested that cucurbitacin-I-induced cardiotoxicity was characterized by stirring a strong autophagy in cardiomycytes, which was parallel with the cell damage, hypertrophic and apoptotic phenotypes. Furthermore, ERK signaling inhibition significantly weakened the cucurbitacin-I-induced autopahgy, hypertrophy and apoptosis, which revealed an ERK-autophagy dependent pathway. In summary, as shown in Figure 8, the principal finding of this study was that the autophagy stirred by cucurbitacin-I through the ERK pathway is involved in its cardiotoxicity, including cardiomyocyte hypertrophy and apoptosis. These findings provide advantageous insights for the development of efficacious cancer therapies with lower cardiotoxicity by combining with ERK1/2 signaling inhibition, which might represent a promising treatment avenue with higher efficacy for cancer patients. Conflict of interest All the co‐authors have read the manuscript carefully and approved its submission to TOXICOLOGY LETTERS. This work was supported by the National Natural Science Foundation of China (31071001, 31271226 and 81670249 to Dr. Wei Jiang. A statement on potential conflicts of interest: NONE. Disclaimers: NONE.
Acknowledgements This work was supported by the National Natural Science Foundation of China (31071001, 31271226 and 81670249 to Dr. W Jiang). We would like to thank Dr Zengliu Su for language assistance. The authors have no competing financial interests to declare.
References Abdel-Daim M, Funasaka Y, Komoto M, Nakagawa Y, Yanagita E, et al. Pharmacogenomics of metabotropic glutamate receptor subtype 1 and in vivo malignant melanoma formation. Journal of Dermatology. 2010; 37: 635-646. Adão R, de Keulenaer G, Leite-Moreira A et al. Cardiotoxicity associated with cancer therapy: Pathophysiology and prevention. Rev Port Cardiol. 2013 May; 32(5):395-409. Alghasham AA. Cucurbitacins - a promising target for cancer therapy. Int J Health Sci (Qassim). 2013 Jan; 7(1):77-89. Anding AL, Baehrecke EH. Autophagy in Cell Life and Cell Death. Curr Top Dev Biol. 2015; 114:67-91. doi: 10.1016/bs.ctdb.2015.07.012. Epub 2015 Sep 9. Chan LL, Smith T, Kumph KA, Kuksin D, Kessel S, Déry O, Cribbes S, Lai N, Qiu J.A high-throughput AO/PI-based cell concentration and viability detection method using the Celigo image cytometry. Cytotechnology. 2016 Aug 3. DOI: 10.1007/s10616-016-0015-x. [Epub ahead of print] Chen H, Wang X, Tong M, Wu D, Wu S, Chen J, Wang X, Wang X, Kang Y, Tang H, Tang C, Jiang W. Intermedin suppresses pressure overload cardiac hypertrophy through activation of autophagy. PLoS One. 2013 May 29; 8(5):e64757. doi: 10.1371/journal.pone.0064757. Print 2013. Chen X, Bao J, Guo J, Ding Q, Lu J, Huang M, Wang Y. Biological activities and potential molecular targets of cucurbitacins: a focus on cancer. Anticancer Drugs. 2012 Sep; 23(8):777-87. doi: 10.1097/CAD.0b013e3283541384. Curigliano G, Cardinale D, Dent S, Criscitiello C, Aseyev O, Lenihan D, Cipolla CM. Cardiotoxicity
of
anticancer
treatments:
Epidemiology,
management.CA Cancer J Clin. 2016 Jul; 66(4):309-25.
detection,
and
Curigliano G, Cardinale D,Suter T et al. Cardiovascular toxicity induced by chemotherapy, targeted agents and radiotherapy: ESMO Clinical Practice Guidelines. Ann Oncol. 2012 Oct;23 Suppl 7:vii155-66; Double J, Barrass N, Barnard ND, Navaratnam V. Toxicity testing in the development of anticancer drugs. Lancet Oncol. 2002 Jul; 3(7):438-42. Gump JM, Thorburn A. Autophagy and apoptosis: what is the connection? Trends Cell Biol. 2011 Jul; 21(7):387-92. doi: 10.1016/j.tcb.2011.03.007. Epub 2011 May 10. Hescheler J, Meyer R, Plant S, Krautwurst D, Rosenthal W, Schultz G. Morphological, biochemical, and electrophysiological characterization of a clonal cell (H9c2) line from rat heart. Circulation Research (1991)1476-1486. Ho CH, Ho MG, Ho SP, Ho HH. Bitter bottle gourd (Lagenariasiceraria) toxicity. J Emerg Med. 2014 Jun; 46(6):772-5. doi: 10.1016/j.jemermed.2013.08.106. Epub 2013 Dec 17. Huitink JM, Teoh WH. Current cancer therapies - a guide for perioperative physicians. Best Pract Res Clin Anaesthesiol. 2013 Dec; 27(4):481-92. Jonchère B, Bélanger A, Guette C, Barré B, Coqueret O. STAT3 as a new autophagy regulator. JAKSTAT. 2013 Jul 1; 2(3):e24353. doi: 10.4161/jkst.24353. Kehat I, Molkentin JD. Extracellular signal-regulated kinase 1/2 (ERK1/2) signaling in cardiac hypertrophy. Ann N Y Acad Sci. 2010 Feb; 1188:96-102. doi: 10.1111/j.1749-6632.2009.05088.x. Lee DH, Iwanski GB, Thoennissen NH. Cucurbitacin: ancient compound shedding new light on cancer treatment. Scientific World Journal. 2010 Mar 5; 10: 413-8. Li DL, Hill JA. Cardiomyocyte Autophagy and Cancer Chemotherapy. J Mol Cell Cardiol. 2014 Jun; 71:54-61; Li Z, Wang J, Yang X. Functions of autophagy in pathological cardiac hypertrophy. Int J Biol Sci. 2015 Apr 27; 11(6):672-8. doi: 10.7150/ijbs.11883. Liang Y, Sheikh F. Scaffold Proteins Regulating Extracellular Regulated Kinase Function in Cardiac Hypertrophy and Disease. Front Pharmacol. 2016 Feb 29;7:37. doi: 10.3389/fphar.2016.00037. eCollection 2016.
Lips DJ, Bueno OF, Wilkins BJ et al. MEK1-ERK2 signaling pathway protects myocardium from ischemic injury in vivo. Circulation 109 (2004 )1938-1941; Lorenz K, Schmitt JP, Vidal M, Lohse MJ. Cardiac hypertrophy: targeting Raf/MEK/ERK1/2-signaling.Int J Biochem Cell Biol. 2009 Dec; 41(12):2351-5. doi: 10.1016/j.biocel.2009.08.002. Merten KE, Jiang Y, Feng W, Kang YJ. Calcineurin Activation Is Not Necessary for Doxorubicin-Induced Hypertrophy in H9c2 Embryonic Rat Cardiac Cells: Involvement of the Phosphoinositide 3-Kinase-Akt Pathway. J Pharmacol Exp Ther. 2006 Nov; 319(2):934-40; Nikoletopoulou V, Markaki M, Palikaras K, Tavernarakis N.Crosstalk between apoptosis, necrosis and autophagy. Biochim Biophys Acta. 2013 Dec; 1833(12):3448-59. doi: 10.1016/j.bbamcr.2013.06.001. Pugsley HR. Quantifying autophagy: Measuring LC3 puncta and autolysosome formation in cells using multispectral imaging flow cytometry. Methods. 2016 Jun 1. pii: S1046-2023(16)30155-4. doi: 10.1016/j.ymeth.2016.05.022. Ramaswami R, Harding V, Newsom-Davis T. Novel cancer therapies: treatments driven by tumour biology. Postgrad Med J. 2013 Nov; 89(1057):652-8. Saijo N, Tamura T, Nishio K. Strategy for the development of novel anticancer drugs. Cancer Chemother Pharmacol. 2003 Jul; 52 Suppl 1:S97-101. Epub 2003 Jun 18. Shimizu I, Minamino T. Physiological and pathological cardiac hypertrophy. J Mol Cell Cardiol. 2016 Aug; 97:245-62. doi: 10.1016/j.yjmcc.2016.06.001. Epub 2016 Jun 2. Sridharan S, Jain K, Basu A. Regulation of autophagy by kinases. Cancers (Basel). 2011 Jun 9; 3(2):2630-54. doi: 10.3390/cancers3022630. Stevens SM1, Reinier K, Chugh SS.Increased left ventricular mass as a predictor of sudden cardiac death: is it time to put it to the test? Circ Arrhythm Electrophysiol. 2013 Feb; 6(1):212-7. doi: 10.1161/CIRCEP.112.974931. Stortecky S, Suter TM. Insights into cardiovascular side-effects of modern anticancer therapeutics. Curr Opin Oncol. 2010 Jul;22(4):312-7. Wang
X, Wang
XL, Chen
HL
et
al.
