CXCR7: A key neuroprotective molecule against alarmin HMGB1 mediated CNS pathophysiology and subsequent memory impairment

Brain, Behavior, and Immunity 82 (2019) 319–337

Contents lists available at ScienceDirect

Brain, Behavior, and Immunity journal homepage: www.elsevier.com/locate/ybrbi

CXCR7: A key neuroprotective molecule against alarmin HMGB1 mediated CNS pathophysiology and subsequent memory impairment Sudeshna Dasa, K.P. Mishrab, Sudipta Chandaa, Lilly Ganjua, S.B. Singhc,

T

⁎

a

Defence Institute of Physiology and Allied Sciences (DIPAS), Defence Research and Development Organisation (DRDO), Lucknow Road, Timarpur, Delhi 110054, India Defence Research and Development Organisation (DRDO), New Delhi 110011, India c National Institute of Pharmaceutical Education and Research (NIPER), Hyderabad 500037, India b

A R T I C LE I N FO

A B S T R A C T

Keywords: HMGB1 Neurodegeneration BBB dysfunction Glia Peripheral immune cell infiltration CXCR7 siRNA AMD3100

High mobility group box 1 (HMGB1) is an endogenous alarmin that drives the pathogenesis of neurodegenerative disorders including cognitive decline. Therefore, HMGB1 is thought to be a common biomarker as well as promising therapeutic target for neuroinflammation associated with neurocognitive disorders. Here, for the first time, we have unmasked the potential inhibitory effect of a novel receptor of HMGB1-CXCL12 complex; atypical chemokine receptor 3 (ACKR3/CXCR7) on HMGB1 induced glial phenotype switching, neuroinflammation, and subsequent memory loss. Upregulation of CXCR7 inhibits HMGB1-CXCL12 complex induced peripheral immune cells infiltration to CNS by regulating blood-brain barrier (BBB) integrity in HMGB1 induced dementia model of mice. Whereas, gene knockdown study by RNA interference (non-invasive intranasal delivery to animal model) shows CXCR7 ablation aggravates inflammatory responses in hippocampus region and immune cell infiltration to CNS tissue by breached BBB. This study also indicates the important role of CXCR7 molecule in maintaining CNS homeostasis by balancing M1/M2 microglia, A1/A2 astrocytes, long term potentiation/long term depression markers which ultimately ameliorates HMGB1 induced neurodegeneration, synaptic depression and memory loss (assessed by both radial arm maze and Morris water maze) in male mice model of dementia. Overall, the study summarizes several significant protective functions afforded by CXCR7 against HMGB1 induced disbalance in neuroimmunological axis, neurodegeneration and memory loss and thereby provides a new paradigm for strategic development of novel therapeutics against neurodegenerative diseases with dementia as a common symptom.

1. Introduction High mobility group box 1 (HMGB1) is a non-histone DNA-binding nuclear protein that serves as an alarmin to drive the pathogenesis of central nervous system (CNS) inflammatory and autoimmune diseases. Cellular actions of HMGB1 depend on its localization, context and posttranslational modification (Harris et al., 2012). As a nuclear molecule, HMGB1 plays a key role in modulating DNA architecture and transcriptional regulation. However, with cellular stress, it can translocate to the cytosol or extracellular space where the molecule acts as a potent damage-associated molecular pattern (DAMP) or alarmin for stimulating the innate immune system either by itself alone or as part of proinflammatory cascade (Andersson and Tracey, 2011). During CNS stress, HMGB1 is released from neuronal, reactive microglial as well as reactive astrocytic cells and acts on some specific receptors of ‘microglia’ in either autocrine or paracrine fashion (Li et al., 2014).

⁎

Extracellular HMGB1 was previously known to mediate microglial activation and subsequent inflammatory responses only via the activation of signaling pathways coupled to TLR4/NF-κB and Receptor for Advanced Glycation End Products (RAGE) (Mazarati et al., 2011; Shi et al., 2018). However, a pioneer finding of 2002 indicated that HMGB1 also acts on microglial scavenger receptor Mac1 and forms the HMGB1Mac1-NADPH oxidase signaling axis bridge to mediate chronic neuroinflammation (Gao et al., 2002). A recent study from our laboratory also showed potent ameliorative effects of intranasal delivery of mac1 siRNA on microglial polarization shift towards M2 (Das et al., 2018). Apart from inflammation, HMGB1 plays a lead role in recruiting inflammatory cells to the site of tissue damage and requires chemokine CXCL12 (stromal cell-derived factor 1) in this recruitment process (Schiraldi et al., 2012). Nuclear magnetic resonance, surface plasmon resonance, and fluorescence resonance energy transfer studies showed the formation of HMGB1-CXCL12 heterocomplex and its mechanism of

Corresponding author. E-mail address: [email protected] (S.B. Singh).

https://doi.org/10.1016/j.bbi.2019.09.003 Received 7 June 2019; Received in revised form 24 August 2019; Accepted 5 September 2019 Available online 07 September 2019 0889-1591/ © 2019 Elsevier Inc. All rights reserved.

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

(Animal facility DIPAS, DRDO, Delhi) during early postnatal (p0-p1) days, with the help of pup brain slicer matrices, neonatal mouse brain atlas and dissecting microscope as guided by Beaudoin et al. (2012). Primary microglial cells derived from early postnatal rodents (p0-p1) exhibit identical cell surface receptor expression and functional characteristics to that seen in microglia in vivo. Cells from five mouse pups, of the same litter were isolated and plated as described by Das et al. (2017). Cells were fully grown for 8–12 days and thereafter divided into different groups according to the experimental requirements as follows: (1) Control: cells were incubated in culture media (DMEM) only. (2) HMGB1: Cells were incubated in different concentrations (100 ng/ml, 250 ng/ml, 500 ng/ml, 750 ng/ml) of recombinant HMGB1 for evaluation of optimum dose, dose-dependent cytotoxicity and altered expression of cellular receptors like CXCR4, CXCR7. (3) CXCR4 siRNA /CXCR7 siRNA: CXCR4/CXCR7 knockdown siRNAs (Accession number- NM_009911.3/NM_007722.3) are transfected by lipofectamine (premixed in 1:1 ratio), for optimum silencing of respective genes. Lipofectamine 2000 in combination with CXCR7/CXCR4 siRNA at different concentrations (1 nM, 5 nM, 8 nM, 10 nM, 25 nM, and 50 nM) were added to serum and antibiotic-free DMEM media and then incubated for 12/24/48/72 h for optimum silencing. (4) Scrambled siRNA: Cells, incubated in serum and antibiotic-free DMEM media and transfected by customized siRNA negative control premixed with lipofectamine (si-control, Invitrogen) for the same time period as CXCR4/ CXCR7 siRNA. (5) HMGB1 + CXCR4 siRNA/CXCR7 siRNA: Cells were incubated in optimum dose of recombinant HMGB1 (after evaluation of optimum dose) and treated with standardized dose of CXCR7/CXCR4 siRNA, 10 min after HMGB1 treatment. (6) HMGB1 + Scrambled siRNA: Cells were incubated in optimum dose of recombinant HMGB1 (after evaluation of optimum dose) and treated with scrambled siRNA (same dose and time period as CXCR4/CXCR7 siRNA), 10 min after HMGB1 treatment. (7) AMD3100 (CXCR7 agonist): Cells were incubated with different doses (50 ng/ml, 100 ng/ml, 250 ng/ml) of AMD3100 for 24 h. (8) HMGB1 + AMD3100: Cells were incubated in optimum dose of recombinant HMGB1 (after evaluation of optimum dose) and treated with standardized dose of AMD3100. (9) HMGB1 + CCX771 (CXCR7 agonist): Cells were incubated with HMGB1 and different doses (50 ng/ml, 100 ng/ml, 250 ng/ml) of CCX771. (10) HMGB1 + VUF11207 (CXCR7 agonist): Cells were incubated with HMGB1 and different concentrations of (50 ng/ml, 100 ng/ml, 250 ng/ml) of VUF11207. (11): HMGB1 + AMD3100 + CXCR4/CXCR7 siRNA: Cells were incubated in optimum dose of recombinant HMGB1 and treated with both AMD3100 and CXCR4/CXCR7 siRNA. Mix primary cultures comprised of 45–50% astrocytes, 35–40% of microglia and 10–20% oligodendrocytes. To isolate pure primary microglial culture, confluent mix cell glial monolayers were detached by shaking the flask for 100–120 min at 150 rpm in a 37 °C incubator (Gao et al., 2002). In microglia enriched culture, more than 95% of the cells were positive to microglial marker (iba1).

action involving conformational rearrangements of CXCR4 receptor. The function of HMGB1/CXCL12/ CXCR4 trio in auto-immune disorders was recently explored (Werner et al., 2013). HMGB1-CXCL12 complex strongly promotes inflammatory cell infiltration during chronic experimental autoimmune disease (Yun et al., 2017) and the level of CXCL12 in the coculture supernatants was found to be dependent on the level of HMGB1. Apart from that CXCL12 is also known to reinforce the astrocytic and microglial activation in autocrine and paracrine manners. Thereby, such HMGB1 induced and CXCL12 derived positive feedback loops of glial activation might facilitate perseverant neuroinflammation within the CNS and subsequent cognitive impairment. CXCR7 or atypical chemokine receptor 3 is a non-classical seven transmembrane-spanning receptor that is regarded as a scavenger or decoy receptor for CXCL12. The original in vivo finding in the zebrafish model indicates that CXCR7 functions primarily by sequestering CXCL12, leading to a CXCL12 gradient formation (Boldajipour et al., 2008). Another study evaluated the effect of CXCR7 agonist on CXCL12CXCR4 induced cellular events and found that CXCR7 up-regulation acts as a negative regulator of CXCR4 by heterodimerizing with CXCR4 and inducing its internalization and degradation (Uto-Konomi et al., 2013). Administration of ACKR3 specific antagonist CCX771, on thecontrary, increases abluminal levels of CXCL12 at the blood-brain barrier. Overall, such a negative correlation of expression between CXCR7 and CXCL12 raised an interesting research question regarding the role of CXCR7 as a therapeutic target for ameliorating HMGB1CXCL12 complex induced neurodegenerative disorders. Deficit of memory, the core feature of neurodegenerative diseases (like Alzheimer’s, schizophrenia and Parkinson’s), is among the cognitive functions most sensitive to decline by old age, external environmental causes, endogenous toxins, and traumas. On the other hand, increased level of endogenous HMGB1 within specific brain regions is a common thread during the pathogenesis of all the above-mentioned neurodegenerative diseases (Fang et al., 2012). Administration of recombinant HMGB1 to naïve animals leads to severe memory impairments, majorly by disbalancing the neuroimmunological axis of CNS and altering the mechanism of synaptic plasticity (Mazarati et al., 2011). Previous studies also exhibited a significant correlation between serum HMGB1 level and amyloid-beta expression within the brain of AD patients (Festoff et al., 2016). Interestingly, serum HMGB1 levels were also found to be significantly elevated in MCI and Parkinson's disease patients. Another very recent study showed that an elevated expression of brain HMGB1 results in a massive apoptosis of neural cells, followed by impaired cognitive functions in septic mice model. At the same time, antagonism of cerebral HMGB1 by administration of neutralizing anti-HMGB1 monoclonal antibody significantly alleviated sepsis-induced memory loss (Ren et al., 2019). But to date, the exact underlying mechanisms of HMGB1 mediated alteration of synaptic plasticity are not known. Thereby, better understanding and selective targeting of HMGB1 mediated alteration of inflammatory, as well as long-term potentiation mechanisms, might be one of the viable strategies for ameliorating the progression of most of the neurodegenerative disorders with memory loss as a common symptom. Here, in this study, we hypothesized that being a negative regulator of HMGB1-CXCL12CXCR4 trio, CXCR7 could have beneficial effects against HMGB1 induced neuroinflammation, neurodegeneration and subsequent memory impairment.

