Curcumin prophylaxis refurbishes alveolar epithelial barrier integrity and alveolar fluid clearance under hypoxia

Respiratory Physiology & Neurobiology 274 (2020) 103336

Contents lists available at ScienceDirect

Respiratory Physiology & Neurobiology journal homepage: www.elsevier.com/locate/resphysiol

Curcumin prophylaxis refurbishes alveolar epithelial barrier integrity and alveolar fluid clearance under hypoxia

T

Titto M, Ankit T, Saumya B, Gausal AK, Sarada SKS* Haematology Division, Defence Institute of Physiology and Allied Sciences, Lucknow Road, Timarpur, Delhi 110054, India

ARTICLE INFO

ABSTRACT

Keywords: Tight junctions Alveolar epithelium Hypoxia NF-κB HIF-1α Inflammatory molecule

We have studied the prophylactic efficacy of curcumin to ameliorate the impairment of tight junction protein integrity and fluid clearance in lungs of rats under hypoxia. A549 cells wereexposed to 3 % O2 for 1 h, 3 h, 6 h, 12 h, 24 h and 48 h and rats were exposed to 7620 m for 6 h. NF-κB, Hif-1α and their related genes, tight junction protein (TJ) (ZO-1, JAM-C, claudin-4 and claudin-5, claudin-18) expressions were determined in A549 cells and lungs of rats by western blotting, ELISA and their activity by reporter gene assay, siRNAp65 knock out. Tissue specific localization of tight junction protein was determined by immunohistochemistry and immunoflorescence. Further transmission electron microscopy (TEM) was used to visualize the TJ structures between pulmonary epithelial cells. Blood gas and hematological parameters were also assessed. Later we checked, whether prior treatment with curcumin can restore the altered alveolar epithelial barrier integrity that is compromised through inflammatory mediators under hypoxia, A549 cells were pre-treated (1 h) with 10 μM curcumin and rats with 50 mg curcumin/kg BW and exposed to hypoxia. Curcumin pre-treatment both in vitro and in vivo showed significant changes in TJ protein integrity, attenuated NF-κB activity with reduced expression of its regulatory genes in lung tissues, serum and bronchoalveolar lavage fluid (BALF) along with stabilized HIF-1α levels under hypoxia. NF-κB inhibitors MG132, SN50 or siRNA mediated p65 knock down significantly reduced the dextran FITC influx into the lungs. The present study indicates that, curcumin prophylaxis augments alveolar epithelial barrier integrity and alveolar fluid clearance under hypoxia.

1. Introduction High altitude pulmonary edema (HAPE) is the result of fluid accumulation in the lungs due to disrupted/ impaired alveolar epithelial barrier. Tight Junction (TJ) complex is formed through interactions between several integral membrane proteins viz. claudin, occludin, junctional adhesion molecule (JAM), peripheral proteins like zonular occludens (ZO-1, ZO-2, and ZO-3) along with other junction-associated proteins. Pneumocytes predominantly express zonula occludens (ZO)-1 and several members of the claudin family (Koval, 2009). It has been reported earlier that high-altitude exposure results in increased reactive oxygen species (ROS) generation leading to enhanced oxidative damage to lipids, proteins and DNA (Tibor and Zsolt, 2004) which further disrupt the tight junction integrity by altering claudin-4 expression (Rokkam et al., 2011; Wray et al., 2009). ROS may indirectly cause up regulation of histone acetyltransferase (HAT) activity in respiratory epithelial cells leading to major inflammatory gene transcription (Tomita et al., 2003). The cytokines viz. IL-1, IL-4, IL-10, IL-13, TNF-α

and IFN-γ were found to regulate the TJ of both epithelia and endothelia (Youakim and Ahdieh, 1999; Oshima et al., 2001) causing paracellular permeability. A recent study demonstrated that ZO proteins are essential for the formation and organization of tight junction complex assembly (Umeda et al., 2006). Therefore, changes in occludin, claudin-5, claudin-4 or ZO-1 are likely to alter endothelial and epithelial permeability in response to inflammatory cytokines. In spite of extensive research, the precise mechanism of action of hypoxia induced pulmonary fluid accumulation is not yet fully elucidated, but most of the studies concur that increased sympathetic tone, increased pulmonary capillary pressure, uneven hypoxic pulmonary vasoconstriction leading to over perfusion of some areas in pulmonary vascular bed, alveolar capillary endothelium leak resulting into interstitial and/or alveolar edema (Patricia et al., 2018; Stream and Grissom, 2008). The treatment includes – descent to lower altitude, administration of O2 and/or nifedipine. The calcium channel blocker nifedipine acts as a vasodilator on both pulmonary and systemic circulation. Tadalafil a phosphodiesterase-5 inhibitor, β2-agonist salmeterol and

Corresponding author at: DIPAS, Lucknow Road, Timarpur, Delhi-54, India. E-mail addresses: [email protected] (T. M), [email protected] (A. T), [email protected] (S. B), [email protected] (G. AK), [email protected] (S. SKS). ⁎

https://doi.org/10.1016/j.resp.2019.103336 Received 13 August 2019; Received in revised form 30 October 2019; Accepted 7 November 2019 Available online 25 November 2019 1569-9048/ © 2019 Elsevier B.V. All rights reserved.

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Table 1 Blood gas variables in hypobaric hypoxia (7620 m for 6 h) exposed rats prior treated with (50 mg n/Kg BW) and without curcumin. Parameter

Normoxia

Hypoxia

Nor + Cur

Hypo + Cur

PaO2 (mmHg) PaCO2 mmHg SaO2 (%) pO2 mmHg SvO2 (%) P(A-a)O2 pH

94.18 ± 2.76 42.01 ± 3.94 98.80 ± 2.18 39.02 ± 3.61 72.65 ± 6.67 22.56 ± 1.12 7.39 ± 0.009

44.85 ± 5.60* 28.64 ± 6.54$ 77.70 ± 4.09* 31.38 ± 4.05# 56.42 ± 8.61* 32.85 ± 2.61* 7.46 ± 0.07

95.78 ± 4.12 44.599 ± 5.41 98.30 ± 1.61 40.06 ± 3.80 71.85 ± 4.05 22.09 ± 2.07 7.40 ± 0.008

92.32 ± 2.86** 46.133 ± 4.05$$ 94.00 ± 3.66** 42.65 ± 2.65# # 74.68 ± 6.07₰₰ 24.49 ± 2.93** 7.39 ± 0.02

PaO2 - arterial oxygen tension; PaCO2 - arterial carbon dioxide tension; SaO2 - arterial oxygen saturation, pO2 - partial pressure of oxygen, SvO2 - venous oxygen saturation, P(A-a) O2 - alveolar- arterial oxygen diffusion difference. Values are mean ± SD (n = 6) per group. *p < 0.001 Norm vs Hypo; # p < 0.05 Norm vs Hypo; $p < 0.01 Norm vs Hypo; **p < 0.01 Hypo vs Hypo + Cur; $ $ p < 0.01 Hypo vs Hypo + Cur; # # p < 0.05 Hypo vs Hypo + Cur; ₰₰ p < 0.01 Hypo vs Hypo + Cur; Norm - Normoxia, Hypo - Hypoxia, Cur - Curcumin.

dexamethasone are also used as HAPE prophylaxis drugs (Patricia et al., 2018). However, there is a contraindication of dexamethasone which disrupts junctional proteins ZO-1 and Cx43 as well as F-actin in human trabecular meshwork (Zhuo et al., 2010). A recent study has noted that the calcium channel blocker nifedipine has no effect on TJ proteins expression and distribution (Brown and Davis, 2002). In our previous studies, we have reported that alveolar epithelial cells exposed to hypoxia triggers an inflammatory cascade mediated through NF-κB (Sarada et al., 2008; Mathew and Sarada, 2015). However, disruption of TJ proteins may eventually lead to fluid buildup in the lungs. Therefore, it is necessary to develop an effective compound with least contraindications. Hence, we postulated that potent antioxidant and anti-inflammatory natural compound ‘curcumin’ might ameliorate the impaired TJ proteins expression and distribution in lung tissue and alveolar epithelial cells (A549 cells) under hypoxia. Curcumin, a yellow pigment extracted from the rhizome of the plant Curcuma longa Linn (Turmeric, Family-Zingiberaceae) has been widely used as a spice, food additive and herbal medicine in Asia. In recent years extensive in vitro and in vivo studies have suggested that curcumin has anti-cancer, anti-viral, anti-arthritic, anti-amyloid, antioxidant, anti-inflammatory and anti-aging properties (Kunnumakkara et al., 2017; Zhou et al., 2011). Curcumin exerts its antioxidant activity in a direct and an indirect way by scavenging reactive oxygen species and therefore induces an antioxidant response with its high bioprotective properties under hypoxia. Several studies have revealed that curcumin can modulate several transcription molecules (viz. nuclear factor kappa B (NF-kB), c-Jun N-terminal kinase (JNK)/Activator protein-1 (AP1), nuclear factor erythroid 2–related factor 2 (Nrf2), etc) cytokines, growth factors and kinases (Julie, 2009; Radha et al., 2006). Earlier reports from our lab had revealed that curcumin is a potential molecule to reduce the oxidative stress and inflammation in hypoxia induced pulmonary edema (Sarada et al., 2014) in rats. Modern science has also documented the important functions of curcumin in intonation of several molecular targets. Curcumin binds and degrades the p50 sub unit of nuclear factor-kB complex (Brennan and O’Neill, 1998) leading to attenuation of NF-κB activity. At high altitude alveolar fluid clearance (AFC) inhibition and disruptions of tight junctions (TJ) under hypoxia likely to contribute enhanced fluid accumulation leading to increased morbidity and mortality in HAPE patients. Although literature reveals that hypoxia exposure disrupts the TJ in AFC, but the time and signaling events involved in their disruption have not been elucidated. Therefore, we set out to determine the time bound effect as well as molecular mechanism of signaling events that are taking place at different hours of hypoxia exposures both in vitro and in vivo. This indeed, addresses a serious problem that generally occurs not only at high altitudes but also in different diseased conditions at sea level as well. In the present study we were interested in finding out (i) the molecular mechanism involved in a cross-talk between hypoxia and inflammation i.e., hypoxia-inducible factor 1 alpha (HIF-1α) vs. nuclear factor kappa B (NF-κB) in causing hypoxia induced pulmonary edema at high altitude (ii) correlation of these two transcriptional factors in