Ghrelin inhibits
doxorubicin
cardiotoxicity by inhibiting excessive autophagy through AMPK and p38-MAPK. Biochem Pharmacol. 1 (2014) 334-350; Watkins SJ, Borthwick GM, Arthur HM. The H9C2 cell line and primary neonatal cardiomyocyte cells show similar hypertrophic responses in vitro. In Vitro Cell Dev Biol Anim. 2011 Feb; 47(2):125-31; White E, Mehnert JM, Chan CS.Autophagy, Metabolism, and Cancer.Clin Cancer Res. 2015 Nov 15; 21(22):5037-46. Yuan G, Yan SF, Xue H et al. Cucurbitacin I Induces Protective Autophagy in Glioblastoma in vitro and in vivo. J Biol Chem. 2014 Apr 11; 289(15):10607-19; Zhang
T,Li
Y, Park
KA
et
al.
Cucurbitacin
induces
autophagy throughmitochondrial ROS production which counteracts to limit caspa se-dependent apoptosis. Autophagy 8 (2012) 559-576. Zhang W, Elimban V, Nijjar MS, Gupta SK, Dhalla NS. Role of mitogen-activated protein kinase in cardiac hypertrophy and heart failure. ExpClinCardiol. 2003 Winter;8(4):173-83; Zhenhua Li,Jian Wang, Xiao Yang. Functions of Autophagy in Pathological Cardiac Hypertrophy. Int J Biol Sci. 2015; 11(6): 672–678; Zhu Y, Shi YP, Wu D, Ji YJ, Wang X, Chen HL, Wu SS, Huang DJ, Jiang W. Salidroside protects against hydrogen peroxide-induced injury in cardiac H9c2 cells via PI3K-Akt dependent pathway.DNA Cell Biol. 2011 Oct;30(10):809-19.
Figure captions
Fig.1. Chemical structure of Cucurbitancin-I. Cucurbitacin-I is a natural cell-permeable triterpenoid purified from cucurbitaceae plants. Fig.2. Cytotoxic actions of cucurbitacin-I on cultured H9c2 cardiomyoblasts. H9c2 cells were treated with the indicated concentrations of cucurbitacin-I for 48 h, then the viabilities of H9c2 cells were detected by using a Celigo® system (n=6/group, A), and the cell apoptosis and secondary necrosis were investigated by using a flow cytometry (n=3/group, B and C). All data were represented as mean ± SEM, and analyzed with the one-way ANOVA.**P<0.01 as compared with DMSO-treated groups (controls). Cu-I, cucurbitacin-I. Fig.3. Cucurbitacin-I induces cardiac hypertrophic responses in H9c2 cardiomyoblasts. H9c2 cells were treated with cucurbitacin-I at the indicated concentrations for 48 h. (A) Cells were visualized with an inverted microscope. (B) The cell surface areas were measured by using the NIH Image J software (mean ± SEM, n=100 cells), Scale bars=50μm. (C and D) Real-time PCR analysis for mRNA expression of the hypertrophic markers ANP and BNP after cucurbitacin-I exposure for 48 h (n=4/group). (E) Cells were challenged by the indicated concentrations of cucurbitacin-I for 48 h, and then stained with Alexa Fluor 488-conjugated WGA to visualize the cell membrane. (F) The cell surface areas were measured by using the NIH Image J software (mean ± SEM, n = 100 cells). Scale bars = 20μm. Data were expressed as fold changes ± SEM vs. the control group, and analyzed with the one-way ANOVA. **P<0.01. Cu-I, cucurbitacin-I. Fig.4. Cucurbitacin-I induces hypertrophy and apoptosis in H9c2 cardiomyoblasts through activation of autophagy. (A) LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with cucurbitacin-I treatments at the indicated concentrations for 48h. (B and C) Densitometric analysis showed that Cu-I treatments gradually increased the ratios of LC3II/β-actin and cleaved-caspase-3/β-actin in a concentration-dependent manner (n=3/group). (D) LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with 0.3μM Cu-I incubation in the absence and presence of 10 mM 3-MA (pre-incubated for 30 min) for 48 h. (E and F) Densitometric analysis (n=3/group) showed that 3-MA attenuated the induction of Cu-I on autophagy (LC3II/β-actin ratios) and apoptosis (cleaved-caspase-3/β-actin ratios). (G) H9c2 cells were treated with 0.3μM Cu-I in the absence and presence of 10 mM 3-MA for 48 h, then the cell membrane was stained
with Alexa Fluor 488-conjugated WGA. (H) The cell surface areas were measured by the NIH Image J software (mean ± SEM, n = 100 cells). Scale bars = 20μm. The western assay data were represented as mean ± SEM, and the cell surface area data were expressed as fold changes ± SEM vs. the control group, and then statistically analyzed with One-Way ANOVA. *P<0.05, **P<0.01. Cu-I, cucurbitacin-I; 3-MA, 3-methyladenine. Fig.5. Cucurbitacin-I activates MAPK signaling pathways in H9c2 cardiomyoblasts. H9c2 cells were treated with Cu-I at the indicated concentrations for 48h. (A) H9c2 cells extracts (35μg) were received to Western blot analysis of MAPK (ERK1/2, JNK, and p38) proteins expression levels. (B, C and D) Densitometric analysis(n=5/group) showed that 0.3 μM Cu-I exposure notably increased the ratios of p-ERK/ERK, p-JNK/JNK and p-p38/p38, respectively. All data were represented as mean ± SEM, and analyzed with one-way ANOVA.**P<0.01. Cu-I, cucurbitacin-I. Fig.6. The ERK inhibitor U0126 supplementation decreases both autophagy and apoptosis induced by cucurbitacin-I exposure in H9c2 cardiomyoblasts. (A) p-ERK, ERK, LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with an ERK inhibitor, U0126 (20μM), pre-incubation for 1 h and then co-incubation with 0.3 μM cucurbitacin-I for another 48h. Densitometric analysis showed that U0126 supplementation remarkably suppressed Cu-I-induced increase in the ratios of both LC3II/β-actin and cleaved-caspase-3/β-actin. (B) p-p38, p38, LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with a p-38 inhibitor, SB203580 (SB, 20μM), pre-incubation for 1 h and then co-incubation with 0.3 μM cucurbitacin-I for another 48h. Densitometric analysis showed that SB supplementation had no obvious effect on Cu-I-induced LC3II/β-actin ratios and cleaved-caspase-3/β-actin ratios.(C) p-JNK, JNK, LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with a JNK inhibitor, SP600125 (SP, 20μM), pre-incubation for 1 h and then co-incubation with 0.3 μM cucurbitacin-I for another 48h. Densitometric analysis showed that SP supplementation had no obvious effect on Cu-I-induced LC3II/β-actin ratios and cleaved-caspase-3/β-actin ratios. All data are expressed as mean ± SEM (n=3/group), and analyzed with one-way ANOVA, *P<0.05, **P<0.01. Cu-I, cucurbitacin-I; SB, SB203580; SP, SP600125; NS, no significant. Fig.7. MEK/ERK1/2inhibition suppresses the induction of cucurbitacin-I exposure on autophagy and hypertrophy in H9c2 cardiomyoblasts. (A) Representative fluorescence images show the effect of ERK inhibition (20μM U0126 supplementation) on the appearance of a punctate GFP-LC3 signal stirred by 0.3 μM cucurbitacin-I treatment in H9c2 cells which were transfected with a pEGFP-LC3 plasmid. Positive signals were defined as those cells that had five or more GFP-LC3 dots in the cytoplasm, and positive cells were analyzed from at least
100 random fields at 48h. (B) The average number of GFP-LC3 dots per cell. (C) The percentage of the cells with GFP-LC3 dots. (D) Cells were pre-incubated with an ERK inhibitor, U0126 (20μM), for 1 h and then co-incubated with 0.3μM cucurbitacin-I for another 48 h, and then stained with Alexa Fluor 488-conjugated WGA to visualize the cell membrane. (E) The cell surface areas were measured by using the NIH Image J software (mean ± SEM, n=100 cells), Scale bars=20μm. (F and G) Real-time PCR assay was performed to evaluate the hypertrophic markers ANP and BNP mRNA expression in H9c2 cells with 0.3 μM cucurbitacin-I treatment in the absence and presence of 20 μM U0126 for 48h (n=3/group). All data are expressed as mean ± SEM, and analyzed with one-way ANOVA, *P<0.05, **P<0.01. Cu-I, cucurbitacin-I. Fig.8. The schematic diagram summarized the signaling pathways modified by cucurbitacin-I to induce the cardiotoxicity. Cartoon of a hypothetical mechanism for cucurbitacin-I to induce cardiomyocyte hypertrophy and death though a MEK/ERK1/2-autophagy signaling pathway. MEK/ERK1/2 inhibition effectively suppresses the autophagy, hypertrophy and apoptosis stirred by cucurbitacin-I exposure in cardiomyocytes.