2.1.2. Tetrazolium (MTT) based colorimetric cell viability assay Viability of primary glial cells were assessed by MTT [3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide] assay which is solely dependent on the conversion of compound MTT into a formazan product as described in detail by our previous study (Das et al., 2017). After plating, microglial/ mixed glial cells were exposed to different doses of recombinant HMGB1 (50 ng/ml, 100 ng/ml, 250 ng/ml, 500 ng/ml, 750 ng/ml, 1000 ng/ml), CXCR4/CXCR7/Sc siRNA (1 nM, 2 nM, 5 nM, 10 nM, 20 nM & 50 nM) and AMD3100 (50 ng/ml, 100 ng/ ml, 250 ng/ml, 500 ng/ml) for predetermined periods. 15–20 μl of tetrazolium dye at a concentration of 5 mg/ml was added to each well of the experimental plate and incubated for an additional 4 h, followed by the addition of dimethyl sulfoxide for dissolving the formazan crystals. plates were then read on ‘BioTek Power wave XS2’ microplate reader at 570 nm.

2. Materials and method 2.1. In vitro study 2.1.1. Primary mix glial/microglial culture and drug treatment Mixed primary glial cells/microglial cells were isolated from brain regions of Swiss albino mice of both sex (sex determined by presence/ absence of a pigment spot on the scrotum and anogenital distance) 320

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

2.2. In vivo study

2.1.3. Flow cytometric analysis of CXCR4 and CXCR7 expression in mixed glial cells After treating the cells with different concentrations of recombinant HMGB1 (100 ng/ml, 250 ng/ml, 500 ng/ml, 750 ng/ml), for a predetermined time period (24 h), the primary cells were harvested by washing twice in wash buffer and then fixed for 30 min by fixation buffer followed by wash and incubation with anti CXCR7 (BD bioscience), CXCR4 (BD bioscience) antibodies at proper dilutions (according to the manufacturer’s instruction) for required time period. Unbound antibodies were removed by washing with a wash buffer, and the cells were suspended in 0.1 ml of suspension buffer and analyzed (50,000 events/group) using a flow cytometer (BD FACS Aria) with FlowJo and FACS Diva software.

2.2.1. Animals The experiments were performed in 8–10 weeks old (adult) BALB/c male (as meta-analysis across studies of radial arm maze and Morris water maze showed that in both maze tasks male animals performed better than female animals; Jonasson, 2005) mice weighing 25–32 g. Mice were housed at constant room temperature and fixed 12 h light/ dark cycle with free access to water, food pellets. All experimental protocols followed in this animal study were approved by the institutional animal ethical committee of DIPAS, DRDO following the guidelines of “Committee for the Purpose of Control and Supervision of Experiments on Animals” (CPCSEA). (CPCSEA, Ref. No. IAEC /DIPAS/ 2015-05), Govt. of India. Animals were randomly divided into 7 major groups for both molecular (n = 5 per group) and behavioral (n = 8 per group) studies. Additionally, for AMD3100/CXCR7 siRNA/Sc siRNA dose standardization (n = 5) animals were treated with different doses of drug. The major animal groups were as follows:

2.1.4. Analysis of CXCL-12, TNFα, IL-1β, TGF- β levels at different groups and post-transfection time by ELISA Supernatant level of CXCL-12 (Elabscience USA), TNFα (Peprotech USA), IL-1β (Peprotech USA), TGF- β (Elabscience USA) obtained after treatment from mixed primary glial cultures at different post-transfection time were measured by ELISA.

1. Control group (i.p. saline/ PBS for 1 week). 2. HMGB1 (Mice were treated with recombinant HMGB1 at a dose of 500 μg diluted in 350 μL of PBS 1 × every day, intraperitoneally, for 1 wk, day 1–7). Animals were subjected to behavioral assessment 1 wk later. 3. AMD3100 (AMD3100 was injected intraperitoneally, daily for 7 days (day 1–7), at a dose of 0.5 mg/kg/day) 4. HMGB1 + AMD3100 (Animals injected with HMGB1 and treated with AMD3100) 5. CXCR7 siRNA (3 times intranasal CXCR7 siRNA on day 0, day 3, day 6) 6. HMGB1 + CXCR7 siRNA (Animals injected with HMGB1 and treated with intranasal CXCR7 siRNA) 7. Sc siRNA (3 times intranasal Scrambled siRNA on day 1, day 4, day 7) 8. HMGB1 + Sc siRNA (Animals injected with HMGB1 and treated with intranasal scrambled siRNA).

2.1.5. mRNA analysis of RAGE, Mac-1, TLR4 by real-time PCR Total RNA was extracted from mixed primary glial cells by using RNA isolation kit (Qiagen RNeasy® Protect Mini Kit 50, GmbH, Cat no: 74124) according to the manufacturer’s instruction. After treatment with DNase 1 and quantitative determination by Thermo Scientific™ NanoDrop 2000c (calculated 260/280 ratio of all samples were between 1.9 and 2.1, the ratio of 28S and 18S rRNA were between 2.0:1 and 2.4:1 and the RIN numbers were greater than 7.2), RNA was reverse-transcribed (Qiagen QuantiTect Rev. Transcription Kit, Cat No.: 205313). The transcript of GAPDH was used to confirm the efficiency of cDNA synthesis and normalization of total mRNA input (the expression of GAPDH varied less compared to other loading controls including βactin and 18S). Relative quantitative real-time PCR analysis for each sample was performed on aliquots of cDNA using SYBR green supermix (Cat. No. KK4601). Oligonucleotide primers (forward and reverse) for RAGE, Mac-1, TLR4, and GAPDH were as follows:

2.2.2. HMGB1 induced memory impairment model, AMD3100 treatment and siRNA delivery Peripheral administration of recombinant HMGB1 at a dose of 500 μg to naïve mice is known to cause memory impairment (Chavan et al 2012). In our study, we have administered full length, fully reduced (HMGB1C23hC45hC106h), endotoxin-free (< 0.01 ng/μg cytokine, as determined by the LAL assay) mice recombinant HMGB1. It is produced in E. coli from an expression plasmid coding for the mouse protein. It has the sequence:

RAGE-forward: 5′-GGACCCTTAGCTGGCACTTAGA-3′ RAGE-reverse: 5′‐GAGTCCCGTCTCA-GGGTGTCT‐3′ Mac-1-forward: 5′‐CCTTGTTCTCTTTGATGCAG‐3′ Mac-1-reverse: 5′‐GTGATGACAACTAGGATCTT‐3′ TLR4-forward: 5′-CCTGTAGAGATGAATACCTC-3′ TLR4-reverse: 5′-TGTGGAAGCCTTCCTGGATG-3′ GAPDH-forward: 5′-AGGTCGGTGTGAACGGATTTG-3′ GAPDH-reverse:5′-TGTAGACCATGTAGTTGAGGTCA-3′

MGKGDPKKPR GKMSSYAFFV QTCREEHKKK HPDASVNFSE FSKKCSERWK TMSAKEKGKF EDMAKADKAR YEREMKTYIP PKGETKKKFK DPNAPKRPPS AFFLFCSEYR PKIKGEHPGL SIGDVAKKLG EMWNNTAADD KQPYEKKAAK LKEKYEKDIA AYRAKGKPDA AKKGVVKAEK SKKKKEEEDD EEDEEDEEEE EEEEDEDEEE DDDDE.

2.1.6. Evaluation of phagocytotic capability of primary microglial cells by zymosan-FITC assay The phagocytotic capability of primary hippocampal microglia of different groups was measured by Vybrant™ Phagocytosis Assay Kit (Cat No. V6694, Thermo Fisher Scientific). Fluorescence intensity for each sample was measured using a fluorescence microplate reader (Ex/Em ~480/520 nm).

The recombinant molecule consists of 215 amino acid residues and has a calculated molecular mass of approximately 24.8 kDa (Cat. no. ab181949 & HM-115). We have administered the recombinant molecule for a continuous 7 days at 10 a.m. ( ± 15 min) to create the neuroinflammatory memory impairment model. Animals were subjected to behavioral assessment 7 days later. AMD3100 up to a dose of 1 mg/kg/ day, shows its optimum biological action on chemokine receptors without causing stem cell mobilization (Huang et al., 2013). In the current study, we have selected the concentration of 0.5 mg/kg/day of AMD3100 after a preliminary screening and administered for 7 days at 10.30 a.m. ( ± 15 min). Treatment with CXCR7 siRNA at a dose of 5 nmol significantly reduced the expression of CXCR7 in mouse model (Supplementary fig. no 1F). We have administered CXCR7/Scrambled

2.1.7. Detection of CXCR7 protein levels by immunoblot Cells were homogenized by using the membrane protein extraction kit (Cat. No ab65400, Abcam) as per the manufacturer’s instruction. Proteins were processed for immunoblotting to determine the expression levels of CXCR7 by using anti-mouse CXCR7 primary antibody (Thermofisher Scientific, US) and anti-rabbit IgG secondary antibody (Cat. No. G-21234, Abcam). 321

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 1. Experimental timelines for in-vivo experiments (A) Establishment of HMGB1 induced dementia model of mice and dose, period of exposure standardization for AMD3100, CXCR7/Sc siRNA (B) Experiment includes eight groups of mice (n = 8 per group) for studying spatial memory errors and molecular memory markers. Initially, there was a habituation session (5 days) followed by training period (7 days) and probe trial (13th day). AMD3100 (for 7 days, 7 times), CXCR7/Sc siRNA (For 3 days on day 0, 3, 5) injections were made (10 a.m., ± 1 h) during continuous HMGB1 exposure. Animals were sacrificed after spatial memory testing on the 21st day. (C) The experiment includes eight groups of mice (n = 8 per group) for studying working memory errors and molecular memory markers. Initially there was a habituation session (5 days) followed by training period (15 days) and testing period (27 days). Three intranasal CXCR7/Sc siRNA and seven intraperitoneal AMD3100 injections were made (10 a.m., ± 15 min) during continuous HMGB1 exposure. Animals were sacrificed on 27th day of testing period.

pool for assessing track path length, time spent in each quadrant and escape latency. The whole experimental protocol included four phases: habituation, training, probe test, and test phase as reported by a previously published work from our institution. In the habituation phase, healthy animals (without having any stereotypic characteristics) were subjected to the pool (without the platform) for a maximum of 5 min and allowed to swim. During the training phase, the water apparatus was equally divided into four relative zones (Z 1–4) and the transparent platform was placed in the Z4 zone (denoted as ISLAND zone). Animals were allowed to search the platform after placing into all fore zones (Z1, Z2, Z3, and Z4 zones) sequentially. If the animal succeeded to find the platform within 1 min, it was taken out of the pool, dried with a towel and placed back to the holding cage (if the animal failed to find the platform, within 1 min, the experimenter guided the animal to find the platform and allowed to sit on the platform for 10 s). The training session was for 7 days (TD1-TD7) and each animal received four trials/day with an inter-trial interval of minimum 5 min. After completion of training period/before recombinant HMGB1 administration, animals were tested (probe test) by subjecting them to the opposite zone of the ISLAND zone i.e. Z2 for 1 min and were allowed to find the hidden platform (training confirmation). During probe test, if the mouse failed to locate the transparent platform within 10 s, immediately excluded from the experiment. After completion of HMGB1/AMD3100/CXCR7siRNA/Sc siRNA treatment, mice immediately underwent the next phase i.e. test phase (with/without hidden platform). In this phase animals were

siRNA for 3 times (Day 0, Day 3, Day 6) at 5p.m. ( ± 15 min) during the HMGB1 treatment period. CXCR7 siRNA/nonspecific siRNA/FITC-labelled transfection indicator siRNA (siGLO Green Transfection Indicator D-001630, DharMacon) were complexed with Invivofectamine reagent (premixed in 1:1 ratio, 10 nmol in 10 µl; Invitrogen). The intranasal siRNA administration procedure was carried out as described by Thorne et al. (2004) and the previous study of our lab (Das et al., 2018). Transfection indicator siRNA (FITC tagged) was used for few initial experiments as qualitative indicator of siRNA delivery to specific brain region. In our study (for every single marker evaluated) Sc siRNA showed no effect on CXCR7/CXCR4 gene suppression, HMGB1 induced reactive glia-derived neuroinflammation, blood-brain barrier permeability, peripheral immune cell entry and subsequent spatial and working memory loss (Mentioned in fig. legends). Thereby, the ameliorative/ aggravated effects found in this current study were exclusively due to target gene suppression by its specific siRNA.