causing tight junction protein disruption leading to increased paracellular transport or leakage in to lungs of rats under hypoxia and also (iii) this study was extended to find out the efficacy of curcumin in maintaining alveolar TJ protein integrity and alveolar fluid clearance under hypoxia. Taken together it is reasonable to hypothesize that TJ disruption and impaired AFC under hypoxia is regulated by inflammatory pathway which might be ameliorated by curcumin prophylaxis. 2. Results 2.1. Impaired alveolar gas exchange under hypoxia is attenuated by curcumin prophylaxis Hypoxia has stimulated a significant fall in partial pressure of oxygen in arterial blood (PaO2) collected from left ventricle of rats (p < 0.05) compared to control animals (normoxia). Consecutively as response to the hyperventilation in these animals; arterial partial pressure of carbon dioxide (PaCO2) was also significantly reduced (p < 0.05). This fall stimulated a shift of pH towards alkalinity in untreated hypoxia exposed animals (Table 1). The most salient finding of this study was that curcumin prophylaxis is able to attenuate this decrease in PaO2, and PaCO2 levels under hypoxia. We further estimated the arterial oxygen saturation (SaO2) which is the indicative of hypoxemia. SaO2 levels in hypoxia exposed animals were significantly (p < 0.001) lowered as compared to curcumin administered hypoxia exposed animals. The mixed venous oxygen pressure (pO2), oxygen saturation (SvO2) and alveolar- arterial oxygen diffusion difference (P(A-a)O2) levels in hypoxia exposed and unexposed animals, treated with and without curcumin was also investigated. We observed that pO2 and SvO2 levels were appreciably decreased under hypoxia compared to normoxia. The fall in levels of venous gas levels under hypoxia were restored by curcumin prophylaxis. The P(A-a)O2 levels are considered as bench mark for monitoring the efficacy of pulmonary gas exchange. The hypoxia exposed animals showed increased P(A-a)O2 as compared to normoxia. The increased level is a clear indication of reduced pulmonary gas exchange. The augmented P(A-a)O2 levels were attenuated by curcumin prophylaxis (p < 0.001) (Table 1). 2.1.1. Haematological analysis Haematological analysis of blood samples in different groups of animals have been summarized in Table 2. There was a significant increase (p < 0.01) in red blood corpuscles (RBC), haemoglobin (Hb), white blood corpuscles (WBC), monocytes, lymphocytes and haematocrit (HCT) levels observed in hypoxia exposed rats over control. Surprisingly rats receiving curcumin (1 h prior to hypoxic exposure, 6 h) under hypoxia showed reduced number (p < 0.01) of WBC, monocytes and lymphocytes compared to 6 h hypoxia exposed rats without curcumin supplementation. However Hb, RBC and HCT continued to remain higher even after curcumin administration under hypoxia. 2

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Table 2 Effect of hypoxia on haematological analysis in rats exposed to hypoxia at 7620 m for 6 h, prior treated with (50 mg/Kg BW) and without curcumin. Parameters 3)

RBC (million/mm Hb (g/dl) WBC (millionc/mm3) Monocytes (%) Lymphocytes (%) HCT (%)

Normoxia

Hypoxia

Nor + Cur

Hypo + Cur

5.80 ± 0.22 11.90 ± 0.56 9.12 ± 0.37 2.87 ± 0.09 67.09 ± 1.68 39.84 ± 0.77

7.06 ± 0.21* 13.52 ± 2.67* 13.74 ± 1.50* 6.54 ± 0.96** 74.70 ± 5.60* 43.92 ± 2.01*

5.78 ± 0.69 12.72 ± 0.75 8.68 ± 0.64 3.10 ± 0.41 67.09 ± 4.18 41.30 ± 2.63

7.12 ± 0.95NS 14.86 ± 1.20# 9.70 ± 1.41# 3.49 ± 0.54$ 68.30 ± 7.86$ 54.90 ± 4.67$

WBC - white blood cells (millionc/mm3); RBC - red blood cells (million/mm3); lymphocytes, monocytes expressed in %; Hb - hemoglobin (g/dl); Hct - hematocrit (%). Values are mean ± SD (n = 6) per group. *p < 0.01 Norm vs Hypo; **p < 0.001 Norm vs Hypo; $p < 0.01 Hypo vs Hypo + Cur (6 h hypoxia); #p < 0.05 Hypo vs Hypo + Cur; NS - Non - significant. Norm - Normoxia; Hypo - Hypoxia; Cur - Curcumin.

Fig. 1. Effect of hypoxia on TJ protein expression in A549 cells. A549 cells exposed to hypoxa (3 % O2) for different time periods (i.e. 0 h (Normoxia), 1 h, 3 h, 6 h, 12 h, 24 h and 48 h hypoxia exposure). (A) Representing Western blot analysis of (a) NF-κB (b) TNF-α (c) ZO-1 (d) claudin-4 (e) claudin-5 and (f) occludin from A549 cells lysate. (B) Representing the densitometry analysis of NF-κB, TNF-α, ZO-1, claudin-4, claudin-5 and occludin. The data is representative blots from 3 to 4 independent experiments from A549 cells. *P < 0.001 Normoxia vs Hypoxia. Nor - Normoxia.

2.2. Effect of hypoxia on alveolar tight junction proteins (in vitro study)

protein integrity is lost due to reduced claudin-4 and occludin protein expressions followed by enhanced claudin -5 protein expressions leading to fluid buildup in the lungs.

We observed that, when A549 cells were exposed to different hours of hypoxia showed a gradual increase in the expression of NF-κB (Fig. 1. A. a) and one of its regulated genes TNF-α (Fig. 1.A. b) followed by decreased expression of ZO-1, claudin-4 and occludin proteins compared to control (Fig. 1. A. c, d and f). However, we observed that claudin-5 expression (Fig. 1. A. e) gradually increased from 1 h to 48 h of hypoxic exposure, being maximum at 6 h of hypoxia exposure compared to control. The increased expression of ZO-1 at 48 h probably might be due to the reason that the cells tried to increase ZO-1 protein levels to cope up with the hypoxic stress, but could not sustain as it is evidenced (Fig. 12) form the increased alveolar permeability from 1 h to 48 h under hypoxia. It is a general fact that, every cell tries to survive under hypoxic conditions. The increased expression of claudin-5 at 6 h of hypoxia exposure indicates the probable reason of abrupt increase in alveolar epithelial barrier permeability between 6 h–12 h of hypoxic stress. Although the ZO-1 protein expression was started reducing right from 1 h to 24 h and later the cells tried to enhance it, but this increased expression of ZO-1 at 48 h is not sufficient to prevent the increased alveolar epithelial barrier permeability because the other tight junction

2.3. Efficacy of curcumin in modulating the cytokines levels in BALF and sera 2.3.1. Pro-inflammatory cytokines To confirm whether the decreased NF-κB expression also resulted into reduced pro-inflammatory cytokines under curcumin prophylaxis, we analyzed the pro-inflammatory cytokines like interleukin-6 (IL-6), tumor necrosis factor alpha (TNF-α), and interferon gamma (IFN-γ) levels by enzyme-linked immunosorbent assay (ELISA) in BALF and sera samples. We observed that there was a significant increase in IL-6 and TNF-α, IFN-γ and interleukin -2 (IL-2) levels in BAL fluid and sera of rats under hypoxia as compared to the control (normoxia). Prior treatment with curcumin and exposed to hypoxia showed substantial decrease in TNF-α, IL-6, IFN-γ and IL-2 levels in sera and BALF of rats over control (Hypoxia, 6 h). However, normoxia animals receiving curcumin showed unmodified cytokines levels (TNF-α, IL-2, IL-6 and IFN-γ) from sera and BAL fluid of rats (Fig. 2. a, b, c & d). 3

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Fig. 2. Pro-inflammatory cytokines levels in sera and BALF of rats exposed to hypoxia at 7620 m for 6 h. Serum/ BALF samples from treated and controls were ex vivo analyzed for the presence of cytokines by capture ELISA. Hypoxia exposure altered the cytokine levels between the groups. Scatter plots showing levels of (a) TNF-α, Sera- *p < 0.01 Nor vs Hypo and Hypo vs Hypo + Cur ; BALF *p < 0.001 Nor vs Hypo and Hypo vs Hypo + Cur (b) IL-2, Sera-*p < 0.01 Nor vs Hypo, #p < 0.05 Hypo vs Hypo + Cur; BALF- *p < 0.01 Nor vs Hypo and Hypo vs Hypo + Cur (c) IL-6, Sera- *p < 0.01 Nor vs Hypo and Hypo vs Hypo + Cur ; BALF- *p < 0.001 Nor vs Hypo and Hypo vs Hypo + Cur (d) IFN-γ, Sera- * p < 0.05 Nor vs Hypo ; #p < 0.001 Hypo vs Hypo + Cur; BALF- *p < 0.05 Nor vs Hypo and Hypo vs Hypo + Cur Values are mean ± SD. (n = 6). Two-way ANOVA with Turkey's Multiple comparison Test was conducted to determine potential statistical difference. Nor vs Nor + Cur is non-significant (Not shown in graph). The lines represent median lines. Nor – Normoxia, Hypo- Hypoxia and Cur - Curcumin.

2.3.2. Anti-inflammatory cytokines There was a significant decrease in IL-10, IL-4 and TGF-β levels (p < 0.001) in BAL fluid as well as sera from rats exposed to hypoxia over control (normoxia). Prior administration of curcumin to rats and exposed to hypoxia resulted into significant increase in expression levels of IL-10, IL-4 (p < 0.01) and TGF-β (p < 0.001) over control (6 h Hypoxia exposure). However, animals supplemented with curcumin under normoxia showed non-significant expression of TGF-β, IL-4 and IL-10 levels in BAL fluid and sera samples (Fig. 3. a, b & c).

treatment even in absence of hypoxia needs further investigation. In contrast to the JAM-C expression pattern to A549 cells, we observed higher protein expression of JAM-C under hypoxia which was mitigated by curcumin prophylaxis. Fascinatingly curcumin (50 mg/kg BW) administered 1 h before hypoxic exposure resulted in augmented protein expression levels of ZO-1, claudin-4 and occludin with adequate levels of claudin-5 and JAM-C (Fig. 5. A. a, c, e, d and b respectively). Apart from the western blot analysis, we have also performed RTPCR expression of tight junction proteins under hypoxia at mRNA level. mRNA expression of zo-1 gene in lungs of rats under hypoxia found to be decreased compared to control (Fig. 5. B. i). Concurrently, curcumin treated animals showed augmented expression of zo-1 gene under hypoxia. However, to our surprise we observed that, zo-1 gene levels were higher in lung tissues of rats treated with curcumin under normoxia compared to control (Fig. 5. B. i). The reason for the increase in zo1gene levels is not known at present in this study. The expression levels of jam-c and claudin-5 increased under hypoxia as compared to their respective controls (Fig. 5. B. ii and iv). Rats receiving curcumin 1 h prior to hypoxic exposure resulted into diminished levels of jam-c (Fig. 5 B. ii). Claudin-5 levels in lungs of rats treated with curcumin prior to hypoxia exposure showed only a marginal decrease as compared to hypoxia (Fig. 5. B. iv.). Sparingly no difference was observed in jam-c and claudin-5 levels in lung tissues of unexposed curcumin treated animals (Fig. 5. B. ii and iv). Claudin-4 (Fig. 5. B. iii) and claudin-18 (Fig. 5. B. v) levels in rat lung tissues of hypoxia exposed animals showed significant decrease as compared to their respective controls, but curcumin prophylaxis alleviated these changes under hypoxia (Fig. 5. B. iii & v). The rats administrated with curcumin (50 mg/kg BW) under normoxia showed a marginal but insignificant increase in claudin-18 levels (Fig. 5. B. v). We observed a slight decrease in occludin mRNA expression under hypoxia and curcumin supplementation

2.4. Efficacy of curcumin in maintaining the tight junction protein integrity in vitro: TJ proteins in A549 cells under hypoxia showed significant down regulation in their expression levels. ZO-1, JAM-C, occludin and claudin-4 showed decreased expression under hypoxia whereas an increased protein expression pattern was observed in claudin-5 protein expression under hypoxia compared to control (Normoxia) (Fig. 4.A. a, b, c, e and d respectively). Cells (A549) treated by curcumin (10 μM) before hypoxia exposure, resulted into increased protein expression levels of ZO-1, JAM-C, claudin-4 and occludin with abridged levels of claudin-5 compared to control (Hypoxia, 6 h) (Fig. 4.A. a, b, c, e and d respectively). in vivo : Protein expression analysis of TJ proteins under hypoxia showed a significant down regulation in proteins levels of viz ZO-1, occludin and claudin-4 and increased protein expression levels of JAMC and claudin-5 over control. Normoxia rats supplemented with curcumin showed no change in the expression levels of these tight junction proteins in lungs compared to control. However, we observed that claudin-5 levels in curcumin supplemented normoxia animals were upregulated compared to control. To elucidate the underlying molecular mechanism of this augmented expression of claudin-5 upon curcumin 4

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Fig. 3. Anti-inflammatory cytokines levels in Sera and BALF of rats exposed to hypoxia at 7620 m for 6 h. Serum/ BALF samples from treated and controls were ex vivo analyzed for the presence of cytokines by ELISA. Hypoxia exposure altered the cytokine levels between the groups. Scatter plots showing levels of (a) TGF-β, Sera- *p < 0.001 Nor vs Hypo and Hypo vs Hypo + cur; BALF *p < 0.001 Nor vs Hypo; # p < 0.01 Hypo+ Hypo + cur (b) IL-4 Sera-*p < 0.001 Nor vs Hypo and Hypo vs Hypo + Cur ; BALF- *p < 0.001 Nor vs Hypo and Hypo vs Hypo + Cur (c) IL-10 Sera-*p < 0.001 Nor vs Hypo and Hypo vs Hypo + Cur; BALF-*p < 0.001 Nor vs Hypo and Hypo vs Hypo + Cur. Values are mean ± SD. (n = 6). Two-way ANOVA with Turkey's Multiple compression Test was conducted to determine potential statistical difference. Nor vs Nor + Cur is non significant (Not shown in graph). The lines represent median lines. Nor – Normoxia, Hypo- Hypoxia and Cur Curcumin.

Fig. 4. Prophylactic efficacy of curcumin (10 μM) in protecting the TJ protein impairment under hypoxia (3 % O2) in A549 cells. (A) Representing western blot analysis of (a) ZO-1 (b) JAM-C (c) Claudin-4 (d) Claudin-5 (arrow mark) and (e) Occludin. (B) Representing densitometry analysis of ZO-1, JAM-C, Claudin 4, Claudin-5 and Occludin. Data is representative of 5–6 independent experiments. *P < 0.001 Normoxia vs Hypoxia; #p < 0.05 Hypoxia vs Hypoxia + curcumin. Nor – Normoxia, Hypo - Hypoxia and Cur - Curcumin. 5

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Fig. 5. Efficacy of curcumin (50 mg/kg BW) in maintaining tight junction protein integrity in lungs of rats exposed to 7620 m for 6 h. (A) Representing western blot analysis of (a) ZO-1 (b) JAM-C (c) caludin-4 (d) claudin-5 and (e) occludin upon hypoxia exposure in lungs of rats treated with and without curcumin (B) Efficacy of curcumin in maintaining the tight junction protein at mRNA levels (i) zo-1 (ii) jam-c (iii) claudin-4(iv) claudin-5 (v) claudin-18 and(vi) occludin in rat lung tissues. (C) Representing densitometry analysis of ZO-1, Jam-C, Caludin-4, Claudin-5 and Occludin. *P < 0.001 Normoxia vs Hypoxia; #p < 0.05 Hypoxia vs Hypoxia + curcumin.(n = 6 animals per group). Nor – Normoxia, Hypo - Hypoxia and Cur - Curcumin.

restored it more or less similar to that of normoxia as compared to hypoxic control (Fig. 5. B. vi). The gapdh expression was monitored as loading control.

further underlined by IHC data (Fig. 8. A). Hypoxia exposure caused diminished number of immuno-positive cells in comparison to curcumin treated hypoxia exposed rat lung tissue sections. From IHC and WB experiments, we have noticed diminished expression of claudin-4 in A549 cells and rat lung tissue. We decided to cross confirm these data using IF staining technique. IF staining results of lung tissues were in agreement with our WB and IHC results. Claudin-4 (Fig. 8. (B) B, F and J) expression (observed as red fluorescence) under hypoxia was diminished compared to control (Normoxia- Fig. 8. (B) A. E. and I), however curcumin prophylaxis restored the claudin-4 (Fig. 8. (B) D, H and L) expression levels.

2.5. Immunohistochemistry and immunofluorescence staining of TJ proteins To establish that TJ disruption is caused due to impairment of TJ proteins under hypoxia we performed immunohistochemistry (IHC) and immunofluorescence (IF) staining in thin sections of rat lung tissues. IHC examination of cytosolic TJ protein ZO-1 expression showed considerable diminished expression in hypoxia exposed rat lung tissue (Fig. 6. A. b) in comparison to normoxia control (Fig. 6. A. a). However animals subjected to hypoxia after prophylactic administration of curcumin, showed higher expression of ZO-1 protein (Fig. 6. A. d) compared to control (hypoxia). The curcumin supplemented normoxia animals did not show any change in protein expression (Fig. 6. A. c). We further confirmed these results by IF staining of ZO-1(Fig. 6. B), which was in agreement with our WB, RT-PCR and IHC results. JAM-C is a trans-membrane protein expressed by epithelial and endothelial cells as well as by leukocytes and platelets (Ebnet et al., 2004). JAM-C protein expression was analyzed by immunofluorescence. We observed difference in expression pattern of JAM-C protein in A549 cell lysate and rat lung tissue homogenates. IF staining of JAM-C showed higher degree of protein expression under hypoxia (Fig. 7. B, F and J) in lungs of rats as compared to normoxia. Curcumin supplemented hypoxia exposed animals showed reduced expression of JAM-C (Fig. 7. D, H and L). Claudin-4 is predominantly expressed in alveolar type II cells. Claudin-4 expression positively correlates with the alveolar fluid clearance (Günzel and Alan, 2013). The WB data of claudin-4 was

2.6. Hypoxia exposure impairs the tight junction protein integrity in lungs of rats TEM was used to visualize the TJ structures between pulmonary epithelial cells. The rats exposed to normoxia showed normal and intact TJ structures (Fig. 9. a. i and ii), while hypoxia exposed rats showed loss of TJ structures as evidenced by widened distance between cells, intermittent widening (Fig. 9. b. i and ii) indicating the loss in TJ integrity at 6 h of exposure. Whereas rats treated with curcumin and then exposed to hypoxia, manifested reduced widening of TJ proteins, indicating the protective efficacy of curcumin in maintaining the TJ integrity under hypoxia (Fig. 9. c. i and ii). 2.7. Curcumin abates hypoxia induced activation of NF-κB To investigate the influence of NF-κB activation in A549 cells under hypoxia, we have transfected the cells with pNF-κB-GFP. As shown in Fig. 10, GFP reporter assay indicated that, hypoxia induced nearly 3.5 6

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Fig. 6. Effect of curcumin (50 mg/kg BW) on the expression of ZO-1 in the lungs of rats exposed to hypobaric hypoxia at 7620 m for 6 h (A) Immunohistochemistry image of ZO-1 of rat lung tissue showing ZO-1 protein. Immunopositive cells for ZO-1 stained as brown dark spots (black arrow) (a) normoxia (b) hypoxia (c) normoxia + curcumin (50 mg/kg BW) (d) hypoxia + curcumin (50 mg/kg BW). Hypoxia caused significant decrease in ZO-1 protein expression in lungs of rat which was mitigated by curcumin prophylaxes (50 mg/kg BW) under hypoxia. Image is representative of five independent experiments. The scale bar represent 100 μm. Images were captured at 400 X magnification. Nor - Normoxia, Hypo - Hypoxia. (B) Immunoflourescence image of rat lung tissue showing ZO-1 protein. Rat exposed to (B and J) hypoxia (7620 m, 6 h) showed reduced expression of ZO-1 protein whereas (D and L) curcumin (50 mg/kg BW) treated hypoxia exposed animals showed normal expression of ZO-1 protein under hypoxia. I, J K and L are the merged images. The nucleus (Blue color) was counter stained with DAPI (4′,6-diamidino-2phenylindole) (E, F, G and H). The image was representative of 5 independent experiments. The image was captured at 200X magnification. Scale is 150 μm. Nor – Normoxia, Hypo - Hypoxia and Cur - Curcumin.

fold increase in NF-κB activation compared with the normoxia condition in A549 cells. Interestingly, curcumin treated hypoxia exposed cells showed nearly 2.0 fold decrease in NF-κB activity in comparison to control (hypoxia) (Fig. 10. A). Curcumin treated normoxia exposed cells showed minimal activity under hypoxia. MG132 is a known inhibitor of NF-κB through inhibition of proteosomal degradation of IkBα and IkBβ. Therefore as a positive control, NF-κB GFP activity was also monitored in presence of proteasome inhibitor MG132. NF-κB failed to get activated under hypoxia in presence of MG132 in A549 cells (Fig. 10. A). However to further strengthen our results we have blocked the NF-kB with another blocker SN50. SN50, a cell permeable inhibitory peptide. The SN50 sequence contains the nuclear localization sequence (NLS residues 360–369) of the transcription factor NF-κB p50 linked to a peptide cell-permeabilization sequence, the hydrophobic region (h-region) of the signal peptide of Kaposi fibroblast growth factor (K-FGF). SN50 peptide blocks the translocation of the NF-κB active complex into the nucleus thus leads to attenuation of inflammation. The EMSA results showed reduced expression of NF-κB expression in nuclear extract of A549 cells treated with SN50, MG132 and SiRNA (Supplementary Figure S1) compared to hypoxia (6 h) exposed cells. Further, we tried to show the siRNAp65 knock down activity of NFκB protein expression in the A549 cells under hypoxia by Western blotting. The results confirmed that pre-treatment of A549 cells with siRNA mediated knock down of p65 significantly abrogated (p < 0.001) hypoxia induced increased NF-κB expression compared to hypoxia exposed cells (Fig. 10. B).

binding site for NF-κB (Van Uden et al., 2008; Rius et al., 2008). Hence experiments were carried out to evaluate potential role of NF-κB in stabilizing HIF-1α. There was a gradual and significant increase in HIF1α levels were observed from 1 h of exposure to 48 h of exposure in A549 cells, indicating that as the NF-κB levels increased, its expression levels were also increased (Supplementary Figure S2). HIF-1α levels in normoxia were seen in A549 cells (Fig. 11). Since A549 are cancerous cells, minimal activity of HIF-1α was expected. NFκB was inhibited using MG132 and siRNAp65 construct. HIF-1α luciferase activity was much less in MG132 (p < 0.001) than the siRNAp65 construct (p < 0.05) as compared to hypoxia (Fig. 11). We noticed that, curcumin could stabilize HIF-1α significantly as compared to hypoxia. However, we have confirmed this at gene level. The mRNA expression of HIF-1α in curcumin treated lung tissue showed stabilized HIF-1α expression (Supplementary Figure S3). This indicates that under hypoxia both NF-κB and HIF-1α are interdependent for their expression. This study (reporter assay) further proves that curcumin is able to control both NF-κB (higher expression) and stabilizes the HIF-1α under oxygen deprivation. Thus, curcumin plays a dual role by maintaining both oxygen homeostasis and also controlling inflammation leading to benefiting the animal to sustain or acclimatize to the hostile environment prevailing around it (i.e., Hypoxia). 2.8. Alveolar fluid clearance (AFC) 2.8.1. Assessment of in vitro alveolar epithelial permeability with different hypoxic durations A549 cells were seeded into trans well inserts for a period of 24 h before the hypoxia exposure. The permeability of flurorescein

2.7.1. Curcumin stabilizes HIF-1α Recent reports have brought out that HIF-1α promoter region has 7

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Fig. 7. Immunoflurescence images showing the effect of curcumin (50 mg/kg BW) on the expression of JAM-C in the lungs of rats exposed to hypobaric hypoxia at 7620 m for 6 h. Poly clonal JAM-C antibody probed tissues sections (A, B, C and D) were incubated with secondary anti goat alexa flura 488 antibody. The nuclei were counter stained with DAPI (E, F, G and H). I, J K and L are the merged images. Arrow mark indicates the expression of JAM-C on endothelium of lung tissue. The images were representative of 5 independent experiments. Image captured at 200X magnification. Scale is 150 μm. Nor – Normoxia, Hypo - Hypoxia and Cur Curcumin.

isothiocyanate (FITC) dextran (200 KDa) from albumin compartment and lower compartments were assessed at different hypoxic time intervals (1 h, 3 h, 6 h, 12 h, 24 h and 48 h). A549 cells started showing disrupted TJ integrity from 1 h of hypoxia exposure. There was an insignificant increase at 1 h of hypoxia exposure. The fluorescence intensity in lower compartment of trans well inserts were slightly increased up on 3 h of hypoxia exposure, but further increase in hypoxia exposure of cells to 6 h (p < 0.001) showed abrupt significant increase in alveolar permeability in A549 cells as compared to normoxia. However, an interesting observation in this study was that, a drastic 3 fold increase in permeability occurred at 12 h compared to 6 h of hypoxia exposure. Upon further increase in hypoxia exposures (ie. 24 h and 48 h) the permeability in A549 cells considerably (p < 0.001) increased compared to control, but not as drastically as observed between 6 h–12 h of hypoxia exposures (Fig. 12).

resulted into increased (25 %) alveolar fluid clearance as compared to control (Fig. 13. B). 3. Discussion In this study we have showed that prophylactic administration of curcumin significantly reduced the inflammation leading to the modulation of the alveolar tight junction protein (ZO-1, occludin, claudin-4, claudin-5 and JAM-C) expressions by attenuating the activation of NFκB thereby down regulating the pro-inflammatory cytokines activity along with stabilizing HIF-1α expression. Curcumin prophylaxis augmented the RBC and Hb count there by PaO2, PaCO2 and SaO2 levels were maintained under hypoxia. This might have led to a significant increase in alveolar fluid clearance. The concept that hypoxia can induce inflammation has gained general acceptance (Sarada et al., 2014; Chawla et al., 2014; Himadri et al., 2010). The mounting data in recent years demonstrated that TJ protein integrity is more affected by NF-κB induced inflammation (Tyagi et al., 2009; Rana et al., 2009; Ward et al., 2015). Clinical and experimental studies have also suggested that a network of pro-inflammatory cytokines, such as TNF-α and IL-6 plays a critical role in lung injury. These cytokines not only cause inflammatory cascade injury but also stimulate neutrophil to migrate into lung tissues (Asha et al., 2014). It was reported that neutrophil recruitment in the vasculature showed loss of TJ molecules including occludin and zonula occludins and followed by redistribution of adherent junction protein vinculin (Bolton et al., 1998). Thus, leukocyte recruitment seems to trigger signal transduction cascades that leads to disorganization of TJ and alveolar epithelial barrier breakdown. Balamayooran et al (Balamayooran et al., 2011) have reported that the increased alveolar permeability induced by hypoxia involves a cascade of events in which cytokines are the main contributors. Our earlier studies on (Sarada et al., 2014) the lung histology manifested the inflammatory cell

2.8.2. Curcumin augments alveolar epithelial TJ integrity under hypoxia (A) in vitro: In order to investigate the efficacy of curcumin in maintaining the alveolar epithelial barrier permeability under hypoxia, we conducted further experiments with curcumin, siRNAp65 knockout and MG132. A549 cells exposed to hypoxia showed two fold increases in dextran FITC efflux over control (p < 0.001). However, A549 cells treated with curcumin reduced the dextran FITC efflux approximately by 2 fold (p < 0.001) as compared to control (hypoxia). Likewise, the cells treated with MG132 (10 μM - a cell permeable, proteasome inhibitor molecule and a known NF-κB inhibitor) or transfected with siRNAp65 construct and exposed to hypoxia not only showed reduced NF-κB expression but also showed significant reduction (p < 0.05 and p < 0.001 respectively) in dextran FITC efflux compared to control (6 h) (Fig. 13. A). (B) in vivo: We extrapolated the in vitro experiment into in vivo system. Rats exposed to hypoxia showed nearly 35 % reductions in fluid clearance over control. However curcumin prophylaxis under hypoxia 8

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Fig. 8. Effect of curcumin (50 mg/kg BW) on the expression of claudin-4 in the lungs of rats exposed to hypobaric hypoxia at 7620 m for 6 h (A) Immunohistochemistry image of claudin-4 in alveolar epithelium (a) Normoxia (b) Hypoxia © Normoxia + Curcumin (50 mg/kg BW) and (d) Hypoxia + Curcumin (50 mg/kg BW) in rats (black arrow). Image is representative of five independent experiments. The scale bar represent 100 μm. Images were captured at 200X magnification. Nor- Normoxia, Hypo-hypoxia. (B) Immunoflurescence (IF) image of claudin-4 in alveolar epithelium. Rats exposed to (B, F and J) hypoxia (7620 m, 6 h) showed reduced expression of claudin-4 protein whereas (D, H and L) curcumin (50 mg/kg BW) treated hypoxia exposed animals showed normal expression of claudin-4 protein. I, J, K and L are the merged images. The nucleus (Blue color) was counter stained with DAPI (4′,6-diamidino-2-phenylindole) (E,F, G and H). The images were representative of 5 independent experiments. (n = 6). Image captured at 200X magnification. Scale is 150 μm. Nor – Normoxia, Hypo - Hypoxia, Cur Curcumin.

Fig. 9. Transmission electron microscope (TEM) image of tight junction structures obtained from a thin section, cut through the lungs of rats exposed to hypoxia at 7620 m for 6 h. (a) i and ii Normoxia (b) i and ii Hypoxia and (c) i and ii Hypoxia + Curcumin. Red arrows indicate tight junction structures in lungs of rats. Image representative of 3 rats. Scale 100−500 nm, image (i) magnification is18,300 X and image (ii) magnification is 36,700 × . 9

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Fig. 10. Effect of hypoxia on NF-κB activity in A549 cells. Cells were exposed to hypoxia (6 h) and NF-κB activity was determined using a GFP fluorescence (A) NF-κB-dependent GFP fluorescence in hypoxic conditions. The curcumin (10 μM) and MG132 (10 μM) treated cells showed minimal NF-κB activity under hypoxia. Data is representative of mean ± SD from 5 independent experiments performed in duplicates.*p < 0.001 Normoxia vs Hypoxia, $ p < 0.001 Hypo vs Hypo + curcumin, # p < 0.001 vs Hypo Vs Hypo + MG132. (B) Representing Western blot analysis of NF-κB activity under Hypoxia and Hypoxia + siRNA treated A549 cells. (C) Representing densitometry analysis of NF-κB expression. *p < 0.001 Hypoxia vs Hypoxia + siRNAp65. Nor - Normoxia, Hypo - Hypoxia, Cur Curcumin.

migration into the lungs under hypoxia. The results presented here supports the hypothesis that hypoxia induced lung NF-κB activation leads to increased pro-inflammatory cytokines (↑TNF-α, IL-2, IL-6 and γ-IFN) followed by decreased anti-inflammatory cytokines (↓TGF-β, IL-

4 and IL-10) which then altered the epithelial permeability by impairing TJ organization i.e. decreased tight junction protein expression levels of ZO-1, claudin-4, occludin and increased expression levels of claudin-5 and JAM-C, whereas curcumin prophylaxis modulated these Fig. 11. HIF-1α luciferase activity in A549 cells under hypoxia. The siRNAp65 and MG132 treated cells showed minimal HIF-1α activity under hypoxia. Curcumin (10 μM) stabilized HIF-1α under hypoxia. Data is representative of mean ± SD from 5 independent experiments performed in duplicates. *p < 0.001 Hypo vs Normoxia; $ p < 0.001 Hypo vs Hypo + curcumin ; # p < 0.001 Hypo vs Hypo + MG132; € p < 0.001 Hypo + curcumin vs Hypo + MG132; ₰ p < 0.001 Hypo vs Hypo + SiRNAp65. Nor - Normoxia, Hypo- Hypoxia, Cur - Curcumin.

10

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Fig. 12. Effect of hypoxia exposure (0 h, 1 h, 3 h, 6 h, 12 h, 24 h and 48 h) on alveolar epithelial barrier permeability in A549 cells. Hypoxia exposures increased the fluorescence of FITC dextran 200 KDa time dependently, in the lower chamber of trans well inserts indicating the loss of alveolar epithelial barrier integrity. Data represent mean ± SD. Results are representative of five independent experiments performed in duplicates. *p < 0.05 Normoxia vs Hypoxia; #p < 0.001 Normoxia vs Hypoxia. Nor - Normoxia, Hyp - Hypoxia, Cur - Curcumin.

Fig. 13. (A) in vitro alveolar barrier permeability in A549 cells. Cells were transfected with siRNA p65 or treated with MG132 or curcumin (10 μM) before hypoxia exposure (3 % O2, 6 h). Permiability of FITC-dextran into the bottom chamber was assayed. Data represent mean ± SD five independent experiments performed in duplicates. *p < 001 Normoxia vs Hypo and Hypo vs Hypo + SiRNAp65; # p < 0.001 Hypo vs Hypo + Curcumin; $p < 0.01 Hypo + Cur vs Hypo + MG132; ## p < 0.05 Hyp + Cur vs Hypo + SiRNAp65; **p < 0.05 Normoxia + Cur vs Hypo + SiRNAp65; @ p < 0.05 Hypo vs Hypo + MG132. (B) in vivo (Rats) alveolar fluid clearance under hypoxia. Rats were prior treated with curcumin (50 mg/kg BW) and exposed to hypoxia at 7620 m for 6 h.Shown are the results of percentage decrease in Evans blue-albumin concentration. Values are the mean ± SD (n = 6). *p < 0.05 Normoxia vs Hypo; #p < 0.05 Hypo vs Hypo + Curcumin. Nor Normoxia, Hypo - Hypoxia, Cur - Curcumin.

changes under hypoxia. To our knowledge we are the first group to report that curcumin prophylaxis is able to control the inflammatory milieu in alveolar epithelium under hypoxia. Anti-inflammatory therapy has been described to overcome the vascular remodeling and redox stress during pulmonary injury (Tyagi et al., 2009). Under such a condition, preventing the activation of inflammatory cascade might rescue from alveolar tight junction disruption. A549 cells transfected with siRNAp65 or treated with MG132 decreased the permeability of fluorescent molecule (Dextran-FITC) in A549 cells under hypoxia. However, slight increase in alveolar epithelial barrier integrity (measured in terms of paracellular transport) observed in the NF-κB activation inhibited by siRNAp65 or MG132 (10 μM) in A549 cells were not as par with curcumin treated cells. This might be due to the fact that these NF-κB blockers were unable to scavenge the free radicals produced under hypoxia hence little activation of NF-κB might have occurred (as evident in Fig. 13. A), but significantly attenuated the dextran permeability compared to control (Hypoxia). p65 knockdown inhibits translocation of nuclear factor-κB (NF-κB) in to the nucleus and production of inflammatory cytokines. An interesting observation was made by Ward et al29 that, NF-κB inhibitors impair lung epithelial tight junctions in the absence of inflammation. These studies were conducted under normal oxygen (21 %) conditions.

Our studies were conducted in both normobaric hypoxia (in vitro) and hypobaric hypoxia (in vivo). It seems that global attenuation of NF-κB is detrimental, constitutive expression of NF-κB is required even under stressful environments for e.g. hypoxia, for maintaining the integrity of the alveolar epithelial tight junctions. These findings further strengthen the data obtained in our current study. HIF-1α stabilization has been accredited to propagate anti-inflammatory responses while down regulating pro-inflammatory responses (Chawla et al., 2014). Our reporter gene assay results have demonstrated that HIF-1α was stabilized by curcumin administration. But silencing of NF-κB p65 with MG132 failed to stabilize HIF-1α under hypoxia as compared to untreated hypoxia exposed cells. Several researchers have reported that NF-κB binding site is present at a distinct element in the proximal promoter of the HIF-1α gene (Ebnet et al., 2004; Günzel and Alan, 2013) More recently NF-κB binding to this site in the HIF-1α promoter has also been shown under hypoxic conditions (Gorlach and Bonello, 2008). It seems that down regulating the NF-κB activity leads to reduced expression of HIF-1α under hypoxic conditions. This means that, under hypoxic conditions, the NF-κB must be down-regulated to certain extent (for controlling the inflammation) and at the same time the HIF-1α must be stabilized (to maintain the oxygen homeostasis and therefore acclimatization) in order to sustain the 11

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

hypoxic stress. This phenomenon was exactly observed in the present study (blocking the NF-κB with MG132 and curcumin) with prior curcumin administration. The most important observation in this study was that even though curcumin was able to attenuate NF-κB protein expression, it stabilized HIF-1α as well, indicating that curcumin might have used some other mechanism to stabilize HIF-1α other than through inhibition of NF-κB under hypoxia. This indicates that these two major pathways are responsible for controlling the oxygen homeostasis on one hand and inflammation on the other hand indicating that a cross talk occurs between these two most important transcriptional molecules under hypoxia. Bouvry et al (Bouvry et al., 2006) have reported that alveolar epithelial cells (AEC) exposed to 3 % and 0.5 % oxygen for 18 h no longer had occludin localized to the TJ but scattered in the cell interior. Acute hypoxia showed 20 % decrease in ZO-1, nearly 50 % decrease in claudin-4 and nearly 30 % decrease in occludin protein expression in A549 cells within an hour of hypoxia exposure. This implies that hypoxia causes a direct dysfunction of the barrier and that this is not a regulated phenomenon, since it only affects the abundance of major TJ proteins at the plasma membrane in AEC. Claudins are integral membrane proteins that have four hydrophobic transmembrane domains and two extracellular loops which appear to be involved in the homophilic and/or heterophilic interactions implicated in TJ formation (Turksen and Troy, 2004). Claudins require additional protein components in order to be assembled into tight junctions. They are directly tethered to the actin cytoskeleton via cytosolic scaffold proteins (ZO-1) that interact primarily with the C-terminal domain and regulate claudin incorporation into tight junctions (Overgaard et al., 2012). Claudin-4 up-regulation in alveolar epithelial cells enhances transepithelial resistance (TER) in alveolar epithelium (Rokkam et al., 2011). The downregulated claudin-4 expression under hypoxia was restored by curcumin prophylaxis both at protein and mRNA transcript levels. Immunohistochemical and immunofluorescence studies further confirmed these findings. This clearly indicates that claudin-4 augmented expression will certainly reduce fluid influx into the lungs. Findley et al (Findley et al., 2008) have revealed that, A549 cells transfected with claudin-5 demonstrated a leaky phenotype, showed increased paracellular flux of calcein and Texas Red Dextran and lowered the transepithelial electrical resistance (TER), suggesting that, the increased claudin-5 expression observed in lung could account for the observed increase in permeability. However, Sarada et al. 2016 have also showed the protective prophylactic efficacy of curcumin in augmenting the tight junction protein integrity and therefore curtailing the fluid accumulation in brain of rats (Sarada et al., 2015). In support of these findings, in our present study hypoxia induced increase in claudin-5 followed by decrease in claudin-18 was modulated by curcumin administration. Our TEM studies however support these findings. Present study therefore, clearly indicates that reduction in claudin-4 and claudin-18 under hypoxia enhances transepithelial permeability leading to increased fluid accumulation in lungs and curcumin prophylaxis restored these claudin-4 and claudin-18 and maintained tight junction integrity. Junctional adhesion molecule (JAM) is a member of the immunoglobulin super family involved in the maintenance of tight junctions. JAM-C expression has been observed in several actions such as leukocyte migration, regulation of cell polarity, vascular permeability and angiogenesis (Bazzoni, 2003). In a model of acute pulmonary inflammation, leukocyte transendothelial migration was increased in mice over expressing JAM-C specifically on their EC (Palmer et al., 2007). These results are in consistence with our study. The immunofluorescence in lung tissues of rats exposed to hypoxia in our present study (Fig. 7) showed higher expression of JAM-C. Curcumin supplementation might have led to the balanced expression of JAM-C under hypoxia considerably. In the present study, the increased haematocrit value in hypoxia exposed rats might be attributed fundamentally to high altitude

dehydration or partially rats drinking less water during hypoxia exposure, thereby reducing plasma volume. On the other hand, the functional consequence of increased Hb levels in the hypoxia exposed as well as curcumin administered hypoxia exposed group of animals is presumed to be an improved physiological response to carry more oxygen to maintain the cellular homeostasis under hypoxia. An earlier case report indicates that the HAPE patients showed increased circulating WBC (Patricia et al., 2018). Hyper-ventilation is generally considered as principal physiological response to hypoxia exposure for maintaining optimal alveolar pO2, which in turn drives the alveolar pCO2 to fall below physiological threshold resulting in systemic hypocapnia. This hypocapnia further invokes a compensatory respiratory alkalosis to restore fall in blood pH (Chawla et al., 2014; Powell et al., 1998). In the present study, the blood gas composition of the hypoxia exposed rats recapitulated the above phenomenon. The increased PaO2 observed in current study upon supplementation of curcumin might be due to increased Hb and RBC levels under hypoxia. Therefore all these functional sequences augmented the haemodynamics for better acclimatization followed by increased TJ protein integrity leading to clear the fluid influx from the lungs. Nowadays, the major concern regarding the low bioavailability of curcumin normally found in rodents and humans is that, it may not reach to different organs of the body in sufficient quantities in order to have a desired effect. A recent study however has suggested a favorable tissue distribution of curcumin (Pawar et al., 2012). These authors have reported that curcumin is rapidly absorbed after oral administration and distributed rapidly into the tissues resulting into very low or undetectable plasma levels indicating that proper utilization of curcumin at tissue level. Pharmacokinetic modeling of the plasma concentration time profile after oral administration revealed that curcumin followed the two compartment model with first order absorption, lag time and first order elimination (Pawar et al., 2012). Their study provided insight into the therapeutic efficacy of curcumin despite being undetectable in plasma. Importantly, curcumin does not block the pathway totally, but only down-regulates the overactive pathway to basal levels. in vitro, in vivo and human clinical studies have all established curcumin’s potential and revealed its therapeutic value (Faizul et al., 2019). Cheng et al (Cheng et al., 2001) have reported that no treatment related toxicity was observed up to 8 g of curcumin daily in phase–I clinical trials, but beyond this dose, the bulk volume of the curcumin was unacceptable to the patients. Our results clearly indicate that it is the inflammation and not only the oxidative stress that contributes to cause fluid influx by disturbing the tight junction protein integrity in lungs. This suggests that pre-treatment with curcumin might be more effective in rat model of HAPE and may also provide similar protection in prevention of HAPE in humans. 4. Conclusion This study showed that prophylactic administration of curcumin appreciably augmented the RBC and Hb count there by PaO2 and PaCO2 levels were maintained more or less similar to that of control (normoxia). Furthermore, curcumin treatment significantly modulated the alveolar tight junction proteins (ZO-1, occludin, claudin-4, claudin-5, claudin-18 and JAM-C) by attenuating the activation of NF-κB (Reduced pulmonary inflammation) thereby down regulating the pro-inflammatory cytokines activity and also stabilizing HIF-1α (maintaining the oxygen homeostasis) by facilitating the acclimatization (enabling better haemodynamics) for effective survival at high altitude. All these might have lead to a significant increase in alveolar fluid clearance. Curcumin prophylaxis able to inhibit the fluid leakage in to the lungs by maintaining tight junction protein integrity and contributed for enhanced AFC by reducing the pulmonary edema in rats. Therefore the multi facet role of curcumin can be used to prevent the problems faced by no of trekkers, mountaineers and/or sojourns visiting to high altitude regions and also can be used as an effective candidate for the 12

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

development of multi-targeted therapy for several human diseases at sea level as well.

5.4. In vitro studies In vitro studies were carried out to find out the time at which the changes in TJ proteins expression takes place up on exposure to hypoxia. Cells were plated at a density of 0.1 million cells per well in 6 well plates. The cells were allowed to adhere over 12 h at normal conditions (i.e normoxia - 5 % CO2, 21 % O2) and later cultured under hypoxic conditions (3 % O2– 5 % CO2– 92 % N2). Prior to hypoxia exposure, culture media was replaced with thin layer of one equilibrated to respective atmosphere. In-vitro hypoxic experiments were carried out in a humidified variable aerobic incubator (Galaxy 170R, New Brunswick Scientific, CT, USA) at different durations viz. 0 h, 1 h, 3 h, 6 h, 12 h, 24 h and 48 h. After different hours of hypoxia exposures the cells were separated for further analysis by trypsinization. From the time dependent studies of hypoxia exposure, we selected to expose the cells for 6 h at 3 % O2. The selected optimum curcumin dose for in vitro study was found to be 10 μM based on our previous studies (Mathew and Sarada, 2015).

5. Methods 5.1. Chemicals and reagents Chemicals and reagents for cell culture, Dulbecco’s modified Eagle’s medium F-12 (DMEM F-12), trypsin- EDTA, penicillin, streptomycin, fetal bovine serum (FBS) and curcumin powder extracted from Curcuma longa (turmeric; catalogue no: C1386−10 G) were purchased from Sigma (St. Louis, MO USA). 5.2. Cell culture A549 cell line (American Type Culture Collection, Rockville, MD) is an epithelial-like human lung cell line derived through explants culture of carcinomatous lung tissue from a 58-year-old male Caucasian. A549 cells were gifted from Institute of Nuclear Medicine and Allied Sciences, Delhi, India. A549 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM F-12), supplemented with 10 % fetal bovine serum, 100 units of penicillin, and 50 μg/ml streptomycin and maintained at 370 C, 5 % CO2, 21 % O2.

5.5. Hypobaric hypoxia exposure: (in vivo studies) The rats were exposed to simulated altitude of 7620 m in a hypobaric chamber (Decibel Instruments, India) for 6 h. The reason for exposing the rats to hypobaric hypoxia for 6 h was based on our previous studies (Sarada et al., 2008), as this duration showed maximum transvascular leakage and edema index as compared to the other durations tested (viz: 3 h, 6 h, 12 h, 24 h and 48 h) against control (hypoxia). The selected optimum curcumin dose (50 mg/Kg BW) was based on our earlier findings, (Sarada et al., 2014) as this dose showed a significant reduction in the level of lung water content and lung transvascular leakage as compared to other doses tested (25, 50, 100 and 200 mg curcumin /Kg BW) compared to control (hypoxia). The in vivo studies were conducted in two Phases as described below: Phase-I: Phase-I experiment had 4 groups of 6 rats each. Groups include- (I) Control or Normoxia (Nor) received only vehicle, (II) Exposed to hypobaric hypoxia (Hypo) (7620 m, 6 h) received only vehicle. (III) Normoxia + Curcumin (50 mg/kg body weight) and (IV) Hypoxia + Curumin (50 mg/kg body weight). Phase-II: Phase-II experiment was same as that of Phase-I experiment i.e. conducted with the same no. of animals with the same curcumin dose and exposed to hypobaric hypoxia for 6 h duration for alveolar fluid clearance study. The temperature of the hypobaric hypoxia chamber was adjusted at 25 ± 1 °C with air flow of 4 l/h, humidity 55 % and barometric pressure at 280 mm Hg. Animals received sufficient quantities of food and water during hypobaric hypoxia exposure.

5.3. Animals Experiments were carried out using male Sprague Dawley rats (150–200 g m). Rats were kept in animal house where temperature was maintained at 25 ± 10 C with day and night cycles of 12 h each. The rats were provided with food and water ad libitum. All the experimental protocols used in this study were approved by the Institute’s Animal Ethical Committee. We have followed the guidelines recommended by the Universities of Federation for Animal Welfare (UFAW) for carrying animal research. Euthanasia dose: Three times increased dose of Ketamine (100 mg/ kg BW) and Xylazine hydrochloride (20 mg/kg BW) IP solution were used for euthanasia. 5.3.1. Curcumin prophylaxis The curcumin was dissolved in a vehicle (Dimethyl sulphoxide (DMSO0.5 %). One hour prior to hypoxia exposure A549 cells received curcumin 10 μM and rats received curcumin 50 mg/kg BW (freshly prepared). Curcumin supplementation to rats 1 h prior to hypoxia exposure (6 h) was based on a standardized protocol established in our earlier studies (Mathew and Sarada, 2015; Sarada et al., 2014). Briefly, among the different durations tested viz. 30 min, 60 min, 90 min, and 120 min before hypoxia exposure, administration of curcumin (10 μM Cur for in vitro studies and 50 mg Cur/kg BW for in vivo studies), 60 min (1 h) before hypoxia exposure increased the cell survival rate and significantly reduced the transvascular leakage respectively as compared to their respective controls. Further we have checked the stability of curcumin in rat's plasma and tissues first time using high performance thin layer chromatography (HPTLC) method (Mishra et al., 2017), where maximum curcumin (50 mg/kg BW) in native form was retained up to one hour after administration compared to different hours tested. Our earlier studies (Cheng et al., 2001) showed curcumin distribution majorly occurred in plasma (0.06 ± 0.0017 mg/mL/ 1 h), kidney (0.89 ± 0.008 mg/gm/1 h), liver (1.39 ± 0.0.029 mg/gm/ 1 h), heart (0.82 ± 0.017 mg/gm/1 h), lung (0.77 ± 0.006 mg/gm/1 h), muscle (0.72 ± 0.030 mg/gm/1 h) and brain (0.69 ± 0.0.014 mg/gm/ 1 h) up to one hour and began to undergo biotransformation thereafter. However in the current study, even after 6 h of hypobaric hypoxia exposure with prior curcumin (50 mg/kg BW) administration, we observed no adverse side effects in any one of the experimental rats.

5.6. Blood gas analysis After anesthesia (intramuscular injection of ketamine and xylazine hydrochloride solution) (Sigma; St. Louis, USA), blood was quickly collected by direct puncture and sampling from the left ventricle using heparinized syringes. All blood samples for arterial blood gas analysis (arterial carbon dioxide tension (PaCO2), arterial oxygen pressure (PaO2), saturation of oxygen (SaO2) were immediately analyzed by GEM Premier 3000 (Instrumentation Laboratory, Bedford, MA, USA). Arterial blood pH, arterial PaCO2 and PaO2 were corrected according to the rectal temperature (Bai et al., 2010). 5.6.1. Mixed venous blood gas analysis Blood gas analysis was performed using the ABL 505 analyzer (Radiometer, Copenhagen, Denmark) for blood gas composition – partial pressure of carbon dioxide (pCO2), partial pressure of oxygen (pO2) and percentage saturation of oxygen (SvO2) in mixed venous blood. Utmost care was taken to avoid blood haemolysis during sample drawing and loading for analysis. 13

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

Table 3 mRNA of tight junction protein's primer sequences. Protein

ZO-1 Claudin- 4 Claudin- 5 Claudin-18 JAM C Occludin GAPDH

Sequences

Product length (bp)

Tm (0C)

Direction

Reverse (5’ – 3’)

Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense

AGCGAAGCCACCTGAAGATA GATGGCCAGCAGGAATATGT ATGGCGTCTATGGGACTACA TTACACATAGTTGCTGGCGG CCTTCCTGGACCACAACATC GCCGGTCAAGGTAACAAAGA TGTGGAGCACTCAAGACCTG AGATGCCGGAGATGATGAAC GAGCCGCTCGAGTTGAACATTGCTGGGATTATTGG CTAGGGCCCTCAGATAACAAAGGACGATTTGTG ATTGAGCCCGAGTGGAAAGG GAGGTAGCACCACGTTGGAA

340

58.5

633

58.4

203

60.3

306

59.9

600

64.3

400

58.4

GTGCTGAGTATGTCGTGGA CACAGTCTTCGAGTGGCA

300

57.1

5.6.2. Hematological analysis Animals after their scheduled normoxia or hypoxia exposures were bled via retro-orbital sampling collected in EDTA mixed tubes for haematological analysis. Sysmex XT 2000i (Lincolnshire, IL, USA) was used for the haematological analysis. The measurements were taken in triplicates for each sample to ensure consistency.

GAA AGT CGC CTC AAC T3′ (the underlining indicates the DNA binding site for NF-κB). 5.9. Studies on mRNA expression The total cellular RNA was extracted from 0.1 g of lung tissue using trizol reagent method following the manufacturer’s recommended protocol (Invitrogen). The concentration of RNA was measured by absorbance at 260 nm. Reverse transcription was performed with Invitrogen cDNA synthesis kit as per manufacturers’ instructions. Briefly, 5 μg total RNA, 0.1 μg oligo (dT)18, 5 U RNase OUTMoloney murine leukaemia reverse transcriptase, 5 mM dNTP mixture, 10 mM dithiothreitol dissolved in reverse transcription buffer (50 mM Tris–HCl, pH 8.3; 75 mM KCl and 3 mM MgCl2) at 250C for 10 min, 420C for 50 min and 700C for 15 min to yield cDNA. The first strand cDNA was amplified in 10 mM Tris–HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCl2, 100 μM dNTP mixture, 0.75 μM specific primers and 0.75 units high fidelity Taq DNA polymerase (Invitrogen, Singapore). The design of each primer was based on the published sequence. Table 3 shows the mRNA of tight junction protein's primer sequences used in the study. The polymerase chain reaction (PCR) was performed in PCR system 9700 (Biorad, USA) under the following conditions: 940C for 5 min (pre-PCR), 30 cycles of 940 C for 30 s, 55–650C for 45 s, 720C for 30 s and 720C for 5 min. The optimal cycle number (30 cycles) for each primer was determined by sequentially performed PCR amplification of 26, 28, 30, 32, 35 cycles. The PCR products were separated by electrophoresis upon loading on to a 1.2 % agarose gel. After staining with ethidium bromide, all DNA bands were photographed using Gel Doc System (Innotech CA, USA).

5.7. Protein expression studies 5.7.1. Western blotting The rinsed cells and tissues were lysed with radioimmuno precipitation assay (RIPA) buffer at 40 C. Nuclear extracts were separated by re-suspending the cells in high salt buffer (20 mM Hepes, 400 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF and protease inhibitor cocktail) and centrifugation. Proteins were separated by SDS-PAGE, then, transferred on to nitrocellulose membrane (Millipore, USA) and later, probed with primary antibodies of p-NF-κB p65, occludin, claudin-4, claudin-5, ZO-1, TNF-α, JAM-C, HIF-1α, β-actin (for cytoplasmic proteins), Histone H3 (for nuclear proteins) (Santa Cruz Biotechnology) followed by probing with peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology). Later, the membranes were thoroughly washed with phosphate buffered saline tween (PBST) (five times) and developed the protein bands using chemiluminescent peroxidase substrate kit (Sigma, LO, USA). The bands were exposed to X-ray film (Kodak, Rochester, NY) 5.7.2. Enzyme-linked immunosorbent assay (ELISA) Cytokine sandwich ELISA experiments were employed to detect the concentration of soluble cytokine proteins in bronchoalveolar lavage fluid (BALF) and sera from rat samples for pro-inflammatory cytokines (TNF-α, IL-2, IL-6, IFN-γ) and anti-inflammatory cytokines (IL-10, IL4,TGF-β) using commercially available kits (BD, Bioscences, USA and Ray Biotech, USA).

5.10. Immunohistochemistry (IHC) Tissue specific localization of tight junction proteins was determined by immunohistochemistry in both normoxia or hypoxia exposed rat’s lung tissues according to the process given by Beytut et al., (2009) (Beytut et al., 2009). Thin cryosections (20 μm, Leica CM 1950, Microtome, Leica Wtzlar, Germany) of alveolar tissues were prepared from para-formaldehyde fixed normoxic/hypoxia exposed rats. 3 % hydrogen peroxide (H2O2) was used to stop the endogenous peroxidase activity. For antigen retrieval, the tissue sections were incubated with phosphate-buffered saline (PBS, pH 7.2, 5 min) followed by 0.05 % Trypsin - ethylene diamine tetra acetic acid (EDTA, 20 min) treatment. After through washings with PBS-Triton100 (PBST, 5 min) and incubation with normal goat serum (5 %) for 1 h, sections were probed with primary antibodies (ZO-1 and claudin-4) kept overnight at 40 C. The sections were washed and then incubated respectively with horse

5.8. NF-κB activation studies using Electrophoretic mobility shift assay (EMSA) The EMSA for NF-κB was carried out using a commercials kit (Thermofisher, USA) as per manufacturer’s instructions. A549 cells were exposed to hypoxia (3 % O2, 6 h) having treated different NF-κB blockers viz MG132, SN50, curcumin and siRNAp65. The nuclear extract of A549 cells were prepared. The sequences were 3′ end labelled with biotin. The NFκB oligonucleotide probe was supplied by Operon, the sequence being NF-κB, F 5′-AGT TGA GGG GAC TTT CCC AGG C-3′, NF-κB R 5′-GCC TGG GAA AGT CCC CTC AAC T-3′, NF-κB mutant F 5′AGT TGA GGC GAC TTT CCC AGG C 3′, NF-κB mutant R 5′GCC TGG 14

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

radish peroxidase (HRP) conjugated secondary antibodies (Sigma-Aldrich MO, USA) for 90 min at RT. Labeling was carried out with 3, 3′diaminobenzidine (DAB) and image processing was done by Olympus BX51TF (Centre valley, PA, USA).

5.13.3. HIF-1α reporter gene assay The HIF-1α-luciferase reporter plasmid (pHIF-1α-luciferase) (Promega, Madison, WI, USA) was used to measure the activity of reporter assay of DNA binding site. The HIF-responsive luciferase construct encodes the firefly luciferase reporter gene under the control of a minimal (m) cytomegalovirus (CMV) promoter and tandem repeats of the hypoxia response element (HRE). An internal control (Renilla luciferase) vector was used to normalize the transfection efficiency. A ratio of 1:1 (Control vector : Test vector) was maintained to optimize the transfection effeciency. A549 cells were co-transfected with pHIF-1αluciferase using Lipofectamine 2000 reagent. To determine whether NFκB activation can modulate HIF-1α activity, A549 cells were transiently co-transfected with pHIF-1α-luciferase +2 pmol siRNAp65 using Lipofectamine 2000 Reagent (Life Technologies). After transfection for 24 h, the cells were incubated under either normoxic or hypoxic conditions and measured the luciferase activity using ARVO SX 1420 Multilabel counter (PerkinElmer Inc., MA, and USA).

5.11. Immunoflurosence (IF) The IF staining of rat lung tissues were performed as in immunohistochemistry staining procedure with slight modifications. Briefly, after the antigen revival, thin cryosections of alveolar tissues were incubated with primary antibodies (ZO-1, JAM-C and Claudin-4) kept overnight at 40C. After thorough washings with PBST, the sections were incubated in fluorochrome–conjugated secondary antibodies (for 60 min at RT), then counter stained with specific nuclear stain (diamidino-2-phenylindole) (DAPI)/Hoechst (for 15 min at RT). The cover slips were mounted with ProLong Gold Anti-fade medium (Invitrogen, USA). The slides were viewed under the microscope Olympus BX51TF (Center valley, PA, USA) equipped with a Cool SNAP HQ digital camera (Photometries) using appropriate filters. Captured images were processed using software's Image-Pro MC5.1 and Image J (NIH, USA).

5.14. Alveolar fluid clearance (AFC) 5.14.1. In-vitro alveolar epithelial barrier integrity To begin with in-vitro alveolar barrier integrity assay, we initially screened the permeability coefficient in transwell chamber using FITC dextran 200 KDa without seeding the cells to understand baseline permeability coefficient. Diffusion of FITC across the insert was assessed as concentration (in μl) as a function of time. These changes in concentration over a given time period allow for the calculation of the permeability coefficient (in cm/s) of the cultured monolayer. From this, we obtained brightness per unit volume assigned to FITC and dilution ration of FITC to be added into the each insert, and then we performed the In-vitro studies which are mentioned below.

5.12. Transmission electron microscopy (TEM) The TJ structures in the lungs of rats were examined by transmission electron microscopy (TEM) as described earlier (Turi et al., 2011) with some modifications. Briefly, lungs were fixed with 2 % parafarmaldehydeat 40C overnight. After washing with PBS post fixation was done in 1 % osimum tetroxide in phosphate buffer saline (pH 7.4) for 1 h. Later, the lung tissues were dehydrated in a graded ethanol series and embedded in epoxy resin media. The resin blocks were then cut in to ultrathin sections (60 nm) with a diamond knife, stained with unanyl acetate and lead citrate for contrast and viewed by TEM (TEM-1200EX, Hitachi Electronic company, Tokyo, Japan) at 18,300 X - 36,700 X magnification.

5.14.2. In vitro studies (AFC) The in vitro permeability assay was determined as described by Tang et al (Tang et al., 2014) but with some modifications. Briefly, A549 cells were seeded on to PFTE membrane Costar Trans-wells (Sigma; St. Louis, USA) with a 0.4 m pore size. 24 h later, non-adherent epithelial cells were removed and fresh medium was added to the lower compartments of the trans-wells, thus maintaining the ATII cell monolayers with an air-liquid interface on their apical side. The seeded inserts were then exposed to hypoxia for 0 h, 1 h, 3 h, 6 h, 12 h, 24 h and 48 h. In a similar experiment the A549 cells were treated with curcumin or siRNAp65 or MG132 (10 μM) and exposed to hypoxia or normoxia. The dextran FITC 200 KDa was added to the upper layer. After the predefined exposure time, trans-epithelial FITC fluorescein flux was measured by estimating the fluorescence both in lower and upper compartments using a fluorescence spectrophotometer (excitation filter 485 nm, emission filter 530 nm). The cell permeability was expressed in arbitrary units (AU). All tests were repeated thrice and statistically analyzed.

5.13. Reporter gene assay 5.13.1. NF-κB reporter gene assay The NF-κB-GFP reporter plasmid (pNF-κB-GFP, cignal GFP reporter) (Qiagen, Hilden, Germany) was used to measure the activity of reporter assay of DNA binding site as per manufacturer's instructions. A549 cells were transiently co-transfected with 1 μl (100 ng) Cignal reporter or negative control using Lipofectamine 2000 Reagent (Life Technologies). After transfection for 24 h, A549 cells were incubated under either normoxia or hypoxia conditions. GFP activity was measured on multimode spectrofluorimeter (Synergy Neo, Biotek, VT USA) at an excitation of 470 nm and an emission filter of 515 nm. The fluorescent activity present in treated and non-treated negative control wells was subtracted from the fluorescent activity in treated and non-treated Cignal NFκB-GFP reporter wells and relative fluorescence activities are expressed as arbitrary units. Due to some unknown reasons the double transfection of NF-κB reporter gene with Small interfering RNA (siRNAp65) could not be attained successfully, hence we showed the siRNAp65 mediated knock down activity of NF-κB protein expression in A549 cells under hypoxia by Western blotting.

5.14.3. In vivo studies (AFC) The in vivo study was conducted as described by Li et al (Li et al., 2014) and Sakuma et al (Sakuma et al., 2004) with some modifications. Briefly, rats were anesthetized by intramuscular administration of urethane (1.2 gm/Kg) and an endotracheal tube was inserted through a tracheotomy. The rats were exsanguinated through the abdominal aorta. The trachea, lungs and heart were excised and placed in a humidified incubator at 370 C. The lungs were ventilated with 100 % nitrogen. Ringer lactate solution (5 ml/kg) containing 5 % albumin and Evans blue dye (0.15 mg/ml) was injected into the alveolar spaces through the endotracheal tube. After injection, the lungs were inflated with 100 % nitrogen at an airway pressure of 7 cm H2O. Alveolar fluid was aspirated 1 h after injection. The concentrations of Evans blue-labeled albumin in the injected and aspirated solutions were measured by a spectrophotometer at 621 nm. Clearance is expressed as a percentage

5.13.2. NF-κB gene silencing in A549 cells using siRNAp65 Transfection of siRNA oligonucleotides applying the Lipofectamine RNAiMAX method (Invitrogen, Carlsbad, CA) small interfering RNA (p65 siRNA; Santa Cruz) was transiently transfected into A549 cells as per manufacturer's instructions to deplete the expression of NF-kB. The cells were then exposed to hypoxia (6 h).The normalization of transfection efficiency was evaluated by a Fluorescein Conjugate-A siRNA (Santa Cruz Biotechnology) used as negative control and confirmed by fluorescence microscopy. 15

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al.

of total instilled volume cleared. AFC was estimated by the progressive increase in the concentration of alveolar Evans blue-labeled albumin and calculated as follows: AFC = [(Vi -Vf)/ Vi]×100, and Vf = Vi×Pi / Pf. Vi is the volume of injected albumin solution, and Vf is the volume of final alveolar fluid. Pi is the concentration of Evans blue in the injected albumin solution and Pf is the concentration of Evans blue in the final alveolar fluid.

Acknowledgments

5.15. Statistical analysis

Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.resp.2019.103336.

We greatly acknowledge our sincere gratitude to the Director, DIPAS, DRDO, India, for rendering all the support and facilities to conduct this study. Appendix A. Supplementary data

SPSS for windows (15.0) software (SPSS Inc., Chicago, IL) was used to obtain the statistical analysis. Two ways analysis of variance (ANOVA) was applied to get the comparison between experimental groups and curcumin treated groups along with student Newman-Klaus and/or Turkey's multiple comparison tests were conducted to determine the potential statistical differences between the groups. p < 0.05 was considered as statistically significant. Results were represented as mean ± SD.

References Koval, M., 2009. Tight junctions, but not too tight: fine control of lung permeability by claudins. Am. J. Physiol. Lung Cell Mol. Physiol. 297, 217–218. Tibor, B., Zsolt, R., 2004. High altitude and free radicals. J. Sports Sci. Med. 3, 64–69. Rokkam, D., Lafemina, M.J., Lee, J.W., Matthay, M.A., Frank, J.A., 2011. Claudin-4 levels are associated with intact alveolar fluid clearance in human lungs. Am. J. Pathol. 179 (3), 1081–1087. Wray, C., Mao, Y., Pan, J., Chandrasena, A., Piasta, F., Frank, J.A., 2009. Claudin-4 augments alveolar epithelial barrier function and is induced in acute lung injury. Am. J. Physiol. Lung Cell Mol. Physiol. 297, L219–27. Tomita, K., Barnes, P.J., Adcock, I.M., 2003. The effect of oxidative stress on histone acetylation and IL-8 release. Biochem. Biophys. Res. Commun. 301, 572–577. Youakim, A., Ahdieh, M., 1999. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. Am. J. Physiol. 276, G1279–G1288. Oshima, T., Laroux, F.S., Coe, L.L., Morise, Z., Kawachi, S., Bauer, P., Grisham, M.B., Specian, R.D., Carter, J.P.S., Granger, D.N., Joh, T., Alexander, J.S., 2001. Interferongamma and interleukin-10 reciprocally regulate endothelial junction integrity and barrier function. Microvasc. Res. 61, 130–143. Umeda, K., Ikenouchi, J., Katahira, Tayama, S., Furuse, K., Sasaki, H., Nakayama, M., Matsui, T., Tsukita, S., Furuse, M., Tsukita, S., 2006. ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation. Cell 126, 741–754. Patricia, S., Julio, B., Eduardo, P., 2018. Reactive oxygen species and pulmonary vasculature during hypobaric hypoxia. Front. Physiol. 9, 865. Stream, J.O., Grissom, C.K., 2008. Update on high-altitude pulmonary edema: pathogenesis, prevention, and treatment. Wilderness Environ. Med. 19, 293–303. Zhuo, Y., He, Y., Leung, K., Hou, F., Li, Y.Q., ChaiF, G.J., 2010. Dexamethasone disrupts intercellular junction formation and cytoskeleton organization in human trabecular meshwork cells. Mol. Vis. 16, 61–71. Brown, R., Davis, 2002. Calcium modulation of adherens and tight junction function: a potential mechanism for blood-brain barrier disruption after stroke. Stroke 33 (6), 1706–1711. Sarada, S.K.S., Himadri, P., Mishra, C., Geetali, P., Ram, M.S., Ilavazhagan, G., 2008. Role of oxidative stress and NF-κB in hypoxia-induced pulmonary edema. Exp. Biol. Med. 233, 1088–1098. Mathew, T., Sarada, S.K.S., 2015. Attenuation of NF-κB activation augments alveolar transport proteins expression and activity under hypoxia. Int. J. Sci. Res. 4 (3), 2230–2237. Kunnumakkara, A.B., Bordoloi, D., Padmavathi, G., Monisha, J., Roy, N.K., Prasad, S., Aggarwal, B.B., 2017. Curcumin, the golden nutraceutical: multitargeting for multiple chronic diseases. Br. J. Pharmacol. 174 (11), 1325–1348. Zhou, H., Beevers, C.S., Huang, S., 2011. The targets of curcumin. Curr. Drug Targets 12 (3), 332–347. Julie, S.J., 2009. Anti-inflammatory properties of curcumin, a major constituent of Curcuma longa: a review of preclinical and clinical research. Altern. Med. Rev. 14 (2), 141–152. Radha, K.M., Anoop, K.S., Jaya, G., Rikhab, C.S., 2006. Multi biological activities of curcumin: a short review. Life Sci. 78, 2081–2087. Sarada, S.K.S., Mathew, T., Patir, H., 2014. Prophylactic administration of curcumin abates the incidence of hypobaric hypoxia induced pulmonary edema in rats: a Molecular Approach. J. Pulm. Respir. Med. 4, 164. Brennan, P., O’Neill, L.A., 1998. Inhibition of nuclear factor kappaB by direct modification in whole cells—mechanism of action of nordihydroguaiaritic acid, curcumin and thiol odifiers. Biochem. Pharmacol. 55, 965–973. Ebnet, K., Suzuki, A., Ohno, S., Dietmar, V., 2004. Junctional adhesion molecules (JAMs): more molecules with dual functions? J. Cell. Sci. 117, 19–29. Günzel, D., Alan, Y.U., 2013. Claudin and the modulation of tight junction permeability. Physiol. Rev. 93 (2), 525–569. Van Uden, P., Kenneth, N.S., Sonia, R., 2008. Regulation of hypoxia-inducible factor-1α by NF-κB. Biochem. J. 412, 477–484. Rius, J., Guma, M., Schachtrup, C., Akassoglou, K., Zinkernagel, A.S., Nizet, V., Johnson, R.S., Haddad, G.G., Karin, M., 2008. NF-kappa B links innate immunity to the hypoxic response through transcriptional regulation of HIF-1alpha. Nature 453, 807–811. Chawla, S., Rahar, B., Singh, M., Bansal, A., Saraswat, Saxena, 2014. Exogenous sphingosine-1-phosphate boosts acclimatization in rats exposed to acute hypobaric hypoxia: assessment of haematological and metabolic effects. PLoS One 9 (6), 98025. Himadri, P., Sarada, S.K., Chitharanjan, M., Dhananjay, S., 2010. Role of oxidative stress and inflammation in hypoxia-induced cerebral edema a molecular approach. High Alt. Med. Biol. 11, 231–244.

Funding This study was carried out under the project entitled "Improving performance under different operational environments using suitable interventions" funded by the Defence Research and Development Organization, Government of India. Grant No: DIP-265. Authors’ contribution Sarada SKS conceived and designed the experiments. Titto M, Ankit T and Saumya B carried out the hypoxia exposure experiments. Titto M, Sarada SKS, Ankit T, Gausal AK and Saumya B performed all the biochemical analysis. The manuscript was prepared by Sarada SKS and Titto M. All the graphs and tables were prepared by Titto M, Ankit T, Gausal AK and Sarada SKS. All the authors read and approved the final manuscript. Research involving human participants and/or animals This article does not contain any studies related with human participants performed by any of the authors. This article contains only animal and cell line studies. Informed consent All authors agreed for publication of this article. Ethical approval All the experimental protocols used in this study were sanctioned bythe Institute’s ethics committee (IEC). We have followed the guidelines mentioned in Universities of Federation for Animal Welfare (UFAW) for doing animal research. Availability of data and materials The data supporting our results in the manuscript has been clearly mentioned in the Materials and Methods section of the main paper. Supporting files have been uploaded with this manuscript to represent some of the data. All the data presented here is in machine readable format. Declaration of Competing Interest The authors declare no competing interests. 16

Respiratory Physiology & Neurobiology 274 (2020) 103336

T. M, et al. Tyagi, N., Moshal, K.S., Sen, U., Vacek, T.P., Kumar, M., Hughes Jr., W.M., Kundu, S., Tyagi, S.C., 2009. H2S protects against methionine-induced oxidative stress in brain endothelial cells. Antioxid. Redox Signal. 11, 25–33. Rana, A.S., Michel, B., Thomas, M., 2009. Mechanism of cytokine modulation of epithelial tight junction barrier. Front Biosci. 14, 2765–2778. Ward, C., Schlingmann, B.L., Stecenko, A.A., Guidot, D.M., Koval, M., 2015. NF-κB inhibitors impair lung epithelial tight junctions in the absence of inflammation. Tissue Barriers 3, 1–2. Asha, K., Tyagi, N., Dash, D., Rashmi, S., 2014. Intranasal curcumin ameliorates lipopolysaccharide-induced acute lung injury in mice. Inflammation 12, 34–41. Bolton, S.J., Anthony, D.C., Perry, V.H., 1998. Loss of the tight junction proteins occludin and zonula occludens-1 from cerebral vascular endothelium during neutrophil-induced blood-brain barrier breakdown in vivo. Neuroscience 86, 1245–1257. Balamayooran, G., Batra, S., Balamayooran, T., Shanshan, C., 2011. Samithamby. MCP-1 regulates pulmonary host defense via neutrophil recruitment during Escherichia coli infection. Infect. Immun. 79 (7), 2567–2577. Gorlach, Bonello, 2008. The cross-talk between NF-kappaB and HIF-1: further evidence for a significant liaison. Biochem. J. 412, 17–19. Bouvry, D., Planes, C., Malbert, C.L., Escabasse, V., Clerici, C., 2006. Hypoxia-induced cytoskeleton disruption in alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol. 35, 519–527. Turksen, K., Troy, T.C., 2004. Barriers built on claudins. J. Cell. Sci. 117, 2435–2447. Overgaard, C.E., Leslie, A., Mitchell, M.K., 2012. Roles for claudins in alveolar epithelial barrier function. Ann. N. Y. Acad. Sci. 1257 (1), 167–174. Findley, M.K., Christina, W., Tekla, S., David, M.G., Susan, S.M., Michael, H.K., 2008. Claudin-5 decreases alveolar epithelial barrier function. FASEB J. 22 464.1. Sarada, S.K.S., Titto, M., Himadri, P., Saumya, S., Vijayalakshmi, V., 2015. Curcumin prophylaxis mitigates the incidence of hypobaric hypoxia-induced altered ion channels expression and impaired tight junction protein integrity in rat brain. J. Neuroinflammation 12, 113. Bazzoni, G., 2003. The JAM family of junctional adhesion molecules. Cur. Opn. Cell Biol. 15, 525–530. Palmer, G., Busso, N., Aurrand, L.M., Talabot, A.D., Chobaz, Peclat, V., Zimmerli, C., Hammel, P., Imhof, B.A., Gabay, C., 2007. Expression and function of functional adhesion molecule-C in human and experimental arthritis. Arthritis Res. Ther. 9, R65.

Powell, F.L., Milsom, W.K., Mitchell, G.S., 1998. Time domains of the hypoxic ventilatory response. Respir. Physiol. 112, 123–134. Pawar, Y.B., Bhushan, M., Saurabh, A., Manoj, K., Gunjan, K.I., Jyoti, K., Arvind, K.B., 2012. Bioavailability of a lipidic formulation of curcumin in healthy human volunteers. Pharmaceutics 4, 517–530. Faiz-ul, H., Muhammad, S.R., Muhammad, S.K., Muhammad, A.A., Aroosa, J., Ayesha, N., Chengjian, Y., 2019. Curcumin as an alternative epigenetic modulator: mechanism of action and potential effects. Front. Genet. 10, 514. Cheng, A.L., Hsu, C.H., Lin, J.K., Hsu, M.M., Ho, Y.E., Shen, T.S., Ko, J.Y., Lin, J.T., Lin, B.R., Ming-shiiang, W., Yu, H.S., Jee, S.H., Chen, G.S., Chen, T.M., Chen, C.A., Lai, M.K., Pu, Y.S., Pan, M.H., Wang, Y.J., Tsai, C.C., Hsieh, C.Y., 2001. Phase I clinical trial of curcumin, a chemo preventive agent, in patients with high-risk or pre-malignant lesions. Anticancer Res. 21, 2895–2900. Mishra, J., Ankit, T., Kshipra, M., Sarada, S.K.S., 2017. HPTLC: a tool for determination of curcumin in mammalian samples. Int. J. Pharmacogn. Phytochem. Res. 9 (4), 498–501. Bai, C., She, J., Goolaerts, A., Song, Y., Shen, J., Hong, Q., 2010. Stress failure plays a major role in the development of high-altitude pulmonary edema in rats. Eur. Respr. J. 35, 584–591. Beytut, E., Soznen, M., Erginosoy, E., 2009. Immunohistochemical detection of pulmonary surfactant protein and retro viral antigen in lungs of sheep with pulmonary adenomatoris. J. Comp. Pathol. Ther. 140, 45–53. Turi, G.J., Ellis, R., Wattie, J.N., Labiris, N.R., Inman, M.D., 2011. The effects of inhaled house dust mite on airway barrier function and sensitivity to inhaled methacholine in mice. Am. J. Physiol. Lung Cell Mol. Physiol. 300, L185–90. Tang, M., Tian, Li.D., Lv, J., Li, Q., Kuang, C., Hu, P., Wang, Y., Wang, J., et al., 2014. TNF-α mediated increase of HIF-1α inhibits VASP Expression, which reduces alveolar-capillary barrier function during acute lung injury (ALI). PLoS One 9 (7), e102967. Li, G., Flodby, Per, Luo, J., Kage, H., Sipos, A., Gao, D., Ji, Y., Beard, L.L., Crystal, N., et al., 2014. Knockout mice reveal key roles for claudin 18 in alveolar barrier properties and fluid homeostasis. Am. J. Resp. Cell Mol. Biol. 51 (2), 210–222. Sakuma, T., Zhao, Y., Sugita, M., Sagawa, M., Toga, H., Ishibashi, T., Nishio, Matthay, M.A., 2004. Malnutrition impairs alveolar fluid clearance in rat lungs. Am. J. Physiol. Lung Cell Mol. Physiol. 286, L1268–L1274.

17