c
S0378-4274(16)33296-9 http://dx.doi.org/doi:10.1016/j.toxlet.2016.11.003 TOXLET 9632
To appear in:
Toxicology Letters
Received date: Revised date: Accepted date:
15-9-2016 3-11-2016 6-11-2016
Please cite this article as: Wu, Yao, Chen, Hongying, Li, Ruli, Wang, Xiaoxiao, Li, He, Xin, Juanjuan, Liu, Zhiqiang, Wu, Sisi, Jiang, Wei, Zhu, Ling, Cucurbitacin-I induces hypertrophy in H9c2 cardiomyoblasts through activation of autophagy via MEK/ERK1/2 signaling pathway.Toxicology Letters http://dx.doi.org/10.1016/j.toxlet.2016.11.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Cucurbitacin-I induces hypertrophy in H9c2 cardiomyoblasts through activation of autophagy via MEK/ERK1/2 signaling pathway Yao Wua,b, Hongying Chenb, Ruli Lib, XiaoxiaoWangb, He Lia, Juanjuan Xinb, Zhiqiang Liub, Sisi Wub, Wei Jiang1b, Ling Zhu2a a
School of Preclinical and Forensic Medicine, Sichuan University, Chengdu 610041, P.R. China;
b
Molecular Medicine Research Center, State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu 610041, Sichuan, P.R. China.
1
Corresponding author: Wei Jiang, PhD, MD. Professor. E-mail address:
[email protected] 2
Corresponding author: Ling Zhu, PhD, MD. Professor. Tel.: 86-28-85501278; FAX.
+86-28-85503204; E-mail address: [email protected].
Graphical abstract
Highlights
1. Cucurbitacin-I, a triterpenoids, has diverse pharmacological and biological activities. 2. Cucurbitacin-I induced cardiotoxicity (hypertrophy and death) in H9c2 cells. 3. Cucurbitacin-I induced strong autophagy, hypertrophy and apoptosis in H9c2 cells. 4. Cucurbitacin-I induced cardiotoxicity via an ERK-autophagy dependent pathway.
Abstract Cucurbitacin-I, a natural triterpenoids initially identified in medicinal plants, shows a potent anticancer effect on a variety of cancer cell types. Nevertheless, the cardiotoxicity of cucurbitacin-I has not heretofore been reported. In this study, the mechanisms of cucurbitacin-I-induced cardiotoxicity were examined by investigating the role of MAPK-autophagy-dependent pathways. After being treated with 0.1-0.3μM cucurbitacin-I for 48 h, H9c2 cells showed a gradual decrease in the cell viabilities, a gradual increase in cell size, and mRNA expression of ANP and BNP (cardiac hypertrophic markers). Cucurbitacin-I concentration-dependent apoptosis of H9c2 cells were also observed. The increased apoptosis of H9c2 cells were paralleling with the gradually strong autophagy levels. Furthermore, an autophagy inhibitor, 3-MA, was used to block the cucurbitacin-I-stirred autophagy, and then the hypertrophy and apoptosis induced by 0.3μM cucurbitacin-I were significantly attenuated. In addition, cucurbitacin-I exposure also activated the MAPK signaling pathways, including ERK1/2, JNK, and p38 kinases. Interestingly, only the ERK inhibitor U0126, but not the JNK inhibitor SP600125 and p38 MAPK inhibitor SB203580, weakened the induction of 0.3μM cucurbitacin-I in hypertrophy, autophagy and apoptosis. Our findings suggest that cucurbitacin-I can increase the
autophagy levels of H9c2 cells, most likely, through the activation of an ERK-autophagy dependent pathway, which results in the hypertrophy and apoptosis of cardiomyocytes.
Abbreviations MAPKmitogen-activated protein kinase ANP atrial natriuretic peptide BNP brain natriuretic peptide 3-MA 3-methyladenine DMSO Dimethyl sulfoxide WGA wheat germ agglutinin
Keywords Cucurbitacin-I, cardiomyocyte hypertrophy, MEK/ERK1/2, autophagy, U0126
1. Introduction Cancer remains an important public health concern in the world (Ramaswami R et al., 2013). Although surgical resection and radiation remain the most common strategy for cancer therapy, anticancer agents are equally important for its convenient and efficient when used alone or in combination with surgery or radiotherapy (Huitink JM and Teoh WH, 2013; Saijo N et al., 2003). Therefore, developing new effective anticancer drugs is still an important strategy in tumor therapy (Saijo N et al., 2003). However, cardiotoxicity, a common complication of many anti-cancer agents, remains a major limitation and potential risk of cardiac dysfunction, strongly impacting the quality of life and the overall survival (Saijo N et al., 2003; Double J et al., 2002; Curigliano G et al., 2012). Cardiotoxicity may occur during or shortly after treatment (within days or weeks), or it may become evident a long period after completion of anticancer therapy (Curigliano G et al., 2012).A variety
of
antitumor
drugs
including
anthracyclines,
antimetabolites,
cyclophosphamide and newer targeted agents have been eventually confirmed to cause cardiomyopathy (Curigliano G et al., 2012; Stortecky S and Suter TM, 2010). Strategies to prevent or mitigate cardiac damage from anticancer drugs are needed to provide the best cancer care (Saijo N et al., 2003; Double J et al., 2002; Stortecky S and Suter TM, 2010). Cucurbitacin-I, a natural triterpenoid (Fig. 1) purified from the fruit extract of cucurbitaceae family plants, such as cucumber, has been used in traditional medicine for its antipyretic, analgesic, anti-inflammatory and antimicrobial actions (Lee DH et al., 2010). Recently, accompanied by discoveries showing that cucurbitacins are the strong signal transducers and activators of transcription-3 (STAT3) inhibitors, the antitumor effect of cucurbitacins has received more and more attention (Lee DH et al., 2010; Alghasham AA, 2013). As one of the 12 categories of cucurbitacins, cucurbitacin-I has a potent anticancer effect on several types of cancer cells, including breast cancer, lung cancer, and glioma, which is comparable to cucurbitacin-B and –D, both of them suppress the proliferation of a variety of cancer cells in vitro and in vivo
(Lee DH et al., 2010; Alghasham AA, 2013; Chen X et al., 2012). Cucurbitacins-induced toxicities in patients present with symptoms including diarrhea, ematemesis, hypotension and gastrointestinal mucosal injury (Ho CH et al., 2013), while it is still not clear whether cucurbitacins induce cardiac toxicity, which is a common side effect of other anticancer agents (Alghasham AA, 2013; Chen X et al., 2012; Ho CH et al., 2013). Autophagy, an evolutionarily conserved catabolic degradative process, plays a vital role in cardiac physiology and is critical to the survival of both tumor cells and heart cells (White E et al., 2015; Li DL and Hill JA, 2014). Autophagy has been proved to be a mechanism that various cancer cells withstand metabolic stress and cancer therapy cytotoxicity, and it is a promising target for cancer therapy (White E et al., 2015). Many of the chemotherapeutics currently in clinical use alter autophagy levels in cancer cells or cardiomyocytes, and autophagy plays an important role in cardiotoxicity caused by these drugs (Li DL and Hill JA, 2014). Elucidation of the biology of autophagy will help prevent or treat chemotherapy-induced cardiotoxicity (White E et al., 2015; Li DL and Hill JA, 2014). Additionally, development of future autophagy-targeting anti-cancer drugs warrants caution for cardiac side effects, especially when used in combination with other drugs known to affect autophagy levels (Curigliano G et al., 2016; White E et al., 2015; Li DL and Hill JA, 2014). Yuan G (Yuan G et al., 2014), Zhang T (Zhang T et al., 2012) and their colleagues have observed that cucurbitacin-I induced robust autophagy in a variety of cancer cells. Little is known presently about whether cucurbitacin-I exposure induces the cardiomyocyte autophagy in the setting of chemotherapy, and whether autophagy plays an important role in the cucurbitacin-I-induced cardiac toxicity (Alghasham AA, 2013; Chen X et al., 2012). In the current study, the myoblast cell line H9c2 cells, derived from embryonic rat heart, were challenged by cucurbitacin-I to study its potential mechanism of inducing autophagy-dependent cardiotoxicity.