2.2.3. Behavioral studies 2.2.3.1. Spatial memory test by Morris water maze. The Morris Water Maze, invented by famous neuroscientist Richard G. Morris, was used to test hippocampal-dependent navigational memory named as spatial memory. A black (as the mice were white) painted circular pool (210 cm diameter and 53 cm height) was filled with clean tap water (temperature 25 ± 2 °C) and contains a transparent removable platform of 10 cm in diameter. A monitoring camera was attached to the ANY-maze software (Stoelting, USA) and placed overhead the water 322

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

C3a forward 5′-GACGCCACTATGTCCATCCT-3′ C3a reverse 5′-CCAGCAGTTCCAGGTCCTTTG-3′ STAT-3 forward 5′-ACCCAACAGCCGCCGTAG- 3′, STAT-3 reverse 5′-CAGACTGGTTGTTTCCATTCAGAT-3′ JAK-1 forward: 5′-CTCTGACGTCTGGTCTTTTGG-3′ JAK-1 reverse: 5′-GTTGGGCCTATCATTTTCAGGAAC-3 NF-κB forward: 5′-GAAATTCCTGATCCAGACAAAAAC-3′ NF-κB reverse, 5′-ATCACTTCAATGGCCTCTGTGTAG-3′ IκB-α forward: 5′-AGCACAAAGAGAGTGTCGC-3′ IκB-α reverse: 5′-CGTCAGTCAGTGTGTATG-3′ SOCS-3 forward: 5′-GCTGGCCAAAGAAATAACCA-3′ SOCS-3 reverse: 5′- AGCTCACCAGCCTCATCTGT-3′ AQP-4 forward: 5′-TGCCAGCTGTGATTCCAAACG-3′ AQP-4 reverse: 5′-GCCTTCAGTGCTGTCCTCTAG-3′ Beclin-1 forward: 5′-GGCCAATAAGATGGGTCTGA-3′ Beclin-1 reverse: 5′-GCTGCACACAGTCCAGAAAA-3′ Bcl-2 forward: 5′-GTC CCG CCT CTT CAC CTT TCA G-3′ Bcl-2 reverse: 5′-GAT TCT GGT GTT TCC CCG TTG G-3′ GAPDH forward: 5′-CATCACTGCCACCCAGAAGACTG-3′ GAPDH reverse: 5′-ATGCCAGTGAGCTTCCCGTTCAG-3′

again placed to Z2 zone and were allowed to explore for maximum 1 min. Different parameters like path length, latency, path efficiency to reach the platform (with hidden platform), and number of entries, time spent in the Z4 (ISLAND) zone (without hidden platform) were evaluated under probe and spatial memory test. 2.2.3.2. Reference and working memory error studies by radial arm maze test. Radial arm maze study was conducted as per the protocol of Das et al. Prior to the experiment, mice were placed on a specific schedule of restricted food intake (3 days prior) for maintaining body weight at 75% of the free-feeding level. A radial arm maze that uses positive reinforcement (food bait) to test working and reference memory consists of an array of eight arms (Wooden, 18.5 × 3.5 × 10.5 in. each). The arms radiate from a central octagonal platform (starting point). In the habituation session experimental subjects were placed on the central platform and allowed to move freely in all the connected arms to collect the hidden baits (chocolate chips) placed at the end of the arms. The habituation period was carried out in the schedule of 3 trials (5 min for each trial) per day for 3 days. After the habituation phase, in the training period, the animals were trained for 8 consecutive days (one session per day) and in this session only 4 pre-selected arms were baited with the reinforcement and the task was to make the correct arm choice. The session was terminated when the animal obtained all four food rewards or when 15 min have elapsed. Each animal was gradually made to learn and memorize the particular baited arms of the maze to get the reward. Following training, in the testing phase, animals from all the groups were tested for their ‘RAM task’ performances in the next 5 days. After 5 days of testing, HMGB1 was injected for the next 7 days, AMD3100 for 7 days and CXCR7/Sc siRNA for 3 days in the same week as per the study design. Thereafter, the behavioral parameters were again tested up to 26th day. Re-entries in the baited arms were designated as working memory errors where entries in the non-baited arms were considered as reference memory errors (Mizuno et al., 2000). Fig. 1 exhibits detailed experimental timelines for in-vivo studies.

2.2.6. Solubilisation of proteins and immunoprecipitation Brain tissues were homogenized in the lysis buffer containing 30 mM Tris–HCl; pH 7.5, 5 mM EDTA, 10 mM EGTA, 1%Triton X-100, 250 mM sucrose, 1 mM NaF, 1 mM phenylmethylsulfonyl fluoride and 1 mM Na3VO4 and protease inhibitors cocktail (Sigma, USA), followed centrifugation at 4000 rpm for 20 min at 4 C. Individual desired proteins were immunoprecipitated from lysates using indicated polyclonal antibodies and captured by incubation with Protein A-Sepharose beads (Cat no. ab193256, Abcam, USA) at 4 °C (rotating for 30 min). Thereafter, immunoprecipitates were washed three times with lysis buffer. Immunoprecipitated proteins were dissolved in 5× loading buffer containing reducing agent (Sigma, USA), resolved by 8–15% SDS-PAGE, and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore Corp., Bedford, MA). Immunoblotting was performed with specific primary antibodies and anti-rabbit horseradish peroxidase-conjugated secondary antibodies followed by visualization of specific bands using a chemiluminescence detection system.

2.2.4. Flow cytometric analysis of in-vivo cell surface receptors, inflammatory markers and markers of infiltrating leukocytes After specific schedule of HMGB1, CXCR7siRNA, scrambled siRNA, AMD3100 treatment and memory testing mice were fully anesthetized with 50 mg/kg dose of sodium pentobarbital (IP), followed by perfusion with sterile ice-cold phosphate-buffered saline (PBS). Specific brain regions (PFC, hippocampus) were processed to isolate pure single brain cell suspension with the help of adult brain dissociation Kit (130-107677, Miltenyi Biotec), gentleMACS™ Octo Dissociator, MACS SmartStrainer (70 μm), and cell type-specific MicroBeads (for isolation of a specific cell type), according to the manufacturer’s instruction. After isolation, cells were harvested by washing twice in 1× wash buffer (Cat no. FC005) for 20–25 min at 37 °C, fixed by 1× fixation buffer (Cat. no 420801) for 30 min followed by incubation with fluorescence tagged primary antibodies of CXCR4 (BD bioscience), CXCR7 (BD bioscience), C3R (Biocompare), CD11b (Abcam), CD45 (BD bioscience), CD8 (BD bioscience), CD4 (BD bioscience), B220 (Biocompare), CD11c (Biocompare), Ly6c (Biocompare) and CD-68 (BD bioscience) at different dilutions for pre-determined time period. Unbound tagged antibodies were removed by washing with 1X wash buffer followed by cell suspension in 0.2 ml of suspension buffer and analysis (50,000 events) by a flow cytometer (BD FACS Aria) with FlowJo software.

2.2.7. Immunoblotting for the analysis of expression of CXCR7, MMP-9, MMP-2, Claudin-5, ZO-1, GSK-3β, NF-κB p-65, HMGB1, p47 phox, BACE1, SNAP-25, PSD-95, APP Brain regions from different groups of animal were homogenized in cytoplasmic or nuclear extraction buffers to get pure cytoplasmic and nuclear extract as per experimental requirements. The membrane fractions from brain tissues (for checking the expression of membrane proteins) were prepared using the membrane protein extraction kit (Cat. No ab65400, Abcam). Proteins were processed for immunoblotting as described by Das et al, to determine the expression levels of CXCR7 (Thermo fisher scientific, USA), p47 phox (Abcam, USA), MMP9 (Sigma, USA), MMP-2 (St Johns laboratory, USA), Claudin-5 (Abcam, USA), ZO-1 (Abcam, USA), GSK-3β (Abcam, US), NF-κB p-65 (Abcam, USA), HMGB1 (St. Johns laboratory, USA), BACE-1 (Abcam, USA), (Abcam, US), SNAP-25 (Abcam, US), PSD-95 (St. Johns laboratory, USA) and APP (St. Johns laboratory, USA). 2.2.8. Immunofluorescence analysis of CXCR7, GFAP, STAT3, CD31, CXCL-12, MMP-3, C3 expression in different groups Each section, containing different regions of hippocampus/ prefrontal cortex, was washed with sterile PBS containing 0.1% Tween-20 (PBST) followed by antigen retrieval with sodium citrate buffer (pH 6.0). After 3–4 washing, sections were incubated with 3% BSA (Blocking solution) followed by primary antibody (Anti CXCR7Thermo fisher scientific, USA; Anti GFAP- Sigma, USA; Anti STAT-3Abcam USA; Anti CD31-Abcam USA; Anti CXCL12- Abcam USA; Anti MMP-3- Abcam, USA; AntiC3- Santa Cruz Biotechnology, USA)

2.2.5. mRNA analysis of C3a, STAT-3, JAK, NF-κB, IκB-α, SOCS-3, AQP4, Beclin-1, Bcl-2 by Real-time PCR Total RNA was extracted from specific brain regions and reverse transcribed as described in the in-vitro (2.1.5) section. Oligonucleotide primers for C3a, STAT-3, JAK, NF-κB, IκB, SOCS-3, AQP-4, Beclin-1, Bcl-2, and GAPDH were as follows: 323

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

2.2.14. Measuring blood-brain-barrier permeability using Evans blue After treatment, mice from all groups were injected (4 ml/kg) with a solution of 2% Evans blue in sterile PBS via the tail vein. 6 hs after Evans blue injection, the mice were anesthetized, blood was drawn by cardiac puncture and transcardial perfusion was done (with 0.9% saline-heparin, 5 U/ml) to remove the intravascular dye. Brain hemispheres were removed, weighed and homogenized. The supernatant was collected, 50% trichloroacetic acid was added followed by overnight incubation at 4 °C and centrifugation for 30 min (15000 RCF, 4 °C). Absorbance was measured at 610 nm and quantified according to the standard curve.

incubation for 2 h at RT. After another 4 washing (4 × 5 min) the sections were incubated with secondary antibodies (fluorescently tagged) for 1 h. TOPRO-3 or Hoechst was used for nuclear stain as per the experimental requirement. Sections were then mounted with VECTASHIELD® Antifade Mounting Medium (Sigma, USA) and observed under a fluorescence microscope. 2.2.9. Analysis of expression of secreted chemokines by ELISA After homogenization and centrifugation (10,000g for 30 min) of specific brain tissue with sterile PBS, the supernatant was collected and diluted again by sterile PBS for performing the assay. Supernatant concentrations of CXCL-10 (Peprotech USA), CCL-2 (Elabscience, USA) were measured by ELISA as per the manufacturer’s protocol.

2.2.15. Data analysis and statistics Immunofluorescence images and Western blot band intensities were measured using computer-based ImageJ software. For immunofluorescence analysis five or more images from different experimental groups were chosen randomly and examined. All data were analyzed using either unpaired t-test (For standardization of dose and time of exposure of HMGB1, AMD3100, CXCR7 siRNA in vitro/in-vivo) or twoway ANOVA (in most of the experiments main effect and the interaction effect was found to be statistically significant) followed by Tukey's multiple comparisons test (according to the experimental design) and presented as the mean ± standard error of mean (SEM). All statistical analyses were done in Graph pad prism version 6.01. The value of p < 0.05 was considered statistically significant. The symbol ‘***’ indicates a significant difference (p < 0.001), ‘**’ indicates a significant difference (p < 0.01), and ‘*’ indicates a significant difference (p < 0.05) of HMGB1 treated group compared to HMGB1 + AMD3100 treated group/ HMGB1 + CXCR7 siRNA treated group.

2.2.10. Apoptotic study by Hoechst 33,342 staining Cryostat hippocampal sections were permeabilized with permeabilization buffer and stained with Hoechst 33342 (10 μg/ml). The stained sections were visualized under a fluorescence microscope. Chromatin condensation and nuclear damage were documented by counting (at 40× magnification) the number of brightly stained Hoechst positive cells emitting high fluorescence (figure showing 10× magnification). 2.2.11. Annexin V-PI staining Annexin-V- FITC, Propidium iodide staining was performed as per the manufacturer’s instructions (BD Biosciences) and analyzed by BD FACS Aria flow cytometric machine. 2.2.12. Fluoro-Jade C staining for assessing neurodegeneration Fluoro-Jade C (Cat no: AG325-30MG, Merck, USA) staining for assessing the number of degenerated neurons was performed as per the manufacturer’s instructions.

3. Results 3.1. Recombinant HMGB1 induction significantly alters CXCR4-CXCR7CXCL12 trio and up/down-regulation of CXCR7 receptor by agonists and siRNA treatment affects the level of secretory cytokines and receptor expressions in glial cells

2.2.13. PCR array study for assessing the expression of synaptic plasticity markers and inflammatory cytokines, receptors in different experimental groups Synaptic plasticity gene profiling was done using RT2 Profile PCR Array (96 well format) mouse Synaptic Plasticity kit (Cat. No. PAMM126Z). The plate profiles the expression of 84 central genes that play key roles in synaptic alterations during learning and memory. This kit includes genes of mouse responsible for immediate-early response in synaptic plasticity (n = 30), late response in synaptic plasticity (n = 2), long term potentiation (LTP) (n = 28), long term depression (LTD) (n = 21), cell adhesion (n = 9), extracellular matrix (n = 5), CREB cofactors (n = 10), postsynaptic density (n = 15), neuronal receptors (n = 19) and others (n = 2). We have also used mouse inflammatory cytokines and receptor array kit (Cat. No. PAMM-011Z) for assessing the neuroinflammatory status of hippocampus region of animal brains of different experimental groups. The kit includes genes of mouse responsible for expression of several chemokines (n = 25), chemokine receptor (n = 11), Interleukins (n = 17), Interleukin receptors (n = 8), some other cytokines (n = 22) and cytokine receptors (n = 1). Initially, RT2 First Strand Kit (Qiagen, USA) was used for cDNA synthesis from 1 µg total RNA (for each sample). For real-time PCR-based gene expression analysis the kit contains an essential genomic DNA elimination step and a built-in external RNA control. Relative abundance of each mRNA sample was assessed using RT2 SYBR Green qPCR master mix (Qiagen, USA, Cat # 330502; 25 µl to each well of the real-time PCR arrays), equal amount of cDNA template and qRT-PCR thermal cycler (Bio-Rad CFX). The threshold cycle (Ct) value of each gene was determined by using CFX Maestro Software and relative expression (foldchange over control) was calculated using ΔΔCT method with five housekeeping genes (included in the kit) and compared with the expression in control genes. The heat map was constructed online by Heatmapper.ca software.

The cytotoxicity of different doses of recombinant HMGB1 (50 ng/ ml, 100 ng/ml, 250 ng/ml, 500 ng/ml, 750 ng/ml, and 1000 ng/ml) for different time period (6 h, 24 h, 48 h) in primary mix glial culture was tested by MTT assay. Treatment of primary cells with HMGB1 at concentrations of 50 ng/ml, 100 ng/ml, 250 ng/ml, 500 ng/ml and 750 ng/ ml did not result in any cytotoxicity even up to 48 h of incubation period, but a dose of 1000 ng/ml was shown to be slightly toxic (n = 3, p = 0.013) after 48 h of incubation (Supplementary Fig. 1B). Flow cytometric analysis showed significant alteration of expression of chemokine receptors CXCR7 and CXCR4 in primary microglia enriched culture after incubation with mouse recombinant HMGB1 at concentrations of 50 ng/ml [CXCR7; p = 0.0014], 100 ng/ml [CXCR4; p = 0.0155, CXCR7; p = 0.003], 250 ng/ml [CXCR4; p = 0.0009; CXCR7; p = 0.0094], 500 ng/ml [CXCR4; p = 0.0003; CXCR7; p = 0.0027], 750 ng/ml [CXCR4; p = 0.0003; CXCR7; p = 0.0014] (Fig. 2A). A dose of 500 ng/ml of HMGB1 was chosen for further experiments, as this dose was the most effective one to alter the expression of chemokine receptors and showed no cytotoxicity to the cells. This 500 ng/ml dose of HMGB1 also upregulated the expression level of CXCL12 at different post-transfection times (6 h, 12 h, 24 h, 48 h) in the supernatant of mix primary glial culture. On the other hand, knockingdown the expression of both CXCR4 and CXCR7 receptor by treating the cells with a standardized dose of CXCR4 siRNA (5 nM) and CXCR7 siRNA (5 nM) (Supplementary Fig. 1C; Scrambled siRNA treatment showed no effect on CXCL12 level) showed its significant impact on CXCL12 expression level. CXCR4 siRNA treatment significantly reduced the level of CXCL12 in glial supernatant after 12 h of incubation (p = 0.0237), where 12 h (p = 0.0335) and 24 h (p = 0.0128) of incubation with CXCR7 siRNA dramatically increased the level of CXCL12 324

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

(caption on next page)

and CXCR7 receptors by treatment with HMGB1, specific siRNAs and several agonists of CXCR7 receptors (AMD3100, CCX771 & VUF11207). Treatment with agonist molecules of CXCR7 receptor and CXCR4 siRNA after HMGB1 induction reduced the expression level of pro-

to the peak (Fig. 2B). Thereby, these two experiments (Fig. 2A and B) concluded about strong interactions among the expressions of CXCR4, CXCR7, and CXCL12. Levels of secretory cytokines like TNF-α, IL-1β, and TGF-β were measured after modulating the expression of CXCR4

325

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 2. Recombinant HMGB1 induced alteration of CXCL12-CXCR4-CXCR7 trio contributes to memory loss in mice and targeting ‘CXCR7’ could be a viable strategy for reversing the impairment: (A) Represents the expressions levels (MFI) of chemokine receptors ‘CXCR4′ and ‘CXCR7’ in primary microglial cells, isolated from hippocampus region, after treatment with different doses of mice recombinant full length HMGB1 protein. With an increase in the dose of recombinant HMGB1, the expression levels of CXCR4 were upregulated and CXCR7 was downregulated. Up to, a dose of 750 ng/ml HMGB1 did not result in any cytotoxicity but a dose of 500 ng/ml was selected for further in-vitro experiments to establish HMGB1 induced inflammation. (B) Represents the expression level of CXCL12 (pg/ml) at different post-transfection times (6 h, 12 h, 24 h, 48 h) in the supernatant of mix primary glial culture of different groups. CXCR7 siRNA treatment upregulated HMGB1induced level of CXCL12 (at a post-transfection time of 12 h, 24 h) but CXCR4 suppression downregulated it (at post-transfection time of 12 h). (C) Histogram showing the level of secretory cytokines, TNF-α, IL-1β, TGF-β in different experimental groups, measured by ELISA. Treatment with different agonists of CXCR7 receptor after HMGB1 induction revealed the significant effect of AMD3100 in balancing the cytokine profiling by upregulating anti-inflammatory and downregulating proinflammatory cytokine, even after HMGB1induction. (D) Relative mRNA expression of conventional HMGB1 receptors (TLR4, Mac-1, RAGE) among different experimental groups measured by real-time PCR. Treatment with AMD3100 and CXCR4 siRNA both led to decreased expression of TLR4, Mac-1 and RAGE receptors where treatment with CXCR7 siRNA aggravated the expressions. Histograms also indicated the fact that, for treatment of HMGB1 induced neuroinflammation, treating the cells with agonist ‘AMD3100’ was comparatively a good strategy than CXCR4 suppression within glial cells for maintaining CNS homeostasis. Sc siRNA showed no effect of it on pro/anti inflammatory cytokine levels and receptor expressions. (E) & (F) line graph representing the correlation of HMGB1 induced memory error scores with chemokines CXCR7, CXCR4, and cytoplasmic HMGB1. Spatial and working memory scores both were positively correlated with hippocampal cytosolic HMGB1 and surface CXCR4 but negatively with surface expression of CXCR7. (G) Histogram representing CXCR7 expression in hippocampus region. Membrane fractions were isolated to perform Western blotting analysis for CXCR7 levels of glial cell. The ratio of densitometry values of membrane CXCR7 to β-actin from three independent experiments indicate significant upregulation of membrane CXCR7 level after different doses of systemic AMD3100 treatment. (H) Intranasal delivery of 1 nM, 2 nM, 5 nM, 10 nM, and 20 nM of CXCR7 siRNA led to significant suppression of CXCR7 expression in CA3 and PFC region of the animal brain. But the level of CXCR7 expression of CA3 region and PFC region was not altered after intranasal delivery of scrambled siRNA. (I) Histogram showing the relative expression of HMGB1 detected on the blot with anti-HMGB1 antibody after immunoprecipitation with anti-CXCL12 antibody. Systemic AMD3100 treatment shows a significant negative and intranasal CXCR7 siRNA treatment shows a significant positive effect on HMGB1-CXCL12 interaction. The histogram showing relative expression of CXCL12 also depicts the same pattern of expressions among different experimental groups. Although intranasal scrambled siRNA treatment shows no effect on HMGB1-CXCL12 interaction. (J) Heatmap showing significant (≥3 fold) alteration of expression of 22 genes (out of 84 genes) related to expression of inflammatory receptors and mediators after HMGB1/AMD3100/ CXCR7 siRNA treatment. CXCR7 agonist treatment reverses HMGB1 induced overexpression of genes related to inflammation like il-17a, il-17b, cx3cl1, ccl4, cxcl10, tnf but CXCR7 siRNA treatment aggravated the expressions. On the other hand, CXCR7 suppression downregulated the expression of anti-inflammatory genes like il-4, il-10, tgf-b1 but CXCR7 agonist ‘AMD3100’ upregulated those genes to basal levels.

CXCR7 molecule in maintaining CNS homeostasis and synaptic plasticity. AMD3100, a small synthetic allosteric agonist of CXCR7 receptor, increases CXCL12 binding to CXCR7 and shows a negative effect on the CXCR4/CXCL12 interaction. The effects of intraperitoneal injection of AMD3100, daily for 7 days at a concentration of 0.1 mg/kg, 0.25 mg/ kg, 0.5 mg/kg, 1 mg/kg, 2 mg/kg were investigated for optimum dose selection. A dose of 0.5 mg/kg was selected as it was the minimum dose showing maximum increase in the level of hippocampal CXCR7 expression (p = 0.0034) and did not cause any side effect (Like weight loss/ any adverse physical symptom) (Fig. 2G). After standardizing the dose of AMD3100 we have standardized the dose of CXCR7 siRNA for nasal administration and treated the animal with same dose of Scrambled siRNA. 1 nmol of CXCR7 siRNA, when delivered intranasally showed significant suppression (p = 0.0144) of target gene in adult mice but a dose of 5 nM showed maximum (almost 70% suppression compared to control group) suppression in both prefrontal cortex (p = 0.0001) and hippocampus (p < 0.0001) regions without causing any side effect or toxicity to the brain regions (Fig. 2H). A similar dose of Scrambled siRNA was administered at the same time with CXCR7 siRNA as a negative control. Inflammatory cells infiltration to CNS tissue and release of proinflammatory-cytokines are highly dependent on the binding of CXCL12 to HMGB1. Previously, AMD3100 was shown to inhibit the -6470651799209000 heterocomplex formation between HMGB1 and CXCL12 (Schiraldi et al., 2012). Here, we performed coimmunoprecipitation study to evaluate the interaction between HMGB1 and CXCL-12 molecule and found a significant interaction (F (3, 8) = 15.60; p = 0.0010) of AMD3100 and CXCR7 alone and in combination with HMGB1 on HMGB1-CXCL12 binding. Peripheral injection of HMGB1 for continuous 7 days to mice significantly (p < 0.001, IB: HMGB1; p = 0.007, IB: CXCL-12) increased the interaction of HMGB1 and CXCL12 within the CNS including the hippocampus region (Fig. 2I). AMD3100 treatment after HMGB1 induction decreased the interaction (p = 0.0038, IB: HMGB1; p = 0.042, IB: CXCL-12) where suppression of CXCR7 receptor by siRNA treatment again increased it (p = 0.010, IB: HMGB1). Next, we have analyzed the expression of a panel of 84 genes focused on neuroinflammatory (mediating immune cascade reactions during inflammation) response among different experimental groups. Out of 84 genes investigated, total 22 genes were significantly altered (≥3 fold) after HMGB1/AMD3100/ CXCR7 siRNA

inflammatory cytokines and slightly upregulated the level of anti-inflammatory cytokine ‘TGF-β’ where targeted knockdown of CXCR7 receptor with its siRNA after HMGB1 treatment upregulated the level of proinflammatory cytokines. Experimental outcomes (Fig. 2C) also indicated that AMD3100 was the most effective [TNF-α (HMGB1 vs HMGB1 + AMD3100, p = 0.0008), IL-1β (HMGB1 vs HMGB1 + AMD3100, p = 0.023)] CXCR7 agonist for maintaining the CNS homeostasis in terms of cytokine balancing and might have some effect in reducing HMGB1 induced neuroinflammatory signals within the CNS. Although AMD3100 is known for its differential effects on CXCR4 (antagonism and suppression) and CXCR7 (agonist and upregulation), in this current study our experimental findings strongly indicated that AMD3100’s ameliorative effects on HMGB1 induced memory loss majorly involved CXCR7 receptor (Supplementary Fig. 3D–G). Furthermore, the cytokine profiling data showed that targeting CXCR7 molecule with agonist ‘AMD3100’ was comparatively a good strategy than CXCR4 suppression with siRNA for maintaining CNS homeostasis. Apart from pro-inflammatory cytokines, conventional receptors of HMGB1 like TLR4, RAGE, and MAC-1 also showed altered expressions after AMD3100 and CXCR4/CXCR7 siRNA treatment. AMD3100 treatment was shown to reduce HMGB1 induced over expressions of TLR4 (p = 0.0460), MAC-1 and RAGE receptors where CXCR7 receptor knockdown after HMGB1 treatment aggravated receptor expressions (Fig. 2D). 3.2. Correlation analysis of memory impairment parameters with hippocampal expression of HMGB1, CXCR7, CXCR4 and strategic delivery of drugs The working memory scores of recombinant HMGB1 induced animals determined by radial arm maze -736600-2098675000 were highly correlated with the level of cytosolic HMGB1 (positively; R2 = 0.9908), CXCR4 (positively; R2 = 0.9956) and CXCR7 (negatively; R2 = 0.9336) (Fig. 2E). Latency to reach the platform of Morris water maze is the indicator of animal memory performance and was again highly correlated with cytosolic HMGB1(positively; R2 = 0.9915), CXCR4 (positively; R2 = 0.9747) and CXCR7 (negatively; R2 = 0.9681) (Fig. 2F). Experimental evidence from the in-vivo studies was thereby similar to in-vitro experimental outcomes and both indicated the potential role of 326

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

3.4. CXCR7 acts as a central player for neutralizing HMGB1 induced bloodbrain barrier dysfunction

treatment. Genes with the greatest fold increases in expression after HMGB1 treatment included Cx3cl, ccl4, Cxcl10 ccr3, il-17a and tnf, which had 13, 29, 13, 26, 17- and 15-fold higher expression patterns, respectively. Where, in the hippocampus of animals of HMGB1 + AMD3100 group the expression of Cxcl3, ccl4, cxcl0, ccr3, il17a and tnf reduced to 4, 7, 4, 6, 8 and 4-fold (Fig. 2J). Suppression of CXCR7, in HMGB1 induced memory loss model, led to enhanced expression of all the inflammatory markers. These data highlighted the prominent role of CXCR7 in microglial and astrocytic activation and glial neuronal communication.

Emerging evidence suggests that loss of integrity of the blood-brain barrier is central to the onset and progression of neurodegenerative disorders and cognitive impairment. Loss of tight junctions of BBB is significantly associated with heightened inflammation and leukocyte infiltration to the CNS. HMGB1 is a causal proximate proinflammatory mediator of BBB dysfunction and causes BBB endothelial damage. Along with HMGB1, disruption of CXCL12 polarity is also known for promoting entry of autoreactive leukocytes and neuroinflammation. Our immunofluorescence data revealed HMGB1 and CXCR7 induction leads to redistribution of CXCL12 expression toward vessel lumena from basolateral localization (Fig. 5A). whereas, CXCL12 remained polarized within all vessels in CNS sections of HMGB1 + AMD3100 animals. Treatment of both AMD3100 and CXCR7 siRNA alone and in combination with HMGB1 showed significant interactions [F(3, 16) = 15.23; P < 0.0001] with the level of CXCL12 polarizations. Apart from CXCl12, matrix metalloproteinases (MMPs) disrupt the blood-brain barrier by acting on the final common pathway for proteolysis of the extracellular matrix proteins in the basal lamina surrounding cerebral capillaries. Especially, MMP-9 and MMP-2 Contribute largely to neuronal cell death in models of dementia. Our immunoblot study suggested significant downregulation of HMGB1 induced MMP9 (p = 0.0010) & MMP2 (p = 0.0193) expression after AMD3100 treatment in the hippocampus region of animal brain (Fig. 5B and C). On the other hand, normal cellular levels of claudin‐5, a molecular component of endothelial tight junctions of the barrier, and zonulin-1, a protein associated with the C‐terminus of claudin, are essential for maintaining the integrity of BBB. Peripheral injection of HMGB1 leads to decreased expression of claudin-5 and zonulin-1 in the hippocampus region. Where, AMD3100, upregulated (Claudin5; p = 0.0138) both the protein to basal level (Fig. 5D and E). Next, we wanted to compare and analyze the blood-brain barrier permeability among different animal groups. There were many ways to analyze this, but we chose a simple yet powerful method using the Evans blue dye. Data showed, significantly increased extravasation of Evans blue albumin in the brain of HMGB1 induced animals (n = 5, randomly chosen from each group) compared to control animals. AMD3100 treatment again decreased (p = 0.0034) the extravasation as evidenced by decreased level of Evans blue present within the hippocampal lysate (Fig. 5F). Knocking down of CXCR7 expression during HMGB1 treatment caused sharp increase (p = 0.04) in the permeability of BBB, compared to the HMGB1 alone group.

3.3. HMGB1 targets the JAK-STAT3 pathway in astrocytic cells and modulation of CXCR7 receptor expression alters HMGB1 induced astrocytic phenotype Increased expression of the glial fibrillary acidic protein (GFAP), the principal intermediate filament protein of mature astrocytes, represents reactive astrocyte (A1 phenotype) and gliosis during neurodegeneration. Recombinant HMGB1 injection to mice caused increased expression of GFAP in astrocytes and both the drug AMD3100 and CXCR7 siRNA in combination with HMGB1 or alone showed statistically significant interaction i.e. F (3, 32) = 4.14; p = 0.0136 on the level of GFAP. Interestingly, simple main effects analysis showed significant downregulation of GFAP expression after AMD3100 treatment (p = 0.0055) where suppression of CXCR7 expression after HMGB1 treatment highly upregulated it (p < 0.001) (Fig. 3A). Thereby, the data suggested ‘CXCR7’ as a key factor for mediating beneficial effect in balancing the A1-A2 astrocytic level. Next, we have investigated the expression of astrocyte-derived chemokines CCL2 and CXCL10 in the hippocampus region of animals from different groups. Significant interaction was found F (3, 32) = 28.06 P < 0.0001; F (3, 32) = 75.67 P < 0.0001 for both the chemokines. CXCR7 agonist shows its significant effect in suppressing the level of both the chemokines (CXCL10; p = 0.0038: CCL-2; p = 0.0061) and CXCR7 siRNA treatment significantly upregulated the level of CCL-2 (p = 0.0358) compared to alone HMGB1 induced neuroinflammatory memory impairment model (Fig. 3B). Activation of the Janus kinase/signal transducer and activator of transcription 3 (JAK/STAT3) pathway is known to be associated with reactive astrocytes (Ben Haim et al., 2015). Here, we examined whether the JAK/STAT3 pathway promotes astrocyte reactivity in HMGB1 induced animal models of memory loss. There were statistically significant interactions between the effects of both AMD3100 and CXCR7 siRNA alone and in combination with HMGB1 on levels of mRNA of STAT3 F(3, 16) = 15.23; P < 0.0001 and JAK F(3, 16) = 34.68 P < 0.0001. Our real-time PCR data suggested significant upregulation of both STAT-3 and JAK after 7 peripheral injections of HMGB1 where CXCR7 agonist downregulated HMGB1 induced expressions of STAT3 (p = 0.0114) and JAK (p = 0.0007). Suppression of CXCR7 during HMGB1 treatment aggravated astrocytic activation probably by significant upregulation of these two proteins (STAT3, p = 0.0138; JAK, p = 0.0015) (Fig. 3C). Agonist of CXCR7 was shown to downregulate (p < 0.001) the expression of C3a, an astrocyte-derived complement peptide important for astroglial microglial crosstalk, during HMGB1 treatment. But surprisingly CXCR7 siRNA and AMD3100 did not alter the level of NF-κB and Iκ-B. Suppressor of cytokine signaling-3 (SOCS3), an essential regulator for inhibition of STAT3 activation, was downregulated after HMGB1 treatment. On the other hand, AMD3100 significantly restored the level of SOCS3 (p = 0.0002). Expression of aquaporin-4 (AQP4), which is a bidirectional water channel present on astrocytes was not altered much after HMGB1/AMD3100/CXCR7 treatment (Fig. 3D). Double labeling of PFC regions by STAT-3 (Red panel) and GFAP (Green panel) revealed that both the expression of the protein follows a similar pattern. CXCR7 siRNA treatment in HMGB1 induced memory loss model worsen the astrocyte-derived neuroinflammatory signal by enhancing the level of STAT-3, even at a significantly (p = 0.01) greater level compared to HMGB1 alone (Fig. 3E).

3.5. Effect of alteration of HMGB1 and CXCR7 expression on CNS resident and transmigrating peripheral immune cells Under normal homeostatic conditions, the specialized intact structure of the BBB restricts paracellular transport of hydrophilic compounds and migration of blood-borne cells within the CNS. Thereby, resident immune cells like microglia and astrocytes are the initial responders to pathogens or tissue damage. Our previous experimental outcomes indicated peripherally injected HMGB1 molecule, within the CNS, caused the BBB to lose its restrictive features and might lead to subsequent infiltration of peripheral immune cells. To determine whether CXCR7 expression alteration affected the percentages and overall numbers of mononuclear subsets within the hippocampal region, we performed flow cytometric analyses of cells isolated from different groups of animals. Both AMD3100 and CXCR7 siRNA treatment alone or in combination with HMGB1 showed strong interactions with the expression of different subsets of hippocampal cells [Interaction: F (3, 32) = 9.259; P = 0.0001 on resting microglial cell percentage, F (3, 32) = 4.280; P = 0.0120 on activated microglia/ invading myeloid cell percentage]. Analysis of CD45+CD11b+ populations revealed that HMGB1 treatment led to the downregulation of numbers of CD11bhiCD45lo (resting microglia) cells and AMD3100 treatment 327

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

(caption on next page)

the hippocampus region. The pattern of lymphoid cell expression in HMGB1 + CXCR7 siRNA treated group was almost like HMGB1 alone group. Infiltration of CD4+ and CD8+ lymphocytes into the brain also contributes to neurodegeneration and therefore we have analyzed the level of these two subsets of lymphocytes in the hippocampus region after different treatment. Our data revealed slight increase in the

(p < 0.04) upregulated it. While the percentage of activated microglia/ invading myeloid cells (CD11bhiCD45int/hi) were downregulated (p < 0.0001) in the hippocampus of HMGB1 + AMD3100 treatment group compared to HMGB1 alone group (Fig. 6A). Apart from that, in the brain of control animal, the no of lymphoid cells was almost nil but in HMGB1 treated animal 7–9% of lymphoid cells were found within 328

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 3. CXCR7 molecule plays an important role in maintaining astroglial homeostasis (A) The immunofluorescence images indicate expression of GFAP (green panels), Hoechst (blue panels) and merged GFAP and Hoechst (merge panels) in hippocampal DG region of the different experimental group. Experimental evidence suggested significant downregulation of GFAP expression and changes in astrocytic morphology of HMGB1 induced and AMD3100 treated group compared to HMGB1 alone group. Where CXCR7 suppression during HMGB1 induction increased the number of reactive astrocytes compared to HMGB1 alone group. (B) Histogram showing the level of reactive astrocyte-derived chemokines CXCL10 and CCL-2 in different experimental groups, measured by ELISA. CXCR7 siRNA treatment significantly up-regulated HMGB1 induced expression of CCL-2 but AMD3100 treatment during HMGB1 induction returned both CXCL10 and CCL2 expression to basal level within the hippocampus region of brain. (C) Relative mRNA expression of different astrocytic proteins, in pure astrocytic cells isolated from hippocampus region of brain of adult mice after HMGB1/ AMD3100/ CXCR7 siRNA administration, measured by real-time PCR. Data shows that HMGB1 majorly affects the JAK-STAT pathway of astrocyte but the expression of astrocytic NF-κB and IκB was not altered much. CXCR7 agonist treatment and CXCR7 suppression after HMGB1 induction lead to downregulation and upregulation the JAK-STAT pathway, respectively. The level of astrocytic C3a was also downregulated after upregulating the expression of CXCR7 by systemic injection of its agonist during HMGB1 induction. (D) Relative mRNA expression of astrocytic SOCS3 and AQP4, in pure astrocytic cells isolated from hippocampus region of brain of adult mice after HMGB1/AMD3100/CXCR7 siRNA administration, measured by real-time PCR. HMGB1 induced upregulation of expression of SOCS3 was returned to basal level after AMD3100 treatment. But the level of AQP-4 was not altered much among different experimental groups. (E) Histogram showing the expression of STAT3 and GFAP in different experimental groups measured by immunofluorescence technique. The immunofluorescence images indicate expression of GFAP (green panels), STAT-3 (red panels) and merged STAT-3 and GFAP (merge panels) in hippocampal CA3 region. AMD3100 treatment significantly downregulated the expression of both STAT3 and GFAP. Sc siRNA showed no effect on astrocytic protein expressions, mRNA levels and the expessions levels of astrocyte derived chemokines. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

about the crucial role played by ‘CXCR7’ in modulating astrocyteneuron communications during HMGB1 induced neuroinflammation. Along with astrocytes, microglial activation is also recognized as the hallmark of neuroinflammation and therefore we aimed to check the expression level of M1/M2 microglial marker within the brain regions related to memory consolidation. At first, we have evaluated the phagocytic activity of microglial cells because phagocytosis is very much essential for microglial clearance of apoptotic cells, extracellular unwanted protein aggregates, and infectious bacteria in the central nervous system. Systemic injection of HMGB1 decreases the capacity of microglial phagocytosis where AMD3100 treatment after HMGB1 induction returned it to the basal level (p = 0.0073). Suppression of CXCR7 by its specific siRNA during HMGB1 treatment decreases the phagocytotic capacity of microglia even more than alone HMGB1 group (p = 0.0023). (Fig. 7A). Next, we have analyzed the expression level of another microglial activation marker ‘CD-68’ within the hippocampal single-cell suspension and found a significant increase in the expression of CD-68 after recombinant HMGB1 treatment. But upregulation of expression of CXCR7 by its agonist had significant effect of it on balancing the number of CD-68 positive microglia (p = 0.0114) (Fig. 7B). Interaction and binding of HMGB-1 with its specific receptor is already known to induce the expressions of pro-inflammatory mediators involving the production of superoxide through the activation of NOX2 (Gao et al., 2011) and activation of NF-κB. In this study, we evaluated the effect of CXCR7 suppression/ activation on the HMGB1 induced over-expression of NFκBp-65 in the hippocampus region. Our data showed significant downregulation (p = 0.0091) of NFκBp-65 level in the hippocampal microglial cells after CXCR7 up-regulation (Fig. 7D). Multiple lines of evidence have also documented a pivotal role of HMGB1 molecule in membrane translocation of p47phox (a cytosolic subunit of NADPH oxidase) and in upregulation of GSK-3β. Our, immunoblot study revealed decrease in expression of both membrane GSK-3β (p = 0.04) and p47phox (p = 0.0351) after CXCR7 upregulation (Fig. 7C and F). Whether peripheral injection of HMGB1 affects the level hippocampus HMGB1 and can cause microglial activation was the major research question of this study and therefore we evaluated the expression level of HMGB1 within hippocampal region after 7 peripheral injections of mouse recombinant HMGB1 and found significant increase in the level of cytosolic HMGB1 expression within hippocampus region. Where AMD3100 treatment downregulated it (p = 0.042) (Fig. 7E). After summarizing our above-mentioned novel findings, it can be concluded that upregulation of CXCR7 expression reduces the activation of the microglial cells and astrocytes as well as modulate glial-neuronal inflammatory signal exchange and subsequent production of proinflammatory factors, that might have significant effect in decreasing the chance of amyloid-beta deposition and associated cognitive decline.

transmigration of CD4+ and CD8+ lymphocytes in HMGB1 and HMGB1 + CXCR7 siRNA group. Although in control, AMD3100, HMGB1 + AMD3100 group there was no evidence of presence of the specific lymphocyte populations within hippocampus region. Flow cytometric analysis of brain dendritic cell subsets (B220+CD11c+) revealed a significant (p < 0.001) rise in the numbers of double-positive cells in HMGB1 + CXCR7siRNA group compared to HMGB1 alone group. CXCR7 agonist treatment also led to a significant decrease in the percentages and total cell numbers (p = 0.042) of infiltrating B220+ cells. (p = 0.042). Apart from that, several previous findings also identified brain-infiltrating monocytes as a contributing factor to neuroinflammation. Here, we examined the percentage of inflammatory monocytes present within the hippocampus region of different groups and found significant increase and decrease in the number of cells in HMGB1 + CXCR7siRNA and HMGB1 + AMD3100 group respectively compared to HMGB1 alone group (Fig. 6B).

3.6. Role of CXCR7 in balancing A1/A2 astrocytic and M1/M2 microglial phenotype Neurotoxic reactive astrocyte (A1 astrocyte) formation is a fundamental pathological response of the CNS to neuroinflammation. Such phenotypic shift of astrocyte occurs in the presence of activated (M1) microglia via secretion of inflammatory cytokines like Il-1α, TNFα. Our previous experimental outcomes identified upregulation in inflammatory pathways including the JAK-STAT pathway within astrocytes. Further we have checked the expression level of another reactive astrocytic marker ‘MMP-3’ which shows a strong and positive correlation with the symptoms of Alzheimer’s disease. We have performed a co-localization study by using GFAP and MMP-3 antibody to know the expression level and localization of the proteins after different treatments. After treatment with AMD3100, HMGB1 induced elevated expression of MMP3 returned to basal level (p < 0.0001) (Fig. 4A) but treatment with CXCR7 siRNA after HMGB1 aggravated the level (p < 0.001). C3, a central complement factor secreted from astrocytes, interacts with neuronal and microglial C3a receptor (C3aR) and leads to CNS pathology and neuroinflammation in response to stress. Our immunofluorescence data suggested significant upregulation of C3 expression within PFC regions of animal brain after peripheral HMGB1 injection. AMD3100 treatment downregulated the expression level of C3 and CXCR7 siRNA treatment upregulated the same (Fig. 4B). Increased C3a-C3aR binding has been reported to modulate neuroinflammation and synaptic plasticity. Thereby, we have also checked the level of C3aR in pure neuronal cells. Flow cytometric analysis identified increase in the expression of C3R within the hippocampus region after HMGB1 treatment where the expression was comparatively low (p < 0.001) after AMD3100 treatment (Fig. 4C). The results concluded 329

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 4. CXCR7 counterbalances astrocyte-derived toxicity and astrocyte-neuron communications (A) Histogram showing the expression of MMP3 and GFAP in different experimental groups measured by immunofluorescence technique. The immunofluorescence images indicate expression of GFAP (red panels), MMP-3 (green panels) and merged MMP-3 and GFAP (merge panels) in hippocampus. AMD3100 treatment significantly downregulated and CXCR7 suppression significantly upregulated the expression of both STAT3 and GFAP. (B) Histogram showing the expression of complement protein 3 in different experimental groups. Immunofluorescence images indicated expression of C3 (green panels) in PFC region. The target gene knockdown by CXCR7 siRNA increased the expression of HMGB1 induced C3 in this brain region. AMD3100 treatment, on the other hand, significantly downregulated the expression of HMGB1 induced C3. (C) Histogram showing the expression of C3R of pure neuronal cells, isolated from adult mice from different experimental groups measured by flow cytometric technique. CXCR7 upregulation by agonist treatment leads to significantly downregulated the expression of C3 in the PFC region of adult animals. Sc siRNA showed no effect on expressions of glial MMP3. C3 and neuronal C3R. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

HMGB1 + AMD3100 group the percentage of early apoptotic (p = 0.0438) and dead (p = 0.0103) cells were significantly less. But suppression of CXCR7 during HMGB1 treatment increases the percentage of apoptotic cells even more than HMGB1 alone group. Suppression of CXCR4 by its siRNA also downregulated HMGB1 induced percentage of apoptotic cells although AMD3100 was more effective in downregulating the number of apoptotic cells (Fig. 8A). To confirm the above findings, we have performed Fluoro-Jade C (FJC), an anionic fluorescent dye, staining to mark the degenerating neurons of hippocampal CA3, DG and PFC region. In PFC (p = 0.0337) and CA3 (p = 0.0303) region significant changes in the number of degenerated neurons were observed after AMD3100 treatment compared to

3.7. Effect of CXCR7 knockdown/upregulation on HMGB1 induced neuronal apoptosis, autophagy and neurodegeneration of PFC and hippocampal CA3 region HMGB1 shows its deleterious effect on brain regions associated with memory impairment by enhancing the neuroinflammatory and neurodegenerative signal to brain tissues and ultimately leads to cellular death. Extracellular release of HMGB1 from neurons and glia is known to be highly correlated with the number of apoptotic cells within CNS. Here, we found similar results where HMGB1 upregulated the number of early apoptotic (only Annexin-V-FITC positive) as well as dead cells (Annexin-V-FITC and PI-positive duel positive). Where in the 330

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 5. CXCR7 is a key homeostatic molecule for maintaining blood-brain barrier integrity: (A) Histogram showing the changes in CXCL12 polarity measured by immunofluorescence technique. Images indicate expression of CD-31(green panels), Topro-3-CD 31 merged panel (green-blue panels) and CD 31-CXCL12 merged panel (green red panels). Data are representative of 6 images/experimental group. Quantitative analysis of CXCL12 on CD31+ venules indicates HMGB1 induction leads to loss of polarity of CXCL12 within the hippocampus where AMD3100 treatment even after HMGB1 induction retained it. CXCR7 suppression by RNA interference during HMGB1 was linked with highest loss of polarity of CXCL12. (B), (C), (D) and (E) represent histograms indicating the ratio of densitometry values of MMP-9, MMP-2, Claudin-5 and ZO-1 to β-actin/ GAPDH from three independent experiments. Results indicating significant upregulation of MMP-9 and MMP-2 and downregulation of ZO-1, claudin-5 level after 7 systemic injections of HMGB1 where AMD3100 treatment leads to significant reversal of the expression of those proteins. (F) 3D histograms indicating extravasation of Evans blue dye (µg/hemisphere of mice brain) to the hippocampus region of different experimental groups. Recombinant HMGB1 administration to mice model of dementia leads to increased leakage of dye through BBB and indicate loss of integrity of BBB (increase in dye extravasation of right hemispheres were from control samples; 0.43 ± 0.14 to HMGB1 induced brain; 3.1 ± 1.5 and left hemispheres were from 0.12 ± 0.05 to 3.2 ± 1.3 where agonist-induced overexpression of CXCR7 prevents such loss of integrity (dye extravasation of right hemispheres was from HMGB1 induced brain; 3.1 ± 1.5 to HMGB1 + AMD3100 induced brain; 0.86 ± 0.6 and left hemispheres was from 3.2 ± 1.3 to 0.8 ± 0.4. Suppression of CXCR7 during HMGB1 treatment had no such significant effect on HMGB1 induced loss of blood-brain barrier integrity. Sc siRNA showed no effect on HMGB1 induced loss of CXCL12 polarity, junctional protein expressions and loss of BBB permeability. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

effect of CXCR7 expression alteration on HMGB1 induced changes in the level of molecular synaptic plasticity markers like SNAP-25, PSD95. SNAP-25, a presynaptic Q-SNARE protein anchored to the cytosolic face of membranes, plays a key role in vesicle fusion. Our immunoblot data suggested that AMD3100 treatment during HMGB1 induction significantly (p = 0.001) upregulated the level of SNAP-25 expression compared to HMGB1 group within the hippocampus region (Fig. 9B). On the other hand, the level of PSD95, another key player for regulating synaptic transmission and plasticity, shows similar expression pattern after different treatments (Fig. 9C). We have also measured the level of two dementia hallmark proteins, BACE-1 and APP in the hippocampus of animal brains after different treatment. BACE-1, which is considered as a prime therapeutic drug for targeting AD, was upregulated after peripheral HMGB1 injection but returned to basal level (p = 0.0091) in HMGB1 + AMD3100 group (Fig. 9A). In case of APP, a key regulator of amyloid-beta accumulation, the expression pattern was almost like BACE-1. The relative expression of hippocampal AAP was significantly (p = 0.010) low in HMGB1 + AMD3100 group compared to HMGB1

HMGB1 + AMD3100 treatment group. In the DG region, although the changes were not significant, pattern of expression was quite like other two brain regions (Fig. 8B). Analysis of nuclear condensation in the CA3 region of animal’s brain of different treatment group by Hoechst 33342 staining, which is used to distinguish apoptotic brain cells from healthy or necrotic cells, showed significantly (p = 0.024) increased neuronal viability in the CA3 region of hippocampus (Fig. 8C) after upregulating the expression of CXCR7. Although the level of HMGB1 induced autophagy genes ‘Beclin-1’ was unchanged after AMD3100 or CXCR7 treatment (Fig. 8D). 3.8. CXCR7 is a key molecule for facilitating long term potentiation mechanism within mice brain Long term potentiation, a mechanism of persistent strengthening of synapses, underlies learning and memory. Disruption of synaptic functions of the PFC and hippocampus region are considered as the core feature of cognitive dysfunction. Thereby, we have investigated the 331

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 6. CXCR7 molecule is important for preventing HMGB1 induced peripheral cell entry to CNS parenchyma especially to the hippocampus of experimental animals: (A) Histogram showing flow cytometric analysis of total numbers of CD4+, CD8+, B220+ cells harvested from hippocampus region of experimental animals from different groups. The figure shows presence of up to 10% of CD4+ (almost 0.35 × 105 cells) but no CD8+ cells after 7 doses of HMGB1 induction. But CXCR7 agonist treatment during HMGB1 induction shows presence of only 1% of CD4+ (0.02 × 105) cells and no CD8+ cells. Suppression of CXCR7 by administration of its specific siRNA for 3 days during continuous HMGB1 exposure leads to upregulation in the numbers of invaded CD4+ (12% i.e. 0.6 × 105) cells and CD8+ (0.2% i.e.0.05 × 105) leukocytes. The number of B220+ cells harvested from the hippocampus of HMGB1 injected and AMD3100 administered animals were also down-regulated significantly (from 4.2 × 105 to 2.1 × 105 cells) compared to alone HMGB1 group. The numbers of resting/M2 microglia (CD11bhigh CD45low) were downregulated after HMGB1 but AMD3100 treatment reversed that. On the other hand, the numbers of invading myeloid cells were found to be less in HMGB1 + AMD3100 group compared to HMGB1 administered group. (B) Graph showing the percentage of inflammatory monocytes in the hippocampus regions of different experimental groups. Systemic HMGB1 administration increases the percentage of inflammatory monocytes (4–6%) within the hippocampus but upregulation of CXCR7 during HMGB1 treatment returns the percentage to basal (0–1.5%) level. CXCR7 knockdown during HMGB1 treatment although significantly enhanced the percentage of inflammatory monocytes (5.8–9%).Sc siRNA showed no effect on peripheral inflammatory cell infiltration to hippocampus region after HMGB1 treatment.

3.9. Effect of CXCR7 upregulation/suppression on memory loss parameters in a mice model of HMGB1 induced dementia

alone group (Fig. 9D). Next, to know the role of CXCR7 in synaptic plasticity we have analyzed the expression of 84 mice synaptic plasticity genes central to synaptic alterations during learning and memory in the hippocampus region of brain. Out of 84 genes investigated, total 18 genes were significantly altered (≥3 fold) after HMGB1/AMD3100/ CXCR7 siRNA treatment. HMGB1 induction significantly altered the expression of some immediate-early response genes including Bdnf, creb1, Homer1, MMP-9, Egr-2, Nfkbib, Ngf, Tnf and one late response gene, synpo. Where treatment with AMD3100 significantly returned the expression to basal level. Suppression of CXCR7 by its siRNA during HMGB1 treatment aggravates the expression of all those genes. Some specific LTP and LTD affecting molecules like Camk2a, ngfr, pick1, Nos-1 was also altered significantly after different treatment. Experimental outcomes also showed alteration in gene expression of cell adhesion molecules, extracellular matrix molecules, CREB Cofactors and neuronal receptors including Adam10, MMP-9, and Gabra-5 (Fig. 9E). Expression of Dlg-4 gene encoding PSD-95 was also upregulated in the hippocampus of animals of HMGB1 + AMD3100 group compared to HMGB1 induced group, but the changes were not significant.

We foremost evaluated the effect of HMGB1 on the spatial memory of mice. We performed the MWM-based spatial memory test during HMGB1 treatment and found significantly increased latency (Fig. 10A) and path length (Fig. 10A) with reduced path efficiency (Fig. 10A) to reach the platform following 7 days of systemic HMGB1 injection. A significantly reduced number of entries (Fig. 10B) and time spent (Fig. 10B) in the ISLAND zone were also observed in HMGB1 induced animals. Next, we have evaluated the effect of CXCR4 siRNA in both spatial and working memory error parameters but found no ameliorative effect of the molecule against HMGB1 medaied memory impairment (Sup Fig. 2A). Where significant reversal of spatial memory was observed post AMD3100 treatment to HMGB1 induced animals. A significantly improved performance as reduced latency (p < 0.001) and path length (p = 0.0007) with enhanced path efficacy (p = 0.0003) to reach the platform was observed. But, CXCR7 suppression during HMGB1 treatment significantly impaired performance parameters (increased latency; p < 0.0001, increased path length; p = 0.0139, reduced path efficiency; p < 0.0001), even more than HMGB1 alone group. We have also performed the RAM-based reference and working memory test post HMGB1, CXCR7 siRNA, AMD3100 treatment and 332

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 7. CXCR7 is important for maintaining neuroprotective microglial phenotype: (A) Represents histograms of the phagocytotic capacity of microglial cell by zymosan-FITC uptake assay. Microglia isolated from the hippocampus regions of HMGB1 induced group and HMGB1 + CXCR7 siRNA induced group show decreased phagocytotic capability of microglial cells where AMD3100 treatment increased the capability to basal levels. (B) Represents histogram of flow cytometric analysis of active microglial marker CD-68 of hippocampus region. Experimental evidence showed significant downregulation of HMGB1 induced level of CD-68 after CXCR7 agonist treatment. (C), (D), (E) and (F) represent histograms showing the ratio of densitometry values of cytoplasmic GSK-3β, nuclear NF-κB, cytoplasmic HMGB1, and p47 phox to β-actin/gp91 from three independent experiments indicating significant suppression in expression levels of all those proteins after 7 times of AMD3100 treatment during HMGB1 treatment. Sc siRNA showed no effect on HMGB1 induced shift in microglial polarization.

HMGB1 induced memory impairment. As non-invasive intranasal siRNA administration has been noted to allow direct delivery of siRNA to the brain, therefore, the efficacy of intranasal CXCR7 siRNA/Sc siRNA delivery was investigated in the animal brain. Here, we provided direct experimental evidence implicating successful delivery of CXCR7 siRNA and subsequent target gene knockdown in brain regions including PFC and CA3 of hippocampus. Furthermore, the intranasal delivery of CXCR7 siRNA during recombinant HMGB1 administration enhanced HMGB1-CXCL12 complex formation and immune cell infiltration to CNS. At the same time, significant downregulation of the complex formation by CXCR7 agonist strongly indicated the possible role of CXCR7 in inhibiting HMGB1 induced infiltration of inflammatory cells to CNS. Experimental outcomes from our study showed the significant negative effect of CXCR7 agonist, ‘AMD3100’ in mediating HMGB1 induced leukocyte trafficking within hippocampus region where CXCR7 ablation during HMGB1 administration resulted in high immune cell infiltration, as evidenced by presence of abnormal percentage of inflammatory monocytes and dendritic cells within hippocampus region. All the above findings revealed the key role played by CXCR7 molecule in regulating BBB permeability. Previous animal studies indicated that polarized expression of CXCL12 at the BBB prevents leukocyte extravasation into brain and disruption of CXCL-12 polarity promotes entry of autoreactive leukocytes and inflammation (McCandless et al., 2008). Here, in HMGB1 induced model of dementia, we have checked CXCL12 polarity and the role of CXCR7 molecule in regulating such pathological expression of

found significant effect of 7 days of continuous HMGB1 exposure on both reference and working memory (15th day onwards). Treatment of AMD3100 overall significantly decreased the number of reference and working memory error scores, especially at testing days 15, 18, 21, 24 and 27 (Fig. 10D and E). Where suppression of CXCR7 during HMGB1 treatment increased the number of errors even compared to HMGB1 alone group.

4. Discussion Elucidating the pathophysiological impact of elevated systemic HMGB1 on CNS glial cells, associated memory deficit and the emerging role played by glial chemokine receptors CXCR4 and CXCR7 molecule to counterbalance HMGB1 induced memory loss was the major focus of the experimental design of the present study. Therefore, in this current study, animal memory was impaired not by conventional cognitive impairment inducing amyloid beta injection, but instead recombinant HMGB1 was used as CNS inflammation-inducing condition. Experimental outcomes from the pilot studies of our laboratory indicated that CXCR7 agonists, compared to CXCR4 siRNA, showed intense therapeutic effects against HMGB1-CXCL12 complex induced disbalance in neuroimmunological axis and subsequent memory loss. Thereby we chose CXCR7 upregulation strategy over CXCR4 downregulation to counterbalance HMGB1 induced memory loss. Along with that, another research question of the current study was whether depletion of CXCR7 during HMGB1 treatment leads to aggravation of 333

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 8. CXCR7 upregulation increases neuronal viability in the mice model of HMGB1 induced dementia: (A) Histogram indicating the number of apoptotic cells in the hippocampus region of the brain of different experimental animals, measured by Annexin V-PI staining and flow cytometry. The number of early and late apoptotic cells were upregulated after HMGB1 treatment but significantly downregulated after CXCR7 agonist treatment. The number and percentage of dead cells were also downregulated by AMD3100 treatment as well as CXCR4 suppression by RNA interference. On the other hand, suppression of CXCR7 upregulates/shows no effect on cellular apoptosis and death. (B) FJC staining of CA3, DG and PFC regions of different experimental groups reveals decreased number of degenerated neurons within all three different regions of brain after CXCR7 upregulation where suppression of the receptor during HMGB1 induction increased the number of FJC positive neurons in all three regions of brains. (C) Histogram showing the number of apoptotic (chromatin condensation) cells in the CA3 region of hippocampus by Hoechst staining. Brightly stained cells are considered as apoptotic cells. Hoechst staining also confirmed the fact that CXCR7 upregulation by AMD3100 decreases the number of apoptotic cells within the CA3 region of hippocampus. (D) Histogram showing fold changes of expression of Beclin-1 and BCL-2 in different experimental groups by real-time PCR analysis. Data shows that AMD3100 has no effect on the expression level of those two proteins. Sc siRNA showed no effect on the percentage of apoptotic and degenerated neurons of different brain regions. Again, after treatment with siRNA no alteration was found in the expressions of autophagy genes like BCL2 and Beclin-1.

CXCL-12. Our finding also revealed redistribution of CXCL12 towards vessel lumena after HMGB1/HMGB1 + CXCR7 siRNA treatment. In contrast, AMD3100 treatment during HMGB1 induction led to basolateral localization of CXCL12. Expressions of some other critical regulators of brain homeostasis like MMPs, ZO-1, claudin-5 were also altered after HMGB1 induction but CXCR7 molecule played important role in balancing the homeostatic level of those markers. Blood-brain barrier permeability test quantified by Evans blue dye also revealed increased HMGB1 induced loss of BBB integrity and key role played by CXCR7 molecule in balancing CNS integrity. Further, we hypothesized that HMGB1 induced alteration of BBB permeability could be associated with changes in glial phenotype and subsequent alteration of endothelium glial interactions. Treatment of microglia with both exogenous and endogenous HMGB1 causes enhanced HMGB1 binding with different microglial receptors and subsequent activation of downstream pathways (Gao et al., 2002). Such classically activated neuroinflammatory microglia incite formation of A1 reactive astrocytes by secreting pro-inflammatory mediators (Liddelow et al., 2017). More importantly, activated microglia form a vicious cycle with degenerated neurons for mediating chronic and

progressive neurodegeneration. Experimental outcomes of the current study, for the first time, proved the beneficial effect of CXCR7 molecule for deriving HMGB1 induced reactive M1 microglia towards resting M2 phenotype. This shift was substantiated by increased microglial phagocytic capacity, downregulated expression of M1 microglial markers like membrane CD-68, membrane p47phox, cytosolic GSK3β, nuclear NF-κB expression and decreased pro-inflammatory mediators after CXCR7 agonist treatment. AMD3100 treatment also affected M1 microglia-mediated phenotype shifting of astrocytes especially by altering the activation state of JAK-STAT3 pathway and level of A1 astrocytederived chemokines. Twenty two genes related to expression of inflammatory receptors and cytokines were altered within animal hippocampus by HMGB1 and HMGB1 + CXCR7 siRNA administration where AMD3100 treatment returned those mRNA expressions to homeostatic basal levels. Thereby, the current study reported that CXCR7 activation resolved and CXCR7 ablation aggravated glia-neuron vicious cycle mediated neurodegeneration by altering glial activation state. Experimental findings of the current study also indicated decreased number of HMGB1 induced apoptotic neuronal cells after CXCR7 up-regulation by its agonist. One of the possible reasons for this

334

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 9. CXCR7 upregulation favors synaptic long-term potentiation mechanism, even after HMGB1 induction: (A), (B), (C) & (D) represents histograms showing the ratio of densitometry values of BACE-1, SNAP-25, PSD-95, APP to GAPDH from three independent experiments. AMD3100 treatment returned the level of all those proteins to basal levels by neutralizing HMGB1 induced neuroinflammatory responses. (E) Heatmap showing significant alteration of 18 genes (≥3 fold) after HMGB1/AMD3100/ CXCR7 siRNA treatment. HMGB1 induction significantly altered the expression of some immediate-early response genes (Bdnf, creb1, Homer1, MMP-9, Egr-2, Nfkbib, Ngf, Tnf), one late response gene (synpo) Where treatment with AMD3100 significantly returned the expression to basal level. Suppression of CXCR7 by its siRNA during HMGB1 treatment aggravates the expression of all those genes. Some specific LTP and LTD affecting molecules (Camk2a, ngfr, pick1, Nos1) were also altered significantly after different treatment. Experimental outcomes also showed alteration in gene expression of cell adhesion molecules, extracellular matrix molecules, CREB Cofactors and neuronal receptors including Adam10, MMP-9, and Gabra-5. Sc siRNA showed no effect in the expression levels of genes related to synaptic plasticity.

agonist molecule ‘AMD3100’ in reversing the same. A further understanding of how these synaptic molecules affect synaptic transmission in HMGB1 dementia model will hopefully lead to development of a different neuroprotective strategy aimed at preserving neuronal function and integrity. A behavioral study using eight-arm radial maze and Morris water maze clearly indicated decreased number of memory error scores and improved maze performance in HMGB1 induced and AMD3100 treated group, compared to HMGB1/HMGB1 + CXCR7 siRNA group, which might be a summative effect of glial phenotype switching, suppressed neuroinflammatory responses, neuronal receptor expression modification and regained synaptic functionality. In summary, our study showed that the systemic administration of HMGB1 led to neurocognitive impairment by altering the neuroimmunological axis of CNS and suppression of CXCR7 by RNA interference during HMGB1 treatment aggravated the responses. CXCR7 agonist molecules (CCX771, AMD3100 and VUF11207) in contrast had an excellent outcome that includes halt in HMGB1 induced conversion of M2 microglia towards a M1 phenotype, A2 astrocyte towards A1 phenotypes, inflammatory communications between glial cells and neurons, neuronal apoptosis in hippocampus region and memory impairment by altering the expressions of synaptic plasticity and memory impairment markers. Overall, this study unmasked the role of atypical chemokine receptor ‘CXCR7’ as a key homeostatic molecule for neutralizing alarmin HMGB1 induced neuroinflammation and subsequent memory loss.

reduction is decreased expression of neuronal C3R, the key mediator of interactions between microglia and synapses, by CXCR7 agonist. Along with HMGB1 mediated shift in neuroinflammatory arm, alteration of the blood-brain barrier permeability and peripheral immune cells entry to CNS, another equally important outcome of the present study was significant alteration in the main physiological correlate of memory deficits i.e. synaptic plasticity after HMGB1 administration to naïve animals. When compared to control mice, in fact, hippocampal LTD induction was favored over LTP in the HMGB1 induced dementia model of mice. HMGB1 administration significantly altered the mRNA level of 18 synaptic plasticity markers (out of 84 experimental mRNAs evaluated) and protein levels of ‘PSD 95’ and ‘SNAP-25’ in the hippocampus region. The expression level of specific LTP related genes Bdnf, Creb1, Homer1, Ngf, synpo, Camk2a, ngfr, Adam10, pick1 and Cdh2 were significantly downregulated after HMGB1 treatment. On the other hand, LTD genes Egr2, Nos-1, Nfkbib, Tnf, Mapk1, Mmp9, Akt1 and Gabra5 were upregulated significantly after peripheral HMGB1 administration. Both LTP and LTD affecting gene expressions were returned to basal level and reversed the synaptic dysregulation after enhancing CXCR7 expression by agonist treatment. Thereby, upregulation of CXCR7 by ‘AMD3100’ was shown to regain the synaptic functionality majorly by neutralizing HMGB1’s pathophysiological effect on LTP/ LTD molecules. Treatment with AMD3100 during continuous HMGB1 exposure also prevented amyloidogenesis, BACE1 production and other neuroinflammatory responses leading to cognitive dysfunctions. Whereas, intranasal delivery of CXCR7 siRNA during HMGB1 treatment enhanced the expression level of APP and BACE-1. The probable reason behind the alteration of these synaptic markers was altered activation status of NF-κB by the CXCR7 agonist/siRNA treatments as NF-κB is considered as the master regulator for transcription of BACE1, APP, and other synaptic depression markers. Overall this study elucidated the underlying mechanism of HMGB1 induced alteration of synaptic plasticity and at the same time, it unmasked the excellent activity of CXCR7

5. Conclusion The important findings of the current study revealed the crucial role of chemokine receptor CXCR7 in ameliorating neurodegenerative signals during exogenous HMGB1 exposure and supported the use of systemically delivered CXCR7 agonist as a novel therapeutic agent for the treatment of neurodegenerative disorders with a decline in memory 335

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

Fig. 10. Systemic AMD3100 administration is beneficial for treating HMGB1 induced memory loss but suppression of CXCR7 during continuous HMGB1 administration aggravates memory impairment: (A) & (B) Track plots of memory test session and histograms of memory impairment study parameters such as latency, path length, path efficiency [with hidden platform] and number of entries, time spent [no hidden platform]. 7 times peripheral injection of recombinant HMGB1 lead to loss of both spatial and working memory where CXCR7 agonist treatment ameliorated the error scores significantly. CXCR7 siRNA treatment by its siRNA again enhanced HMGB1 induced memory impairment scores in both types of maze experiments. (C) 7 doses of AMD3100 treatment during continuous HMGB1 exposure of 7 days shows its significant impact on HMGB1 induced working and reference memory impairment, measured by radial arm maze test. In the graph, ‘a’ refers to significance between the corresponding day of HMGB1 treated group and HMGB1 + AMD3100 injected groups at p < 0.001. ‘b’ refers to significance between the corresponding day of HMGB1 and HMGB1 + AMD3100 injected animals at p < 0.05. ‘c’ refers to Significant between a time point and the previous time point of HMGB1 at p < 0.05. ‘d’ refers to Significance between the corresponding day of HMGB1 and HMGB1 + CXCR7 siRNA injected animals at p < 0.05. Sc siRNA alone or in combination with HMGB1 showed no effect on spatial as well as working memory error parameters. 336

Brain, Behavior, and Immunity 82 (2019) 319–337

S. Das, et al.

as a common symptom. The current study also revealed the neurodegenerative effect of intranasally delivered CXCR7 siRNA on hippocampus region of animal brains thereby validating that suppression of this receptor by non-invasive drug delivery approach along with systemic HMGB1 administration might be an effective strategy for establishing animal model of neurodegenerative dementia.

s12035-012-8264-y. Festoff, B.W., Sajja, R.K., van Dreden, P., Cucullo, L., 2016. HMGB1 and thrombin mediate the blood-brain barrier dysfunction acting as biomarkers of neuroinflammation and progression to neurodegeneration in Alzheimer’s disease. J. Neuroinflammation 13 (1), 194. https://doi.org/10.1186/s12974-016-0670-z. Gao, H.-M., Jiang, J., Wilson, B., Zhang, W., Hong, J.-S., Liu, B., 2002. Microglial activation-mediated delayed and progressive degeneration of rat nigral dopaminergic neurons: relevance to Parkinson’s disease. Retrieved from. J. Neurochem. 81 (6), 1285–1297. http://www.ncbi.nlm.nih.gov/pubmed/12068076. Gao, H.-M., Zhou, H., Zhang, F., Wilson, B.C., Kam, W., Hong, J.-S., 2011. HMGB1 acts on microglia Mac1 to mediate chronic neuroinflammation that drives progressive neurodegeneration. J. Neurosci.: Off. J. Soc. Neurosci. 31 (3), 1081–1092. https://doi. org/10.1523/JNEUROSCI.3732-10.2011. Harris, H.E., Andersson, U., Pisetsky, D.S., 2012. HMGB1: a multifunctional alarmin driving autoimmune and inflammatory disease. Nat. Rev. Rheumatol. 8 (4), 195–202. https://doi.org/10.1038/nrrheum.2011.222. Huang, J., Li, Y., Tang, Y., Tang, G., Yang, G.-Y., Wang, Y., 2013. CXCR4 antagonist AMD3100 protects blood-brain barrier integrity and reduces inflammatory response after focal ischemia in mice. Stroke 44 (1), 190–197. https://doi.org/10.1161/ STROKEAHA.112.670299. Jonasson, Z., 2005. Meta-analysis of sex differences in rodent models of learning and memory: a review of behavioral and biological data. Neurosci. