Curcumin protects against hyperosmoticity-induced IL-1β elevation in human corneal epithelial cell via MAPK pathways

Experimental Eye Research 90 (2010) 437e443

Contents lists available at ScienceDirect

Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer

Curcumin protects against hyperosmoticity-induced IL-1b elevation in human corneal epithelial cell via MAPK pathways Min Chen a, Dan-Ning Hu a, *, Zan Pan b, Cheng-Wei Lu a, Chun-Yan Xue a, Ivar Aass a a b

Tissue Culture Center, Department of Pathology, New York Eye and Ear Infirmary, 310 E. 14th Street, New York, NY 10003, USA Department of Biological Sciences, State University of New York, College of Optometry, 33 W. 42nd Street, New York, NY 10036, USA

a r t i c l e i n f o

a b s t r a c t

Article history: Received 26 June 2009 Accepted in revised form 10 December 2009 Available online 23 December 2009

Increased tear osmolarity is an essential feature of dry eye disease. Curcumin, a natural polyphenol extracted from herb turmeric, has recently been reported to have anti-inflammatory effects. However, its anti-inflammatory effects have not been investigated in dry eye disease. It has been reported that elevated osmolarity achieved by adding sodium chloride to the culture medium of corneal epithelial cells increased the production of IL-1b, a proinflammation cytokine. This in vitro dry eye model was used to test the antiinflammatory effects of curcumin. In the present study, a 450 mOsM hyperosmotic medium was produced by adding sodium chloride to the culture medium to reach a final concentration of 90 mM. Human corneal epithelial cells cultured in this hyperosmotic medium for 24 h showed an increase of IL-1b, IL-6 and TNF-a levels in the conditioned medium. IL-1b was also upregulated at mRNA levels. Activation of p38 MAP kinase (p38), JNK MAP kinase (JNK) and NF-kB in cultured corneal epithelial cells were also induced by hyperosmotic conditions. Curcumin at concentrations of 1e30 mM did not affect the cell viability of cultured corneal epithelial cells. Pretreatment of curcumin (5 mM) completely abolished the increased production of IL-1b induced by the hyperosmotic medium. Increased phosphorylation of p38 caused by high osmolarity was also completely abolished by curcumin, whereas the phosphorylation of JNK was only partially inhibited. SB 203580 (p38 inhibitor), but not SP 600125 (JNK inhibitor), completely suppressed hyperosmoticity-induced IL-1b production, indicating that the inhibition of production of IL-1b by curcumin may be achieved through the p38 signal pathway. Curcumin completely abolished a hyperosmoticity-induced increase of NF-kB p65. NF-kB inhibitor suppressed hyperosmoticity-induced IL-1b production. p38 inhibitor suppressed hyperosmoticity-induced NF-kB activation, indicating that NF-kB activation was dependent on p38 activation. The present study suggests that curcumin might have therapeutic potential for treating dry eye disease. Ó 2009 Elsevier Ltd. All rights reserved.

Keywords: curcumin corneal epithelial cell hyperosmoticity IL-1 b JNK MAP kinase p38 MAP kinase NF-kB

1. Introduction Dry eye disease is a common eye disorder, affecting over ten million people in the United States (Niederkorn et al., 2006). Dry eye syndrome is attributable to disorders of the tear film and ocular surface (International Dry Eye WorkShop, 2007). Inadequate secretion of tears and increased tear evaporation are two major causes of dry eye disease. Two common mechanisms contributing to the pathogenesis of ocular surface injury in dry eye disease are tear hyperosmoticity and ocular surface inflammation (Brignole et al., 2000; Gao et al., 2004; Li et al., 2004; Pflugfelder, 2004; Johnson and Murphy, 2004; Zoukhri, 2006; International Dry Eye WorkShop, * Correspondence to: Dan-Ning Hu, Tissue Culture Center, Department of Ophthalmology, New York Eye and Ear infirmary, 310 E. 14th Street, New York, NY 10003, USA. Tel.: þ1 212 979 4148; fax: þ1 212 677 1284. E-mail address: [email protected] (D.-N. Hu). 0014-4835/$ e see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.exer.2009.12.004

2007). Evidence linking ocular surface inflammation to dry eye disease include: (1) the over-expression of inflammatory markers such as HLA-DR gene in the ocular surface of dry eye disease patients (Tsubota et al., 1999; Brignole et al., 2000; Barabino et al., 2003; Rolando et al., 2005). (2) elevated expression and production of proinflammatory cytokines (such as IL-1b, IL-6, TNF-a and INF-g) in both dry eye patients and experimental dry eye models (Solomon et al., 2001; Luo et al., 2004; De Paiva et al., 2007; Zoukhri et al., 2007; Li et al., 2008; Chotikavanich et al., 2009). (3) anti-inflammatory therapy is effective in treating dry eye disease. An in vitro dry eye model induced by hyperosmotic stress has been developed to investigate dry eye disease (Li et al., 2004, 2006; Luo et al., 2007; Corrales et al., 2008). Various anti-inflammatory drugs such as topical corticosteroid are routinely used in dry eye disease treatment. Clinical evidence indicates that topical corticosteroid significantly improves both the signs and symptoms of dry eye disease in short term trials. However,

438

M. Chen et al. / Experimental Eye Research 90 (2010) 437e443

the potential of adverse effects limits its long term use (International Dry Eye WorkShop, 2007). An immunomodulatory agent, topical cyclosporin A, demonstrated in a recent study to be effective against dry eye disease (International Dry Eye WorkShop, 2007). However, the development of more effective drugs for the treatment of dry eye disease is still required. Curcumin (diferuloylmethane) is a natural substance derived from the rhizome of the plant Curcuma longa. It exhibits anti-inflammatory, anti-viral and anti-cancer properties. Curcumin is widely used in East Asian countries (Nakamura et al., 2002). Curcumin intake has been proven to be safe at doses as high as 2.0e2.5 g per day (Strimpakos and Sharma, 2008). The effects of curcumin on dry eye disease still remain unknown. Therefore, the present study is designed to investigate the potential value of curcumin in treating dry eye disease using an in vitro hyperosmoticity-induced dry eye model. 2. Materials and methods 2.1. Reagent Defined K-SFM medium, fetal bovine serum (FBS), phosphate buffered saline (PBS), 0.02% ethylenediamine tetra acetic acid (EDTA), 0.05% trypsin-0.02% EDTA solution (TE), L-glutamine and gentamicin were purchased from Gibco (Grand Island, NY, USA). Sodium chloride (NaCl), curcumin, 3-[4,5-dimethylthiazol-2-yl]-2,5diphenyl tetrazoliumbromide (MTT), dimethyl sulfoxide (DMSO), p38 MAP kinase (p38) inhibitor SB 203580, JNK MAP kinase (JNK) inhibitor SP 600125 and NF-kB inhibitor Bay 11-7082 were purchased from Sigma (St Louis, Missouri, USA). 2.2. Cell culture The SV40-adenovirus-immortalized human corneal epithelial cell line, a generous gift from Dr. Peter Reinach (State University of New York, New York, USA) was grown in defined K-SFM medium supplemented with 10% FBS, L-glutamine (2 mM) and gentamicin (50 mg/ml). Cells were incubated in a CO2-regulated incubator in a humidified 95% air/5% CO2 atmosphere. After the culture reached confluence, cells were detached with TE and seeded into 96 well, 24 well and 6 well plates (Corning, NY, USA) at a density of 4.0  103 cells, 5  104 cells and 5  105 cells, respectively. 2.3. Cell viability assay After implanting into 96 well plates for 24 h, cells were placed in serum-free medium. Curcumin was added at final concentrations of 1, 3, 5, 10, 30 and 50 mM. Both controls (without curcumin) and curcumin treated cells were incubated for an additional 24 h. Subsequently, cells were incubated with 0.3 mg/ml of MTT for 4 h. The MTT solution was then aspirated and 100 ml DMSO was then added to the cultures. The 96 well plates were read by microplate spectrophotometer (Multiskan MCC/340, Fisher Scientific, Pittsburgh, PA, USA) at 540 nm. The control group measurement was standardized as 100% viability. 2.4. IL-1b, IL-6 and TNF-a measurements Cells were seeded on 24 well plates at a density of 5  104 cells. After 24 h, the medium was replaced with a serum-free K-SFM medium. Curcumin was dissolved in DMSO and added into the cultures at a final concentration of 5 mM. After the cells were cultured for 24 h, culture medium was collected for the measurement of IL-1b and compared with the controls (cells cultured without curcumin).

In testing the effects of hyperosmoticity on IL-1b production, hyperosmoticity (450 mOsM) was achieved by adding NaCl to reach a final concentration of 90 mM (Li et al., 2004; Luo et al., 2007). The osmolarity of the solutions was measured by Osmette Osmometer (Precision System, Natick, MA, USA). Cells were exposed to the hyperosmotic medium for 24 h; and then culture medium was collected for the measurement of IL-1b and compared with cells cultured in isomolar medium. In testing the effects of curcumin on hyperosmoticity-induced IL-1b production, curcumin (5 mM) was added 30 min before exposure to the hyperosmotic medium. In studying the effects of various signal pathway inhibitors on the hyperosmoticity-induced IL-1b production, p38 inhibitor (SB 203580, 20 mM), JNK inhibitor (SP 600125, 25 mM) or NF-kB inhibitor (Bay 11-7082, 5 mM) were added 30 min before exposure to the hyperosmotic medium separately. In testing the effects of hyperosmoticity on IL-6 and TNF-a production, cells were exposed to the hyperosmotic medium for 24 h. In testing the effects of curcumin on hyperosmoticity-induced IL-6 and TNF-a production, curcumin (5 mM) was added 30 min prior to exposing the cells to the hyperosmotic medium. All the conditioned media were centrifuged at 800  g for 5 min and the supernatants were transferred to vials and stored at 70  C until the measurements of various cytokines. IL-1b, IL-6 and TNF-a concentrations were measured in triplicate by using recombinant human IL-1b, IL-6 and TNF-a ELISA kits (R&D System, Minneapolis, MN, USA) with accordance to manufacturer's instructions and were expressed in pg/ml. 2.5. RNA isolation and RT-PCR Cells were seeded into 6 well plates at a density of 5  105. After 24 h, curcumin (5 mM) was added. After 30 min, cells were exposed to the hyperosmotic medium for 30 min, the cultures were washed with cold PBS and cells were harvested by scraping with a rubber policeman. Cells cultured in isomolar medium were used as negative controls. Cells cultured in hyperosmotic medium without curcumin were used as positive controls. After microcentrifuging at 800  g for 5 min, cell pellets were collected for mRNA extraction. Total RNA was isolated with the RNeasy mini kit (QIAGEN, Valencia, CA), according to the manufacturer's instructions. The SuperScriptÔ first-strand synthesis system for RT-PCR kit (Invitrogen, USA) was used to perform cDNA synthesis. The PCR primers for glyceraldehyde-3phosphate dehydrogenase (GAPDH) were designed from a published human gene sequence (Li et al., 2006) (Table 1). The first-strand cDNAs were synthesized from 1 mg of total RNA at 50  C for 50 min. PCR amplification was conducted in a GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA) using the following parameters: first denaturation at 94  C for 5 min followed by 35 cycles of reactions of denaturation at 94  C for 30 s, annealing at 58  C for 45 s, and extension at 72  C for 45 s, and last extension for 5 min at 72  C. 2.6. p38 and JNK Map kinase assay Cells were seeded into 6 well plates at a density of 5  105. After 24 h, curcumin (5 mM) was added. After 30 min, cells were exposed to hyperosmotic medium for 30 min, the cultures were washed with cold PBS and cells were harvested by scraping with a rubber policeman. Cells cultured in isomolar medium were used as negative controls. Cells cultured in hyperosmotic medium without curcumin were used as positive controls. Extractions of proteins were performed as previously described (Hashimoto et al., 1999). After microcentrifuging for 5 min at 4  C, pellets were treated with icecold Cell Extraction Buffer (Biosource, Camarillo, CA, USA) with Protease Inhibitor Cocktail (Sigma) and PMSF (Biosource) for 30 min, with subsequent vortexing at 10 min intervals. Cell extractions were

M. Chen et al. / Experimental Eye Research 90 (2010) 437e443

439

Table 1 RT-PCR primer designs. Gene

Accession

Forward

Reverse

Product

IL-1b GAPDH

M15330 M33197

TGAACTGAAAGCTCTCCACC GCCAAGGTCATCCATGACAAC

CTGATGTACCAGTTGGGGAA GTCCACCACCCTGTTGCTGTA

297 bp 498 bp

microcentrifuged for 30 min at 4  C. The supernatants were collected into vials and stored at 70  C until analysis. Phosphorylated p38 and JNK measurements were performed in triplicate by using p38 and JNK ELISA kits (Biosource), according to the protocol outlined by the manufacturer and were expressed as percentages of the control (cells not exposed to hyperosmotic medium). 2.7. Nuclear extracts and NF-kB p65 measurement Cells were seeded into 6 well plates at a density of 5  105. After 24 h, curcumin (5 mM) or p38 inhibitor (SB 203580, 20 mM) were added. After 30 min, cells were exposed to hyperosmotic medium for 30 min, the cultures were washed with cold PBS and cells were harvested by scraping with a rubber policeman. Cells cultured in isomolar medium were used as negative controls. Cells cultured in hyperosmotic medium without curcumin were used as positive controls. Nuclear extracts were prepared by using a nuclear extraction kit (Biosource). Cell suspension was centrifuged for 5 min at 4  C, and the pellets were treated with cold Hypotonic Cell Lysis Buffer (Biosource) for 15 min. After treating with detergent (10% NP40), cells were vortexed at 10 min intervals. The homogenate was centrifuged for 10 min at 2000  g at 4  C. Cell pellets were resuspended in Cell Extraction Buffer (Biosource) for 30 min at 4  C. Nuclear proteins were isolated by centrifugation at 14,000  g for 15 min. Nuclear extracts were collected and stored at 80  C until used for NF-kB p65 analysis. NF-kB p65 measurements were performed in triplicate by using NF-kB p65 ELISA kit (Biosource), according to the manufacturer's instruction and were expressed as percentages of the controls (cells not exposed to hyperosmotic medium). 2.8. Statistical analysis Data analysis was performed using statistical package SPSS 11.0. Statistical significance was analyzed using analysis of One-way ANOVA with Post Hoc tests and Bonferroni correction. P values less than 0.05 were considered as significant. 3. Results

cells cultured with and without hyperosmotic medium was statistically significant (P < 0.01) (Fig. 2). By pretreating with 5 mM of curcumin for 30 min, hyperosmoticity-induced IL-1b levels were completely abolished. IL-1b concentrations in curcumin treated cultures were 8.79  3.74 pg/ ml, which showed no significant difference from cells cultured in isomolar medium (P > 0.05) (Fig. 2). In the cells cultured in isomolar medium, curcumin did not affect IL-1b levels in the conditioned medium (Fig. 2). By pretreating with p38 inhibitors (SB 203580, 20 mM) for 30 min, hyperosmoticity-induced increase of IL-1b was also completely abolished. IL-1b concentrations were 8.66  4.04 pg/ml in p38 inhibitor treated cultures, which showed no significant difference from cells cultured in isomolar culture medium (P > 0.05) (Fig. 2). JNK inhibitor (SP 600125, 25 mM) failed to affect hyperosmoticityinduced increase of IL-1b, which was still significantly higher than cells cultured in isomolar culture medium (P < 0.05) (Fig. 2). NF-kB inhibitor (Bay 11-7082, 5 mM) completely abolished the hyperosmoticity-induced increase of IL-1b. IL-1b concentrations in NF-kB inhibitor treated cultures were 9.24  2.81 pg/ml, which showed no significant difference from cells cultured in isomolar culture medium (P > 0.05) (Fig. 2). Following 24 h exposure to hyperosmotic medium, the concentrations of IL-6 in conditioned culture medium were increased from 44.00  4.27 pg/ml (control) to 157.43  20.43 pg/ml. The difference in IL-6 concentrations between cells cultured with and without hyperosmoticity was statistically significant (P < 0.05) (Fig. 3A). By pretreating with 5 mM of curcumin for 30 min, hyperosmoticity-induced increase of IL-6 was partially abolished. IL-6 concentrations were 86.87  13.11 pg/ml in curcumin treated culture, which showed a significant difference from cells cultured in isomolar culture medium (P < 0.05) (Fig. 3A). Following 24 h exposure to hyperosmotic medium, the concentrations of TNF-a in conditioned culture medium were increased from 20.40  2.77 pg/ml in the controls to 64.63  4.12 pg/ml. The difference in TNF-a concentrations between cells cultured with and without hyperosmoticity was statistically significant (P < 0.05) (Fig. 3B).

3.1. Cell viability assay

3.2. Curcumin reduced hyperosmoticity-induced IL-1b through suppression of both p38 and NF-kB activation A 450 mOsM hyperosmotic medium was produced by supplementing the basic medium with NaCl until a final concentration of 90 mM was achieved. Following 24 h exposure to this medium, the concentrations of IL-1b in conditioned culture medium were increased from 8.10  1.95 (mean  SD) pg/ml in the controls to 18.43  1.57 pg/ml. The difference in IL-1b concentrations between

120%

Cell Viability (%)

Cell viability of cultured human corneal epithelial cells treated with curcumin at concentrations of 1, 3, 5, 10 and 30 mM for 24 h did not show a significant difference, as compared with cells cultured without curcumin (P > 0.05) (Fig. 1). Therefore, we used 5 mM curcumin in all of the experiments in this study.

100% 80% 60% **

40% 20% 0%

0

1

3

5

10

30

50

Curcumin (µ M) Fig. 1. Effects of curcumin on cell viability. Cells were cultured with curcumin at different concentrations for 24 h, cell viability was tested via MTT assay. *P < 0.05, **P < 0.01, n ¼ 3, compared with the controls (cells cultured without curcumin).

440

M. Chen et al. / Experimental Eye Research 90 (2010) 437e443

25 *

*

20 IL-1β (pg ml-1)

* * 15 10 5

m

N

N in +

aC l

aC l

l aC rc u Cu

11 y Ba

SB

20

-7 0

35

82

80

+N

+N aC

+N ac 25 01

60 SP

l

l

in m rc u Cu

Co

nt ro l

0

Fig. 2. Effects of hyperosmoticity, curcumin and various signal pathway inhibitors on secretion of IL-1b by human corneal epithelial cells. IL-1b levels in conditioned media of human corneal epithelial cells exposed to isomolar medium (312 mOsM, the control) and hyperosmotic medium (450 mOsM, created by adding 90 mM NaCl) with or without curcumin (5 mM), p38 MAP kinase inhibitor (SB 203580, 20 mM), JNK MAP kinase inhibitor (SP 600125, 25 mM) or NF-kB inhibitor (Bay 11-7082, 5 mM) for 24 h were measured by ELISA assay. *P < 0.05, **P < 0.01, n ¼ 3, compared with the levels in isomolar medium.

By pretreating with 5 mM of curcumin for 30 min, the hyperosmoticity-induced increase of TNF-a was completely abolished. TNF-a concentrations were 24.33  3.21 pg/ml in curcumin treated culture, which showed no significant difference from cells cultured in isomolar culture medium (P > 0.05) (Fig. 3B). RT-PCR (Fig. 4) showed that the expression of IL-1b mRNA was stimulated in human corneal epithelial cells exposed to hyperosmotic medium and pretreatment with 5 mM of curcumin greatly inhibited IL-1b mRNA expression induced by hyperosmoticity.

IL-6 (pg ml-1)

A 200 180

*

160 140 120 100 80 60 40 20 0

*

Control

B

Curcumin

*

Curcumin+NaCl

3.3. Curcumin suppressed hyperosmoticity-induced tyrosine phosphorylation of p38 and JNK MAP kinases After exposure to a 450 mOsm hyperosmoticity for 1 h, phosphorylated p38 and JNK levels increased to 240.40% and 275.28% of the controls, respectively (P < 0.05) (Figs. 5 and 6). Pretreatment of 5 mM curcumin completely abolished the increase of phosphorylated p38 induced by hyperosmoticity. Phosphorylated p38 levels in cells treated with curcumin and in hyperosmotic medium showed no difference from cells cultured in isomolar medium (P > 0.05) (Fig. 5). Phosphorylated JNK levels in cells treated with curcumin and hyperosmotic medium were 151% of the controls (cells cultured in isomolar medium), which were decreased from JNK levels in cells treated with hyperosmola medium by 45.1%. This level was still significantly greater than that of cells cultured in isomolar medium (Fig. 6).

NaCl

300% 80

* * *

70

*

250%

60

200%

p-p38

TNF-α (pg ml-1)

*

Fig. 4. Effects of hyperosmoticity and curcumin on IL-1b mRNA expression by human corneal epithelial cells. Representative RT-PCR profiles from three experiments showed the mRNA expressions of IL-1b by human corneal epithelial cells exposed to isomolar medium (312 mOsM, the control) and hyperosmotic medium (450 mOsM, created by adding 90 mM NaCl) with or without curcumin (5 mM) for 4 h. GAPDH was used as an internal loading control.

50 40 30

150% 100%

20

50%

10

0%

0 Control

Curcumin

Curcumin+NaCl

NaCl

Fig. 3. Effects of hyperosmoticity and curcumin on secretion of IL-6 (A) and TNF-a (B) by human corneal epithelial cells. Levels of TNF-a and IL-6 in conditioned media of human corneal epithelial cells exposed to isomolar medium (312 mOsM, the control) and hyperosmotic medium (450 mOsM, created by adding 90 mM NaCl) with or without curcumin (5 mM) for 24 h were measured by ELISA assay. *P < 0.05, **P < 0.01, n ¼ 3, compared with the levels in isomolar medium.

Control

Curcumin

Curcumin+NaCl

NaCl

Fig. 5. Effects of hyperosmoticity and curcumin on phosphorylation of p38 in human corneal epithelial cells. Levels of phosphorylation of p38 in human corneal epithelial cells exposed to isomolar medium (312 mOsM, the control) and hyperosmotic medium (450 mOsM) created by adding 90 mM NaCl with or without curcumin (5 mM) for 24 h were measured via ELISA assay. *P < 0.05, **P < 0.01, n ¼ 3, compared with the levels in cells cultured with isomolar medium.

M. Chen et al. / Experimental Eye Research 90 (2010) 437e443

300%

**

250%

p-JNK

200%

**

150% 100% 50% 0% Control

Curcumin

Curcumin+NaCl

NaCl

Fig. 6. Effects of hyperosmoticity and curcumin on phosphorylation of JNK in human corneal epithelial cells. Levels of phosphorylation of JNK in human corneal epithelial cells exposed to isomolar medium (312 mOsM, the control) and hyperosmotic medium (450 mOsM, created by adding 90 mM NaCl) with or without curcumin (5 mM) for 24 h were measured by ELISA assay. *P < 0.05, **P < 0.01, n ¼ 3, compared with the levels in cells cultured with isomolar medium.

3.4. Curcumin suppressed hyperosmoticity-induced NF-kB activation through suppression of p38 phosphorylation Exposure to 450 mOsm hyperosmoticity for 30 min significantly increased NF-kB p65 protein in nuclear extraction (P < 0.05) (Fig. 7). Pretreatment with 5 mM of curcumin inhibited hyperosmoticityinduced increase of NF-kB p65 by 48.40%, while pretreatment with 20 mM of p38 inhibitor SB 203580 inhibited increase of NF-kB p65 by 49.12%, both exhibiting no difference from the controls (cells cultured in isomolar culture medium) (P > 0.05) (Fig. 7). 4. Discussion Hyperosmoticity is well established as a stimulator of inflammation. In a hyperosmotic environment, increased secretion of proinflammatory cytokines such as IL-1b, IL-6 and IL-8 was demonstrated in various cell lines (e.g. increase of IL-1b in human aortic endothelial cell; increase of IL-6 in human intestinal cells, etc.) (Asakawa et al., 1997; Hubert et al., 2004) and experimental animals (IL-1b, IL-6 and TNF-a in mice) (Luo et al., 2004; Li et al., 2008). In the eye, proinflammatory cytokines (IL-1b and TNF-a) were increased in cultured media of human limbal epithelial cells in a dose-dependent manner

250% *

*

NF-kBp65

200%

150%

100%

50%

N aC l

C ur cu m in +N aC l

23 90 63 +N ac l

SB

C ur cu m in

C on tro l

0%

Fig. 7. Effects of hyperosmoticity, curcumin and p38 inhibitor on NF-kB p65 in nuclear human corneal epithelial cells. Levels of NF-kB p65 in the nuclei of human corneal epithelial cells exposed to isomolar medium (312 mOsM, the control) and hyperosmotic medium (450 mOsM, created by adding 90 mM NaCl) with or without curcumin (5 mM) or p38 kinase inhibitors (SB 203580, 20 mM) for 24 h were measured via ELISA assay. *P < 0.05, **P < 0.01, n ¼ 3, compared with the levels in cells cultured with isomolar medium.

441

by adding NaCl to isomolar media for 24 h (Li et al., 2006). In dry eye patients, IL-1b, IL-6 and TNF-a were significantly increased in the tears (Solomon et al., 2001; De Paiva et al., 2007; Zoukhri et al., 2007; Chotikavanich et al., 2009). In the present study, increased production of IL-1b, IL-6 and TNF-a in cultured human corneal epithelial cell was elicited via an in vitro dry eye model produced by supplementing NaCl into isomolar basic medium to reach a 450 mOsm hyperosmoticity. These findings suggest that this dry eye model effectively mimics the actual conditions found in the tear film and corneal surface interface of dry eye disease. In previous studies, curcumin has been reported to have antiinflammatory properties in addition to its anti-virus and anti-cancer properties (Strimpakos and Sharma, 2008). However, in some in vitro experiments, curcumin was reported to be toxic at high concentrations, e.g. at a concentration of 20 mM for monocytic macrophage cells (Chan, 1995). To testify these findings, we examined the doseeresponse effects of curcumin on the viability of human corneal epithelial cells. Curcumin at concentrations up to 30 mM still do not affect cell viability. Therefore, the 5 mM concentration of curcumin was chosen to use as the tested concentration. At a concentration of 5 mM, curcumin was shown to completely abolish the increase of IL-1b, IL-6 and TNF-a proteins as well as IL-1b mRNA induced by hyperosmotic stress. To the best of our knowledge, this is the first report demonstrating that curcumin could abolish the hyperosmoticity-induced production of various cytokines by human corneal epithelial cells. In cells cultured in isomolar culture medium, curcumin did not affect IL-1b levels in the conditioned culture medium, which indicated that curcumin does not inhibit constitutive production of IL-1b by corneal epithelial cells. The mitogen-activated protein kinases (MAPK) signaling pathways play an important role in regulation of the inflammatory responses (Hashimoto et al., 1999; Loitsch et al., 2000; Ouwens et al., 2001; Németh et al., 2002; Hubert et al., 2004; Li et al., 2006). MAPK are regulated by phosphorylation cascades. MAPK include JNK, p38 and extracellular-signal regulated kinase (ERK). ERK is involved in cell survival and proliferation, while p38 and JNK are activated by various extracellular stimuli, including changes in osmolarity (Clermont et al., 2003; Pan et al., 2007). Selective or combined activation of p38 and/or JNK by stimulation of hyperosmoticity was dependent on the cell type (Niswander and Dokas, 2007). Under hyperosmotic conditions, p38 MAP kinase (Hashimoto et al., 1999; Pandey et al., 1999; Loitsch et al., 2000; Németh et al., 2002; Hubert et al., 2004; Niswander and Dokas, 2007), JNK MAP kinase (Yujiri et al., 1998; Li et al., 2006), or both (Duzgun et al., 2000; Corrales et al., 2008; Nielsen et al., 2008) were found to be activated in various cell lines. Hyperosmorality effects on the activation of MAPK are highly cell-specific. In the present study, both p38 and JNK were found to be activated in human corneal epithelial cells stimulated by hyperosmoticity. p38 inhibitor was able to abolish IL-1b increase in human corneal epithelial cells induced by hyperosmotic stress, whereas JNK inhibitor was not. This indicates that increases in the production of cytokines by hyperosmotic stress in corneal epithelial cells are dependent on p38 activation. Previous studies reported that NF-kB was also activated under hyperosmotic stress (Németh et al., 2002; Matsuo et al., 2006). NF-kB mainly includes p65 and p50, both located in the cytoplasm, along with inhibitory molecules (IkBs) in unstimulated cells (Chen et al., 2006). Stimulants such as hyperosmotic stress activate NF-kB and lead to an increase in p50/p65 in the nucleus (Németh et al., 2002; Chen et al., 2006). In this study, NF-kB was found to be activated in human corneal epithelial cells under hyperosmotic conditions. Previous studies have demonstrated that curcumin inhibits inflammatory processes via suppression of MAPK signaling pathways. Depending on the cell type, curcumin suppresses hyperosmoticity activation of p38 and/or JNK. Curcumin inhibited

442

M. Chen et al. / Experimental Eye Research 90 (2010) 437e443

LPS-stimulated p38 activation in mice (Jin and Li, 2007), and inhibited the activation of p38 in an experimental colitis model in mice (Salh et al., 2003; Camacho-Barquero et al., 2007). However, curcumin was also reported to enhance activation of p38 in human monocytes (Rushworth et al., 2006). This indicates that curcumin's effect on the p38 pathway is highly cell-specific. Curcumin inhibits JNK activation in IL-1b-stimulated liver-derived HepG2 cells (Li et al., 2002) and stretch-stimulated myometrial smooth muscle cells (Oldenhof et al., 2002). Activation of MAPK can be induced by increased osmolarity. Hyperosmoticity induces cell shrinkage, which may activate MAPK signaling pathways via various osmosensing structures, e.g. Naþ/Hþ exchanger (Németh et al., 2002; Corrales et al., 2008). Furthermore, curcumin inhibited activation of p38 may be achieved through activation of MAPK phosphatase-1 (MKP-1) which acts as a negative regulator of p38 MAP kinase (Pae et al., 2009). In the present study, it was found that curcumin inhibits hyperosmoticity-induced activation of p38 and JNK. The activation of p38 was completely abolished, while the activation of JNK was only partly suppressed. p38 inhibitor significantly suppressed hyperosmoticity-induced IL-1b production, whereas, JNK inhibitor failed to do so. Therefore, we postulate that hyperosmoticity-induced IL-1b expression is mainly achieved via the p38 pathway in human corneal epithelial cells. Curcumin inhibits hyperosmoticity-induced increase of production of IL-1b in human corneal epithelial cells through inhibition of the p38 pathway. Curcumin was also reported to inhibit inflammatory processes via the NF-kB signaling pathway (Jobin et al., 1999; Gaddipati et al., 2003; Foryst-Ludwig et al., 2004; Shakibaei et al., 2007; Nonn et al., 2007). Therefore, we studied the role of NF-kB activation in the processes of hyperosmoticity-induced IL-1b elevation. Results in the present study showed that NF-kB inhibitor completely abolished hyperosmoticity-induced increase of IL-1b. This indicates that hyperosmoticity-induced increase of IL-1b is dependent on the activation of NF-kB. Curcumin completely abolished the increase of NF-kB p65 caused by hyperosmotic culture medium. In addition, p38 inhibitor was tested to investigate the possible causative relationship between the hyperosmoticity-induced NF-kB activation as well as the p38 activation. In the present study, p38 inhibitor suppressed hyperosmoticity-induced NF-kB activation. This result indicates that hyperosmoticity-induced NF-kB activation is dependent on p38 activation. Therefore, it seems that hyperosmoticity activates the p38 signal pathway, which leads to NF-kB activation and in turn leads to an increased production of IL-1b. This is consistent with the results of previous studies which showed that NF-kB activation in various cell lines via different stimulators is blocked by p38 inhibitor and NF-kB activation is dependent on p38 phosphorylation (Maulik et al., 1998; Zechner et al., 1998; Craig et al., 2000; Woo et al., 2005; Nonn et al., 2007). Curcumin has been successfully applied for treating inflammatory diseases in clinical trials, e.g. ulcerative colitis (Holt et al., 2005), Crohn disease (Holt et al., 2005), rheumatoid arthritis (Deodhar et al., 1980) and chronic anterior uveitis (Lal et al., 1999). This study is the first report to investigate curcumin as a potential therapeutic drug for dry eye disease. Either systemic or local administration of curcumin may serve as a promising antiinflammatory agent and hence a candidate for the treatment of dry eye disease. Acknowledgments Supported by the Bendheim-Lowenstein Family Foundation, New York, NY and the New York Eye and Ear Infirmary Pathology Research Funds. The authors thank Dr. Peter Reinach (State University of New York, New York, USA) for supplying the

SV40-adenovirus-immortalized human corneal epithelial cell line, and Ms. Violete Perez for assistance with manuscript preparation. References Asakawa, H., Miyagawa, J., Hanafusa, T., Kuwajima, M., Matsuzawa, Y., 1997. High glucose and hyperosmoticity increase secretion of interleukin-1 beta in cultured human aortic endothelial cells. J. Diabetes Complications 11, 176e179. Barabino, S., Rolando, M., Camicione, P., Ravera, G., Zanardi, S., Giuffrida, S., Calabria, G., 2003. Systemic linoleic and gamma-linolenic acid therapy in dry eye syndrome with an inflammatory component. Cornea 22, 97e101. Brignole, F., Pisella, P.J., Goldschild, M., De Saint Jean, M., Goguel, A., Baudouin, C., 2000. Flow cytometric analysis of inflammatory markers in conjunctival epithelial cells of patients with dry eyes. Invest. Ophthalmol. Vis. Sci. 41, 1356e1363. Camacho-Barquero, L., Villegas, I., Sánchez-Calvo, J.M., Talero, E., SánchezFidalgo, S., 2007. MAPK p38 pathway modulating COX-2 and iNOS expression in chronic experimental colitis. Int. Immunopharmacol. 7, 333e342. Chan, M.M., 1995. Inhibition of tumor necrosis factor by curcumin, a phytochemical. Biochem. Pharmacol. 49, 1551e1556. Chen, J.T., Chen, P.L., Chang, Y.H., Chien, M.W., Chen, Y.H., Lu, D.W., 2006. Glucosamine sulfate inhibits leukocyte adhesion in response to cytokine stimulation of retinal pigment epithelial cells in vitro. Exp. Eye Res. 83, 1052e1062. Chotikavanich, S., de Paiva, C.S., Li, D.Q., Chen, J.J., Bian, F., Farley, W.J., Pflugfelder, S. C., 2009. Production and activity of matrix metalloproteinase-9 on the ocular surface increase in dysfunctional tear syndrome. Invest. Ophthalmol. Vis. Sci. 50, 3203e3209. Clermont, F., Adam, E., Dumont, J.E., 2003. Survival pathways regulating the apoptosis induced by tumour necrosis factor-alpha in primary cultured bovine endothelial cells. Cell. Signal. 15, 539e546. Corrales, R.M., Luo, L., Chang, E.Y., Pflugfelder, S.C., 2008. Effects of osmoprotectants on hyperosmotic stress in cultured human corneal epithelial cells. Cornea 27, 574e579. Craig, R., Larkin, A., Mingo, A.M., Thuerauf, D.J., Andrews, C., McDonough, P.M., Glembotski, C.C., 2000. p38 MAPK and NF-kappa B collaborate to induce interleukin-6 gene expression and release. Evidence for a cytoprotective autocrine signaling pathway in a cardiac myocyte model system. J. Biol. Chem. 4, 23814e23824. De Paiva, C.S., Villarreal, A.L., Corrales, R.M., Rahman, H.T., Chang, V.Y., Farley, W.J., Stern, M.E., Niederkorn, J.Y., Li, D.Q., Pflugfelder, S.C., 2007. Dry eye-induced conjunctival epithelial squamous metaplasia is modulated by interferongamma. Invest. Ophthalmol. Vis. Sci. 48, 2553e2560. Deodhar, S.D., Sethi, R., Srimal, R.C., 1980. Preliminary study on antirheumatic activity of curcumin (diferuloyl methane). Indian J. Med. Res. 71, 632e634. Duzgun, S.A., Rasque, H., Kito, H., Azuma, N., Li, W., Basson, M.D., Gahtan, V., Dudrick, S.J., Sumpio, B.E., 2000. Mitogen-activated protein phosphorylation in endothelial cells exposed to hyperosmotic conditions. J. Cell. Biochem. 76, 567e571. Foryst-Ludwig, A., Neumann, M., Schneider-Brachert, W., Naumann, M., 2004. Curcumin blocks NF-kappaB and the motogenic response in Helicobacter pylori-infected epithelial cells. Biochem. Biophys. Res. Commun. 16, 1065e1072. Gaddipati, J.P., Sundar, S.V., Calemine, J., Seth, P., Sidhu, G.S., Maheshwari, R.K., 2003. Differential regulation of cytokines and transcription factors in liver by curcumin following hemorrhage/resuscitation. Shock 19, 150e156. Gao, J., Morgan, G., Tieu, D., Schwalb, T.A., Luo, J.Y., Wheeler, L.A., Stern, M.E., 2004. ICAM-1 expression predisposes ocular tissues to immune-based inflammation in dry eye patients and Sjögrens syndrome-like MRL/lpr mice. Exp. Eye Res. 78, 823e835. Hashimoto, S., Matsumoto, K., Gon, Y., Nakayama, T., Takeshita, I., Horie, T., 1999. Hyperosmoticity-induced interleukin-8 expression in human bronchial epithelial cells through p38 mitogen-activated protein kinase. Am. J. Respir. Crit. Care Med. 159, 634e640. Holt, P.R., Katz, S., Kirshoff, R., 2005. Curcumin therapy in inflammatory bowel disease: a pilot study. Dig. Dis. Sci. 50, 2191e2193. Hubert, A., Cauliez, B., Chedeville, A., Husson, A., 2004. Lavoinne A osmotic stress, a proinflammatory signal in Caco-2 cells. Biochimie 86, 533e541. International Dry Eye WorkShop, 2007. The definition and classification of dry eye disease: report of the definition and classification Subcommittee of the International Dry Eye WorkShop. Ocul. Surf 5, 75e92. Jin, B., Li, Y.P., 2007. Curcumin prevents lipopolysaccharide-induced atrogin-1/MAFbx upregulation and muscle mass loss. J. Cell. Biochem. 100, 960e969. Jobin, C., Bradham, C.A., Russo, M.P., Juma, B., Narula, A.S., Brenner, D.A., Sartor, R.B., 1999. Curcumin blocks cytokine-mediated NF-kappa B Activation proinflammatory gene expression by inhibiting inhibitory factor I-kappa B kinase activity. J. Immunol. 15, 3474e3483. Johnson, M.E., Murphy, P.J., 2004. Changes in the tear film and ocular surface from dry eye syndrome. Prog. Retin. Eye Res. 23, 449e474. Lal, B., Kapoor, A.K., Asthana, O.P., Agrawal, P.K., Prasad, R., Kumar, P., Srimal, R.C., 1999. Efficacy of curcumin in the management of chronic anterior uveitis. Phytother. Res. 13, 318e322. Li, D., Zimmerman, T.L., Thevananther, S., Lee, H.Y., Kurie, J.M., Karpen, S.J., 2002. Interleukin-1 beta-mediated suppression of RXR: RAR transactivation of the Ntcp promoter is JNK-dependent. J. Biol. Chem. 277, 31416e31422.

M. Chen et al. / Experimental Eye Research 90 (2010) 437e443 Li, D.Q., Chen, Z., Song, X.J., Luo, L., Pflugfelder, S.C., 2004. Stimulation of matrix metalloproteinases by hyperosmoticity via a JNK pathway in human corneal epithelial cells. Invest. Ophthalmol. Vis. Sci. 45, 4302e4311. Li, D.Q., Luo, L., Chen, Z., Kim, H.S., Song, X.J., Pflugfelder, S.C., 2006. JNK and ERK MAP kinases mediate induction of IL-1beta, TNF-alpha and IL-8 following hyperosmotic stress in human limbal epithelial cells. Exp. Eye Res. 82, 588e596. Li, S., Nikulina, K., DeVoss, J., Wu, A.J., Strauss, E.C., Anderson, M.S., McNamara, N.A., 2008. Small proline-rich protein 1B (SPRR1B) is a biomarker for squamous metaplasia in dry eye disease. Invest. Ophthalmol. Vis. Sci. 49, 34e41. Loitsch, S.M., von Mallinckrodt, C., Kippenberger, S., Steinhilber, D., Wagner, T.O., Bargon, J., 2000. Reactive oxygen intermediates are involved in IL-8 production induced by hyperosmotic stress in human bronchial epithelial cells. Biochem. Biophys. Res. Commun. 276, 571e578. Luo, L., Li, D.Q., Doshi, A., Farley, W., Corrales, R.M., Pflugfelder, S.C., 2004. Experimental dry eye stimulates production of inflammatory cytokines and MMP-9 and activates MAPK signaling pathways on the ocular surface. Invest. Ophthalmol. Vis. Sci. 45, 4293e4301. Luo, L., Li, D.Q., Pflugfelder, S.C., 2007. Hyperosmoticity-induced apoptosis in human corneal epithelial cells is mediated by cytochrome c and MAPK pathways. Cornea 26, 452e460. Matsuo, H., Tamura, M., Kabashima, N., Serino, R., Tokunaga, M., Shibata, T., Matsumoto, M., Aijima, M., Oikawa, S., Anai, H., Nakashima, Y., 2006. Prednisolone inhibits hyperosmoticity-induced expression of MCP-1 via NF-kappaB in peritoneal mesothelial cells. Kidney Int. 69, 736e746. Maulik, N., Sato, M., Price, B.D., Das, D.K., 1998. An essential role of NFkappaB in tyrosine kinase signaling of p38 MAP kinase regulation of myocardial adaptation to ischemia. FEBS Lett 429, 365e369. Nakamura, K., Yasunaga, Y., Segawa, T., Ko, D., Moul, J.W., Srivastava, S., Rhim, J.S., 2002. Curcumin down-regulates AR gene expression and activation in prostate cancer cell lines. Int. J. Oncol. 21, 825e830. Németh, Z.H., Deitch, E.A., Szabó, C., Haskó, G., 2002. Hyperosmotic stress induces nuclear factor-kappaB activation and interleukin-8 production in human intestinal epithelial cells. Am. J. Pathol. 161, 987e996. Niederkorn, J.Y., Stern, M.E., Pflugfelder, S.C., De Paiva, C.S., Corrales, R.M., Gao, J., Siemasko, K., 2006. Desiccating stress induces T cell-mediated Sjögren's syndrome-like lacrimal keratoconjunctivitis. J. Immunol. 176, 3950e3957. Nielsen, M.B., Christensen, S.T., Hoffmann, E.K., 2008. Effects of osmotic stress on the activity of MAPKs and PDGFR-beta-mediated signal transduction in NIH3T3 fibroblasts. Am. J. Physiol. Cell. Physiol. 294, C1046eC1055. Niswander, J.M., Dokas, L.A., 2007. Hyperosmotic stress-induced caspase-3 activation is mediated by p38 MAPK in the hippocampus. Brain Res. 1186, 1e11. Nonn, L., Duong, D., Peehl, D.M., 2007. Chemopreventive anti-inflammatory activities of curcumin and other phytochemicals mediated by MAP kinase phosphatase-5 in prostate cells. Carcinogenesis 28, 1188e1196. Oldenhof, A.D., Shynlova, O.P., Liu, M., Langille, B.L., Lye, S.J., 2002. Mitogen-activated protein kinases mediate stretch-induced c-fos mRNA expression in myometrial smooth muscle cells. Am. J. Physiol. Cell. Physiol. 283, C1530eC1539. Ouwens, D.M., Gomes de Mesquita, D.S., Dekker, J., Maassen, J.A., 2001. Hyperosmotic stress activates the insulin receptor in CHO cells. Biochim. Biophys. Acta 1540, 97e106.

443

Pae, H.O., Jeong, S.O., Zheng, M., Ha, H.Y., Lee, K.M., Kim, E.C., Kim, D.H., Hwang, S.Y., Chung, H.T., 2009. Curcumin attenuates ethanol-induced toxicity in HT22 hippocampal cells by activating mitogen-activated protein kinase phosphatase1. Neurosci. Lett. 453, 186e189. Pan, Z., Capó-Aponte, J.E., Zhang, F., Wang, Z., Pokorny, K.S., Reinach, P.S., 2007. Differential dependence of regulatory volume decrease behavior in rabbit corneal epithelial cells on MAPK superfamily activation. Exp. Eye Res. 84, 978e990. Pandey, P., Avraham, S., Kumar, S., Nakazawa, A., Place, A., Ghanem, L., Rana, A., Kumar, V., Majumder, P.K., Avraham, H., Davis, R.J., Kharbanda, S., 1999. Activation of p38 mitogen-activated protein kinase by PYK2/related adhesion focal tyrosine kinase-dependent mechanism. J. Biol. Chem. 274, 10140e10144. Pflugfelder, S.C., 2004. Antiinflammatory therapy for dry eye. Am. J. Ophthalmol. 137, 337e342. Rolando, M., Barabino, S., Mingari, C., Moretti, S., Giuffrida, S., Calabria, G., 2005. Distribution of conjunctival HLA-DR expression and the pathogenesis of damage in early dry eyes. Cornea 24, 951e954. Rushworth, S.A., Ogborne, R.M., Charalambos, C.A., O'Connell, M.A., 2006. Role of protein kinase C delta in curcumin-induced antioxidant response elementmediated gene expression in human monocytes. Biochem. Biophys. Res. Commun. 341, 1007e1016. Salh, B., Assi, K., Templeman, V., Parhar, K., Owen, D., Gómez-Muñoz, A., Jacobson, K., 2003. Curcumin attenuates DNB-induced murine colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 285, G235eG243. Shakibaei, M., John, T., Schulze-Tanzil, G., Lehmann, I., Mobasheri, A., 2007. Suppression of NF-kappaB activation by curcumin leads to inhibition of expression of cyclo-oxygenase-2 and matrix metalloproteinase-9 in human articular chondrocytes: implications for the treatment of osteoarthritis. Biochem. Pharmacol. 73, 1434e1445. Solomon, A., Dursun, D., Liu, Z., Xie, Y., Macri, A., Pflugfelder, S.C., 2001. Pro- and anti-inflammatory forms of interleukin-1 in the tear fluid and conjunctiva of patients with dry-eye disease. Invest. Ophthalmol. Vis. Sci. 42, 2283e2292. Strimpakos, A.S., Sharma, R.A., 2008. Curcumin: preventive and therapeutic properties in laboratory studies and clinical trials. Antioxid. Redox Signal. 10, 511e545. Tsubota, K., Fujihara, T., Saito, K., Takeuchi, T., 1999. Conjunctival epithelial expression of HLA-DR in dry eye patients. Ophthalmologica 213, 16e19. Woo, M.S., Jung, S.H., Kim, S.Y., Hyun, J.W., Ko, K.H., Kim, W.K., Kim, H.S., 2005. Curcumin suppresses phorbol ester-induced matrix metalloproteinase-9 expression by inhibiting the PKC to MAPK signaling pathways in human astroglioma cells. Biochem. Biophys. Res. Commun. 7, 1017e1025. Yujiri, T., Sather, S., Fanger, G.R., Johnson, G.L., 1998. Role of MEKK1 in cell survival and activation of JNK and ERK pathways defined by targeted gene disruption. Science 282, 1911e1914. Zechner, D., Craig, R., Hanford, D.S., McDonough, P.M., Sabbadini, R.A., Glembotski, C.C., 1998. MKK6 activates myocardial cell NF-kappaB and inhibits apoptosis in a p38 mitogen-activated protein kinase-dependent manner. J. Biol. Chem. 273, 8232e8239. Zoukhri, D., 2006. Effect of inflammation on lacrimal gland function. Exp. Eye Res. 82, 885e898. Zoukhri, D., Macari, E., Kublin, C.L., 2007. A single injection of interleukin-1 induces reversible aqueous-tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation. Exp. Eye Res. 84, 894e904.