2. Materials and methods 2.1. Materials Cucurbitacin-I, Dimethyl sulfoxide (DMSO) and 3-methyladenine (3-MA) were purchased from Sigma-Aldrich Chemicals (St Louis, MO, USA); WGA, Alexa FluorR 488 conjugate, TRIzol Reagent, lipofectamin TM2000, and the fluorescein isothiocyanate (FITC) Annexin V and propidium iodide (PI) kit for apoptosis detection from Invitrogen (Carlsbad, CA, USA); iScriptTM cDNA Synthesis Kit and iQTM SYBR® Green Supermix from Bio-Rad Laboratories, Inc. (Hercules, CA, USA); Hoechst 33258 from KeyGen Biotech. CO. Ltd (Shang Hai, China); anti-Extracellular signal regulated protein kinase (ERK), anti-phosphor-ERK (Thr202/Tyr204), anti-c-Jun NH2-terminal kinase (JNK), anti-phosphor-JNK, anti-p38, anti-phosphor-p38, anti-caspase3, anti-LC3B and anti-β-actin antibodies from
Cell
Signaling
Technologies
(Beverly,
MA,
USA);
4’6’-diamidino-2-phenylindole (DAPI) from Roche (Roche Applied Science, Indianapolis, IN, USA), U0126-EtOH (a ERK inhibitor) from Selleckchem (Houston, TX, USA), SP600125 (a JNK inhibitor), and SB203580 (a p38 Mitogen-Activated Protein Kinase ( MAPK) inhibitor) were from Calbiochem (Cambridge, MA, USA). All pairs of PCR primers were synthesized by Shenggong Biotechnology (Shanghai, China). Other chemicals and reagents were of analytical grade. 2.2. Cardiac H9c2 cell cultures and treatments The H9c2 cell line is a subclone of the original clonal cardiomyoblast, which is derived from embryonic rat heart tissue and holds lots of cardiomyocyte characteristics (Hescheler J et al., 1991). All cells used were derived from an initial CRL-1446 cell culture of the American Type Culture Collection (CRL-1446; ATCC, Rockville, MD). Cells were cultured in Dulbecco’s modified Eagle’s medium, supplementing with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin, in a humidified incubator containing 95% air and 5% CO2 at 37 °C, with media refreshed every 3 days. Cells cultured at about 80% confluence were treated with cucurbitacin-I (dissolved in DMSO). For inhibitor experiments, cells
were pre-incubated with the selective autophagy inhibitor 3-MA (10 mM), the ERK inhibitor U0126 (10 μM), the JNK inhibitor SP600125 (20 μM), or the p38 MAPK inhibitor SB203580 (20 μM) for 1 h, respectively, and then treated with cucurbitacin-I for 48 h. Control cells were treated with an equal amount of DMSO (0.1% v/v).
2.3. Cell viability assays After treatment with different concentrations of cucurbitacin-I, H9c2 cells were washed with PBS, and then adhesive cells harvested and stained with Annexin-V-FITC/ PI kit (Invitrogen, USA) and Hoechst 33258 following the manufacturer’s instructions. The cells apoptosis were analyzed by a CytoFLEX flow cytometer (Beckman Coulter) (Zhu Y et al., 2011), and the cell viabilities were detected by a Celigo® Image cytometer (Nexcelom, USA) (Chan LL et al., 2016). The data were analyzed by using CytExpert software (TreeStar, Ashand, OR, USA) and the Celigo® system (Chan LL et al., 2016) provided a gross quantitative analysis for each fluorescence channel and individual well, including total number of cells by Hoechst-33258-positive nucleus counting, the number of apoptotic cells by Annexin-V-positive cell counting, and the number of dead cells by PI-positive nucleus counting (Zhu Y et al., 2011; Chan LL et al., 2016).
2.4. Measurement of cell size H9c2 cardiomyocytes were grown on collagen-coated coverslips. After different treatments with cucurbitacin-I or 3-MA alone, or in combination, the cells were fixed with 4% paraformaldehyde for 30 min. After stained with Alexa Fluor 488-conjugated WGA (Molecular Probes, Invitrogen, USA) (5.0 µg/mL) for 30 min at 37°C to visualize cytomembrane, at least 100 cardiomyocytes in each group were collected and measured the surface area in three independent experiments by use of Image J program (NIH) (Wang X et al., 2014).
2.5. Fluoresecence Microscope Imaging of Autophagy after GFP-LC3 Transient Transfection H9c2 cells were transfected with a pEGFP-LC3 plasmid following the
manufacturer’s instructions by using lipofectamine 2000 (Invitrogen) (Wang X et al., 2014). After treatments, the cells were fixed with 4% paraformaldehyde. Autophagy was detected by calculating the percentage of GFP-LC3-positive autophagic vacuoles or cells with LC3 punctate dots. The GFP-LC3 punctate dot structures in individual live H9c2 cells were imaged by using a fluorescence microscope. Twenty fields of 600×magnification with 20 to 30 GFP-labeled green cells per field were counted in each condition.
2.6. Quantitative Real-Time PCR (qPCR) Assays Total RNA was extracted from H9c2 cells by using the TRIzol Reagent (Chen H et al., 2013). To evaluate the mRNA expression levels of hypertrophic markers including atrial natriuretic peptide(ANP) and brain natriuretic peptide (BNP), reverse transcription was performed with the iScriptTM cDNA Synthesis Kit (Bio-Rad; Hercules, CA, USA) following the manufacturer’s protocol. GAPDH was used for normalization of the results. The primers sequences (forward and reverse) were as follows: ANP: CAAAGGCTGAGAGAGAAACCA, GCCAGGAAG AGGAAGA A GC; BNP: GAGACAAGAGAGAGCAGGACA, AAAGCAGGAGCAGAATC ATC; GAPDH: TGCCACTCAGAAGACTGTGG, GTCCTCAGTGTAGCCAGGA.
2.7. Western blotting analysis Western blot assay was performed following the method described previously (Chen H et al., 2013). H9c2 cells were lyzed at 4°C and then the supernatants collected after centrifugation. The protein concentration was measured by Bradford assay (Bio-Rad). Protein lysate was loaded on and separated by the 10% or 12% SDS-PAGE, and then transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were probed with antibodies against caspase3, LC3B, p-ERK, ERK, p-p38, p-38, p-JNK, JNK and β-actin, respectively. Signals were amplified and observed with horseradish peroxidase (HRP)-conjugated secondary antibody (Santa Cruz, CA, U.S.A., 1:1000 dilution) and enhanced chemiluminescence. An ECL Western Blot Detection System (EMD Millipore, MA, U.S.A.) was used to detect
densitometry. All experiments were repeated at least three times.
2.8. Statistical analysis Results were presented as mean ± SEM. Comparisons were performed by using unpaired Student’s t test and groups of three or more were analyzed by using one-way ANOVA, followed by the Newman-Keuls multiple comparison tests. A P value<0.05 was considered statistically significant.
Results
3.1. Cytotoxic effects of cucurbitacin-I on cultured H9c2 cardiomyoblasts To evaluate the cytotoxicity of cucurbitacin-I in cultured H9c2 cells, the viability of the H9c2 cells was tested via Celigo® system after treatment with different concentrations of cucurbitacin-I for 48 h. As shown in Fig. 2A, cucurbitacin-I triggered cell mortality significantly at 0.3-1 μM, with a gradually increase in cell mortality of 1.93-fold, 5.06-fold, and 7.22-fold, compared with the control cells (all P < 0.01), respectively. To get more insights into the H9c2 cell death by cucurbitacin-I, effect of cucurbitacin-I on H9c2 cell apoptosis and secondary necrosis were investigated by flow cytometry. As shown in the right lower quadrant and upright quadrant, treatment of Cu-I at 0.3-1 μM resulted in a significant increase in FITC+PI+ and FITC+ cell population (7.31%, 7.90% and 17.47%, respectively), whereas very few Annexin-V and PI positive (FITC+PI+, late phase apoptosis and necrosis) and Annexin-V positive (FITC+, early phase apoptosis) cells were detected in control cultures (2.22%) (Fig. 2B and 2C). These results indicate that cytotoxic actions of cucurbitacin-I on H9c2 cells in a concentration-dependent manner. Therefore, cucurbitacin-I at a concentration of 0.3 μM was employed for further experimentation to assess its impact on H9c2 cells.
3.2.Cucurbitacin-I induces hypertrophic responses in H9c2 cardiomyoblasts The hypertrophic response of cardiomyocytes is characterized by an augmented cell size and the induced expression of hypertrophic markers, such as ANP and BNP (Chen H et al., 2013). In order to verify whether cucurbitacin-I induces cardiomyocyte hypertrophy, we cultured H9c2 cells for 48 h with or without cucurbitacin-I treatment. H9c2 cells were visualized with an inverted microscope after treatment with cucurbitacin-I at different concentrations (Fig. 3A). Compared with the control cells, H9c2 cell surface area was notably increased by 1.52-fold and 2.90-fold at 0.1 μM and 0.3 μM, respectively (both P< 0.01, Fig. 3B). Furthermore, real time-PCR assay indicated that cucurbitacin-I treatment (0.3μM) markedly elevated both ANP and BNP mRNA levels in H9c2 cells (Fig. 3C and 3D). To get more insights into the cucurbitacin-I-induced hypertrophic responses in H9c2 cells, we further investigated the cell surface area after staining with Alexa Fluor 488-conjugated WGA. We observed that 0.1 and 0.3 μM (but not 0.01 μM) cucurbitacin-I treatments significantly induced larger cell surface area by 1.41-fold and 2.90-fold (both P<0.01), respectively, compared with DMSO-treated control cells (Fig. 3E and 3F). Collectively, these results showed that cucurbitacin-I induced hypertrophic responses in cardiomyoblasts in a concentration-dependent manner.
3.3. Cucurbitacin-I deteriorates cardiac hypertrophy in H9c2 cardiomyoblasts through activation of autophagy We examined the activation of autophagy and apoptosis induced by cucurbitacin-I exposure. As shown in Fig.4A and 4B, the ratios of LC3-II/β-actin in H9c2 cells gradually increased by increasing cucurbitacin-I concentrations from 0.01 to 0.3 μM (3.91-fold, P< 0.01) compared with control cells. To further reveal the functional relationship between cucurbitacin-I and apoptosis, we detected active caspase-3 levels.
As shown in Fig. 4C, after being treated with cucurbitacin-I at concentrations of 0.1 and 0.3 μM , cleaved caspase 3 levels of H9c2 cells markedly increased resulting in the elevated cleaved caspase-3/β-actin ratios to 24.11% (P<0.05) and 57.22% (P<0.01), respectively, by comparing with control cells. Interestingly, when we used an autophagy inhibitor 3-MA (10 mM) to block the augmented autophagy levels induced by cucurbitacin-I, the significant decrease in surface area of H9c2 cells was observed (Fig. 4D-H). Compared with H9c2 cells treated with 0.3 μM cucurbitacin-I alone, cells pre-incubated with 10mM 3-MA for 30 min and then co-incubated with 0.3 μM cucurbitacin-I for 48h showed a decrease in LC3-II/β-actin ratio by 56.91% (P<0.01, Fig. 4D and 4E), in cleaved caspase-3/β-actin ratio by 54.62% (P<0.01, Fig. 4F), and in cell surface area by 31.59% (P< 0.05, Fig. 4G and 4H), respectively. Taken together, these results suggested that cucurbitacin-I induced cardiac hypertrophy and apoptosis in an autophagy dependent manner.
3.4. Cucurbitacin-I induces considerable activation of MAPK signaling pathway in H9c2 cardiomyoblasts The onset of cardiac hypertrophy essentially depends upon activation of MAPKs, including ERK1/2, JNK, and p38 kinases (Liang Y and Sheikh F, 2016). Thus, we examined the MAPK activation induced by cucurbitacin-I in H9c2 cells by detecting the levels of phosphorylated MAPKs. As shown in Fig. 5A-D, after 48 hours of incubation with 0.3 μM cucurbitacin-I, the ratios of phosphorylated ERK1/2, JNK and p38 MAPK to total MAPKs in H9c2 cells were increased with 1.37-fold, 1.08-fold, and 0.44-fold, respectively, by comparing with those in control cells (all P<0.01). Our results indicated that cucurbitacin-I exposure strongly activated MAPKs in H9c2 cells.
3.5. The ERK inhibitor U0126 supplementation suppresses both autophagy and apoptosis induced by Cucurbitacin-I exposure in
H9c2 cardiomyoblasts To further reveal which MAPK subfamily, ERK1/2, JNK or p38 kinase, was involved in cucurbitacin-I-induced autophagy and cell apoptosis, we detected autophagy levels and apoptosis in H9c2 cells in the presence of pharmacological inhibitors of the three MAPK family members. 20 μM U0126 (a specific MEK/ERK1/2 inhibitor) was pre-incubated with H9c2 cells for 1 h, and then cucurbitacin-I (0.3 μM) was added for another 48 h. Our results showed notably reduced cell apoptosis and cucurbitacin-I-stirred LC3-II conversion (Fig.6A), with decrease in cleaved caspase-3/β-actin ratios by 19.73% (P<0.05) and LC3-II/β-actin ratios by 47.3% (P<0.01), compared with cells challenged by 0.3 μM cucurbitacin-I alone, respectively. However, pre-incubation with a special p38 MAPK inhibitor, SB203580 (20 μM), or a special JNK inhibitor, SP600125 (20 μM), showed no obvious effect on cucurbitacin-I -induced autophagy and cell apoptosis in H9c2 cells, compared with cucurbitacin-I alone treated cells (Fig.6B and 6C). These results suggested that cucurbitacin-I-stirred ERK activation played an important role in its induction of autophagy and apoptosis in cardiomyocytes.
3.6. Inhibition of MEK/ERK1/2 signaling attenuated the autophagy and hypertrophy induced by cucurbitacin-I exposure in H9c2 cardiomyoblasts MEK/ERK1/2 signaling pathway has been suggested to participate in the regulation of autophagy (Lorenz K et al., 2009) and cardioprotection (Lips DJ et al., 2004). We further examined the hypothesis that the suppression of cucurbitacin-I-stimulated MEK/ERK1/2 signaling pathway might help to alleviate cucurbitacin-I-induced cardiac hypertrophy by reducing the autophagy. GFP-LC3 is a marker for autophagic membranes, which allows the direct visualization of autophagy in cells (Pugsley HR, 2016). After transient transfection of a pEGFP-LC3 plasmid into H9c2 cells, we observed that the control and U0126 alone treated cells exhibited diffused and weak
LC3 punctate dots in the cytoplasm, while 0.3 μM cucurbitacin-I treatment alone induced numerous bright green LC3 punctate dots in the cytoplasm, with a significant increase in average number of GFP-LC3 dots per cell by 36.92% (P<0.01) compared with control cells (Fig.7A-C). Furthermore, we investigated the cell size and the mRNA expression levels of ANP and BNP to confirm the effect of U0126 on cucurbitacin-I-induced hypertrophic H9c2 cells. The cell surface area was investigated by staining with Alexa Fluor 488-conjugated WGA. Our data indicated that the surface area of cells treated with 0.3 μM cucurbitacin-I alone is 3.5-fold larger than control cells treated with DMSO (P<0.01). Furthermore, the U0126 supplementation remarkably decreased the cell surface area, with 39.33% less than that of cells treated with cucurbitacin-I alone (P< 0.05, Fig. 7D and 7E). In addition, 0.3 μM cucurbitacin-I treatment alone induced the mRNA expression levels of both ANP and BNP, with a significant increase by 4.79-fold and 6.67-fold (P< 0.01, Fig.7F and 7G), compared with the control cells, respectively. U0126 pre-incubation and then co-incubation with Cu-I (0.3 μM) significantly decreased the mRNA expression levels of ANP and BNP, with a decrease of 40.31% and 34.84% (both P< 0.05, Fig.7F and 7G), compared with cucurbitacin-I treatment alone cells, respectively. These findings indicated that cucurbitacin-I induced cardiac hypertrophy and apoptosis through a MEK/ERK1/2 signaling pathway.
Discussion Cardiovascular toxicity is a potential short- or long-term complication of various anticancer therapies (Curigliano G et al., 2012; Stortecky S and Suter TM, 2010). With recent advances in cancer chemotherapy and consequent improvements in cancer survival, drug induced toxicity to the heart has assumed greater importance (Saijo N et al., 2003; Stortecky S and Suter TM, 2010; Adão R et al., 2013). Our findings indicated that cucurbitacin-I induced cardiac hypertrophy and cell death (including apoptosis) in H9c2 myoblasts, which was comparable with the action of doxorubicin in H9c2 cells (Merten KE et al., 2006). H9c2 myoblasts was isolated and
established by selective passaging from BDIX rat heart tissue (Hescheler J et al., 1991). Watkins and colleagues (Watkins SJ et al., 2011) observed that H9c2 cells showed almost identical hypertrophic responses to those observed in primary cardiomyocytes. Therefore, these results suggested that clinical application of cucurbitacin-I for tumor therapy might associate with potential cardiotoxicity, including hypertrophy and cardiomyocyte death. Cardiac hypertrophy is an adaptive response to a wide array of intrinsic and extrinsic stimuli (Shimizu I and Minamino T, 2016). It is characterized by an increase in protein synthesis, sarcomeric reorganization and re-expression of fetal regulatory genes (Li Z et al., 2015; Shimizu I and Minamino T, 2016). Prolonged pathological cardiac hypertrophy is a major cardiovascular endpoint and is strongly associated with arrhythmias, heart failure and sudden death (Shimizu I and Minamino T, 2016; Stevens SM et al., 2013). It was the first time for us to uncover a dose-dependent side effect of cucurbitacin-I, the cardiotoxicity, by inducing cardiac hypertrophy, which has been associated with morphological changes leading to increases in cell size and death (including apoptosis). Because the re-induction of the fetal cardiac gene program is known to be a hallmark of cardiomycyte hypertrophy, we further investigated the effects of cucurbitacin-I on the mRNA expression of the ANP and BNP genes, (Shimizu I and Minamino T, 2016). Our findings indicated that 0.3 μM cucurbitacin-I induced significant increase in both ANP and BNP mRNA expression. However, the details of molecular pathways associated with cucurbitacin-I-induced cardiotoxicity in H9c2 cells are still open for further investigation. Autophagy is an evolutionarily conserved dynamic self-degradative process necessary for the maintenance of cellular homeostasis (Anding AL and Baehrecke EH, 2015). Experienced regulation of autophagy protects heart from various physiological and pathological stimuli via degrading and recycling of protein aggregates, lipid drops, or dysfunctional organelles (Zhenhua Li et al., 2015). LC3-II is localized in both the outer and inner membranes of the autophagosome, and usually utilizes as a special autophagosome marker (Pugsley HR, 2016). Tracking the conversion of LC3-I to LC3-II is indicative of autophagic activity (Li Z et al., 2015; Pugsley HR, 2016). We
observed that cucurbitacin-I induced strong autophagy in H9c2 cells in a concentration-dependent manner and parallel with the increase in H9c2 cell apoptosis, which was comparable with those reported by Yuan G (Yuan G et al., 2014) and Zhang T (Zhang T et al., 2012) et al., their studies showed cucurbitacin I stirred robust autophagy in cancer cells. These results suggested that cucurbitacin-I might induce strong autophagy and apoptosis in cardiac tissues when it is used in anti-tumor therapy in clinical oncology patients. We further evaluated the role of cucurbitacin-I -induced autophagy in cardiomyocyte hypetrophy and apoptosis by the use of 3-MA, an autophagy inhibitor. Compared with cucurbitacin-I treatment alone cells, 3-MA pre-incubation and then co-incubation with cucurbitacin-I notably reduced the cucurbitacin-I-induced autophagy level, and associating with a significant decrease in both cell size and apoptosis. These results indicated that cucurbitacin-I induced a detrimental autophagy in cardiomyocytes, which was closely related to the induction of hypertrophic and apoptotic phenotypes. Although STAT3 has been identified as a new autophagy regulator (Jonchère B et al., 2013), Zhang T et al. (Zhang T et al., 2012) observed that cucurbitacin-I induced strong autophagy in cancer cells in a STAT3-independent way. So we further investigated the role of a conventional or classical signaling pathway that regulates cardiac hypertrophy, MAPKs (Liang Y and Sheikh F, 2016; Zhang W et al., 2003). The MAPK signaling pathway consists of three major members, including ERK, JNK and p38 MAP kinase, which are mainly activated by stress type stimuli (Zhang W et al., 2003). JNK and p38 play a vital role in the induction of the cardiac hypertrophy (Zhang W et al., 2003). Although ERK1/2 provides critical protective effects/signals during stress-stimulation (Abdel-Daim M et al., 2010), it is not absolutely necessary for mediating cardiac hypertrophy (Zhang W et al., 2003; Kehat I and Molkentin JD, 2009).We observed that all three members of MAPKs were activated in H9c2 cells with exposure to cucurbitacin-I. However, only the blockage of ERK1/2 signaling pathway, but not the JNK and p38 MAPK, weakened the induction of cucurbitacin-I in autophagy, hypertrophy and apoptosis. Accumulating evidences have revealed that ERK1/2 induced autophagy in response to various anti-cancer/cytotoxic agents, like
the ways of soyasaponins in colon cancer cells, capsaicin in breast cancer cells and cadmium in mesangial cells (Sridharan S et al., 2011). Our results indicated that as a new anti-tumor drug, cucurbitacin-I induced autophagy, hypertrophy and apoptosis in cardiomyocytes through the activation of ERK1/2 signaling pathway. Both autophagy and apoptosis are well-controlled biological processes that play critical roles in tissue homeostasis and diseases (Nikoletopoulou V et al., 2013). Similar stimuli usually induce a complicated cross-talk between autophagy and apoptosisis (Gump JM and Thorburn A, 2011). In particular cases, excessive autophagy or autophagy-relevant proteins may contribute to cause apoptosis (Gump JM and Thorburn A, 2011). Our results suggested that cucurbitacin-I-induced cardiotoxicity was characterized by stirring a strong autophagy in cardiomycytes, which was parallel with the cell damage, hypertrophic and apoptotic phenotypes. Furthermore, ERK signaling inhibition significantly weakened the cucurbitacin-I-induced autopahgy, hypertrophy and apoptosis, which revealed an ERK-autophagy dependent pathway. In summary, as shown in Figure 8, the principal finding of this study was that the autophagy stirred by cucurbitacin-I through the ERK pathway is involved in its cardiotoxicity, including cardiomyocyte hypertrophy and apoptosis. These findings provide advantageous insights for the development of efficacious cancer therapies with lower cardiotoxicity by combining with ERK1/2 signaling inhibition, which might represent a promising treatment avenue with higher efficacy for cancer patients. Conflict of interest All the co‐authors have read the manuscript carefully and approved its submission to TOXICOLOGY LETTERS. This work was supported by the National Natural Science Foundation of China (31071001, 31271226 and 81670249 to Dr. Wei Jiang. A statement on potential conflicts of interest: NONE. Disclaimers: NONE.
Acknowledgements This work was supported by the National Natural Science Foundation of China (31071001, 31271226 and 81670249 to Dr. W Jiang). We would like to thank Dr Zengliu Su for language assistance. The authors have no competing financial interests to declare.
References Abdel-Daim M, Funasaka Y, Komoto M, Nakagawa Y, Yanagita E, et al. Pharmacogenomics of metabotropic glutamate receptor subtype 1 and in vivo malignant melanoma formation. Journal of Dermatology. 2010; 37: 635-646. Adão R, de Keulenaer G, Leite-Moreira A et al. Cardiotoxicity associated with cancer therapy: Pathophysiology and prevention. Rev Port Cardiol. 2013 May; 32(5):395-409. Alghasham AA. Cucurbitacins - a promising target for cancer therapy. Int J Health Sci (Qassim). 2013 Jan; 7(1):77-89. Anding AL, Baehrecke EH. Autophagy in Cell Life and Cell Death. Curr Top Dev Biol. 2015; 114:67-91. doi: 10.1016/bs.ctdb.2015.07.012. Epub 2015 Sep 9. Chan LL, Smith T, Kumph KA, Kuksin D, Kessel S, Déry O, Cribbes S, Lai N, Qiu J.A high-throughput AO/PI-based cell concentration and viability detection method using the Celigo image cytometry. Cytotechnology. 2016 Aug 3. DOI: 10.1007/s10616-016-0015-x. [Epub ahead of print] Chen H, Wang X, Tong M, Wu D, Wu S, Chen J, Wang X, Wang X, Kang Y, Tang H, Tang C, Jiang W. Intermedin suppresses pressure overload cardiac hypertrophy through activation of autophagy. PLoS One. 2013 May 29; 8(5):e64757. doi: 10.1371/journal.pone.0064757. Print 2013. Chen X, Bao J, Guo J, Ding Q, Lu J, Huang M, Wang Y. Biological activities and potential molecular targets of cucurbitacins: a focus on cancer. Anticancer Drugs. 2012 Sep; 23(8):777-87. doi: 10.1097/CAD.0b013e3283541384. Curigliano G, Cardinale D, Dent S, Criscitiello C, Aseyev O, Lenihan D, Cipolla CM. Cardiotoxicity
of
anticancer
treatments:
Epidemiology,
management.CA Cancer J Clin. 2016 Jul; 66(4):309-25.
detection,
and
Curigliano G, Cardinale D,Suter T et al. Cardiovascular toxicity induced by chemotherapy, targeted agents and radiotherapy: ESMO Clinical Practice Guidelines. Ann Oncol. 2012 Oct;23 Suppl 7:vii155-66; Double J, Barrass N, Barnard ND, Navaratnam V. Toxicity testing in the development of anticancer drugs. Lancet Oncol. 2002 Jul; 3(7):438-42. Gump JM, Thorburn A. Autophagy and apoptosis: what is the connection? Trends Cell Biol. 2011 Jul; 21(7):387-92. doi: 10.1016/j.tcb.2011.03.007. Epub 2011 May 10. Hescheler J, Meyer R, Plant S, Krautwurst D, Rosenthal W, Schultz G. Morphological, biochemical, and electrophysiological characterization of a clonal cell (H9c2) line from rat heart. Circulation Research (1991)1476-1486. Ho CH, Ho MG, Ho SP, Ho HH. Bitter bottle gourd (Lagenariasiceraria) toxicity. J Emerg Med. 2014 Jun; 46(6):772-5. doi: 10.1016/j.jemermed.2013.08.106. Epub 2013 Dec 17. Huitink JM, Teoh WH. Current cancer therapies - a guide for perioperative physicians. Best Pract Res Clin Anaesthesiol. 2013 Dec; 27(4):481-92. Jonchère B, Bélanger A, Guette C, Barré B, Coqueret O. STAT3 as a new autophagy regulator. JAKSTAT. 2013 Jul 1; 2(3):e24353. doi: 10.4161/jkst.24353. Kehat I, Molkentin JD. Extracellular signal-regulated kinase 1/2 (ERK1/2) signaling in cardiac hypertrophy. Ann N Y Acad Sci. 2010 Feb; 1188:96-102. doi: 10.1111/j.1749-6632.2009.05088.x. Lee DH, Iwanski GB, Thoennissen NH. Cucurbitacin: ancient compound shedding new light on cancer treatment. Scientific World Journal. 2010 Mar 5; 10: 413-8. Li DL, Hill JA. Cardiomyocyte Autophagy and Cancer Chemotherapy. J Mol Cell Cardiol. 2014 Jun; 71:54-61; Li Z, Wang J, Yang X. Functions of autophagy in pathological cardiac hypertrophy. Int J Biol Sci. 2015 Apr 27; 11(6):672-8. doi: 10.7150/ijbs.11883. Liang Y, Sheikh F. Scaffold Proteins Regulating Extracellular Regulated Kinase Function in Cardiac Hypertrophy and Disease. Front Pharmacol. 2016 Feb 29;7:37. doi: 10.3389/fphar.2016.00037. eCollection 2016.
Lips DJ, Bueno OF, Wilkins BJ et al. MEK1-ERK2 signaling pathway protects myocardium from ischemic injury in vivo. Circulation 109 (2004 )1938-1941; Lorenz K, Schmitt JP, Vidal M, Lohse MJ. Cardiac hypertrophy: targeting Raf/MEK/ERK1/2-signaling.Int J Biochem Cell Biol. 2009 Dec; 41(12):2351-5. doi: 10.1016/j.biocel.2009.08.002. Merten KE, Jiang Y, Feng W, Kang YJ. Calcineurin Activation Is Not Necessary for Doxorubicin-Induced Hypertrophy in H9c2 Embryonic Rat Cardiac Cells: Involvement of the Phosphoinositide 3-Kinase-Akt Pathway. J Pharmacol Exp Ther. 2006 Nov; 319(2):934-40; Nikoletopoulou V, Markaki M, Palikaras K, Tavernarakis N.Crosstalk between apoptosis, necrosis and autophagy. Biochim Biophys Acta. 2013 Dec; 1833(12):3448-59. doi: 10.1016/j.bbamcr.2013.06.001. Pugsley HR. Quantifying autophagy: Measuring LC3 puncta and autolysosome formation in cells using multispectral imaging flow cytometry. Methods. 2016 Jun 1. pii: S1046-2023(16)30155-4. doi: 10.1016/j.ymeth.2016.05.022. Ramaswami R, Harding V, Newsom-Davis T. Novel cancer therapies: treatments driven by tumour biology. Postgrad Med J. 2013 Nov; 89(1057):652-8. Saijo N, Tamura T, Nishio K. Strategy for the development of novel anticancer drugs. Cancer Chemother Pharmacol. 2003 Jul; 52 Suppl 1:S97-101. Epub 2003 Jun 18. Shimizu I, Minamino T. Physiological and pathological cardiac hypertrophy. J Mol Cell Cardiol. 2016 Aug; 97:245-62. doi: 10.1016/j.yjmcc.2016.06.001. Epub 2016 Jun 2. Sridharan S, Jain K, Basu A. Regulation of autophagy by kinases. Cancers (Basel). 2011 Jun 9; 3(2):2630-54. doi: 10.3390/cancers3022630. Stevens SM1, Reinier K, Chugh SS.Increased left ventricular mass as a predictor of sudden cardiac death: is it time to put it to the test? Circ Arrhythm Electrophysiol. 2013 Feb; 6(1):212-7. doi: 10.1161/CIRCEP.112.974931. Stortecky S, Suter TM. Insights into cardiovascular side-effects of modern anticancer therapeutics. Curr Opin Oncol. 2010 Jul;22(4):312-7. Wang
X, Wang
XL, Chen
HL
et
al.
Ghrelin inhibits
doxorubicin
cardiotoxicity by inhibiting excessive autophagy through AMPK and p38-MAPK. Biochem Pharmacol. 1 (2014) 334-350; Watkins SJ, Borthwick GM, Arthur HM. The H9C2 cell line and primary neonatal cardiomyocyte cells show similar hypertrophic responses in vitro. In Vitro Cell Dev Biol Anim. 2011 Feb; 47(2):125-31; White E, Mehnert JM, Chan CS.Autophagy, Metabolism, and Cancer.Clin Cancer Res. 2015 Nov 15; 21(22):5037-46. Yuan G, Yan SF, Xue H et al. Cucurbitacin I Induces Protective Autophagy in Glioblastoma in vitro and in vivo. J Biol Chem. 2014 Apr 11; 289(15):10607-19; Zhang
T,Li
Y, Park
KA
et
al.
Cucurbitacin
induces
autophagy throughmitochondrial ROS production which counteracts to limit caspa se-dependent apoptosis. Autophagy 8 (2012) 559-576. Zhang W, Elimban V, Nijjar MS, Gupta SK, Dhalla NS. Role of mitogen-activated protein kinase in cardiac hypertrophy and heart failure. ExpClinCardiol. 2003 Winter;8(4):173-83; Zhenhua Li,Jian Wang, Xiao Yang. Functions of Autophagy in Pathological Cardiac Hypertrophy. Int J Biol Sci. 2015; 11(6): 672–678; Zhu Y, Shi YP, Wu D, Ji YJ, Wang X, Chen HL, Wu SS, Huang DJ, Jiang W. Salidroside protects against hydrogen peroxide-induced injury in cardiac H9c2 cells via PI3K-Akt dependent pathway.DNA Cell Biol. 2011 Oct;30(10):809-19.
Figure captions
Fig.1. Chemical structure of Cucurbitancin-I. Cucurbitacin-I is a natural cell-permeable triterpenoid purified from cucurbitaceae plants. Fig.2. Cytotoxic actions of cucurbitacin-I on cultured H9c2 cardiomyoblasts. H9c2 cells were treated with the indicated concentrations of cucurbitacin-I for 48 h, then the viabilities of H9c2 cells were detected by using a Celigo® system (n=6/group, A), and the cell apoptosis and secondary necrosis were investigated by using a flow cytometry (n=3/group, B and C). All data were represented as mean ± SEM, and analyzed with the one-way ANOVA.**P<0.01 as compared with DMSO-treated groups (controls). Cu-I, cucurbitacin-I. Fig.3. Cucurbitacin-I induces cardiac hypertrophic responses in H9c2 cardiomyoblasts. H9c2 cells were treated with cucurbitacin-I at the indicated concentrations for 48 h. (A) Cells were visualized with an inverted microscope. (B) The cell surface areas were measured by using the NIH Image J software (mean ± SEM, n=100 cells), Scale bars=50μm. (C and D) Real-time PCR analysis for mRNA expression of the hypertrophic markers ANP and BNP after cucurbitacin-I exposure for 48 h (n=4/group). (E) Cells were challenged by the indicated concentrations of cucurbitacin-I for 48 h, and then stained with Alexa Fluor 488-conjugated WGA to visualize the cell membrane. (F) The cell surface areas were measured by using the NIH Image J software (mean ± SEM, n = 100 cells). Scale bars = 20μm. Data were expressed as fold changes ± SEM vs. the control group, and analyzed with the one-way ANOVA. **P<0.01. Cu-I, cucurbitacin-I. Fig.4. Cucurbitacin-I induces hypertrophy and apoptosis in H9c2 cardiomyoblasts through activation of autophagy. (A) LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with cucurbitacin-I treatments at the indicated concentrations for 48h. (B and C) Densitometric analysis showed that Cu-I treatments gradually increased the ratios of LC3II/β-actin and cleaved-caspase-3/β-actin in a concentration-dependent manner (n=3/group). (D) LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with 0.3μM Cu-I incubation in the absence and presence of 10 mM 3-MA (pre-incubated for 30 min) for 48 h. (E and F) Densitometric analysis (n=3/group) showed that 3-MA attenuated the induction of Cu-I on autophagy (LC3II/β-actin ratios) and apoptosis (cleaved-caspase-3/β-actin ratios). (G) H9c2 cells were treated with 0.3μM Cu-I in the absence and presence of 10 mM 3-MA for 48 h, then the cell membrane was stained
with Alexa Fluor 488-conjugated WGA. (H) The cell surface areas were measured by the NIH Image J software (mean ± SEM, n = 100 cells). Scale bars = 20μm. The western assay data were represented as mean ± SEM, and the cell surface area data were expressed as fold changes ± SEM vs. the control group, and then statistically analyzed with One-Way ANOVA. *P<0.05, **P<0.01. Cu-I, cucurbitacin-I; 3-MA, 3-methyladenine. Fig.5. Cucurbitacin-I activates MAPK signaling pathways in H9c2 cardiomyoblasts. H9c2 cells were treated with Cu-I at the indicated concentrations for 48h. (A) H9c2 cells extracts (35μg) were received to Western blot analysis of MAPK (ERK1/2, JNK, and p38) proteins expression levels. (B, C and D) Densitometric analysis(n=5/group) showed that 0.3 μM Cu-I exposure notably increased the ratios of p-ERK/ERK, p-JNK/JNK and p-p38/p38, respectively. All data were represented as mean ± SEM, and analyzed with one-way ANOVA.**P<0.01. Cu-I, cucurbitacin-I. Fig.6. The ERK inhibitor U0126 supplementation decreases both autophagy and apoptosis induced by cucurbitacin-I exposure in H9c2 cardiomyoblasts. (A) p-ERK, ERK, LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with an ERK inhibitor, U0126 (20μM), pre-incubation for 1 h and then co-incubation with 0.3 μM cucurbitacin-I for another 48h. Densitometric analysis showed that U0126 supplementation remarkably suppressed Cu-I-induced increase in the ratios of both LC3II/β-actin and cleaved-caspase-3/β-actin. (B) p-p38, p38, LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with a p-38 inhibitor, SB203580 (SB, 20μM), pre-incubation for 1 h and then co-incubation with 0.3 μM cucurbitacin-I for another 48h. Densitometric analysis showed that SB supplementation had no obvious effect on Cu-I-induced LC3II/β-actin ratios and cleaved-caspase-3/β-actin ratios.(C) p-JNK, JNK, LC3I, LC3II, capase3 and β-actin protein levels were evaluated by immunoblotting in H9c2 cells with a JNK inhibitor, SP600125 (SP, 20μM), pre-incubation for 1 h and then co-incubation with 0.3 μM cucurbitacin-I for another 48h. Densitometric analysis showed that SP supplementation had no obvious effect on Cu-I-induced LC3II/β-actin ratios and cleaved-caspase-3/β-actin ratios. All data are expressed as mean ± SEM (n=3/group), and analyzed with one-way ANOVA, *P<0.05, **P<0.01. Cu-I, cucurbitacin-I; SB, SB203580; SP, SP600125; NS, no significant. Fig.7. MEK/ERK1/2inhibition suppresses the induction of cucurbitacin-I exposure on autophagy and hypertrophy in H9c2 cardiomyoblasts. (A) Representative fluorescence images show the effect of ERK inhibition (20μM U0126 supplementation) on the appearance of a punctate GFP-LC3 signal stirred by 0.3 μM cucurbitacin-I treatment in H9c2 cells which were transfected with a pEGFP-LC3 plasmid. Positive signals were defined as those cells that had five or more GFP-LC3 dots in the cytoplasm, and positive cells were analyzed from at least
100 random fields at 48h. (B) The average number of GFP-LC3 dots per cell. (C) The percentage of the cells with GFP-LC3 dots. (D) Cells were pre-incubated with an ERK inhibitor, U0126 (20μM), for 1 h and then co-incubated with 0.3μM cucurbitacin-I for another 48 h, and then stained with Alexa Fluor 488-conjugated WGA to visualize the cell membrane. (E) The cell surface areas were measured by using the NIH Image J software (mean ± SEM, n=100 cells), Scale bars=20μm. (F and G) Real-time PCR assay was performed to evaluate the hypertrophic markers ANP and BNP mRNA expression in H9c2 cells with 0.3 μM cucurbitacin-I treatment in the absence and presence of 20 μM U0126 for 48h (n=3/group). All data are expressed as mean ± SEM, and analyzed with one-way ANOVA, *P<0.05, **P<0.01. Cu-I, cucurbitacin-I. Fig.8. The schematic diagram summarized the signaling pathways modified by cucurbitacin-I to induce the cardiotoxicity. Cartoon of a hypothetical mechanism for cucurbitacin-I to induce cardiomyocyte hypertrophy and death though a MEK/ERK1/2-autophagy signaling pathway. MEK/ERK1/2 inhibition effectively suppresses the autophagy, hypertrophy and apoptosis stirred by cucurbitacin-I exposure in cardiomyocytes.
c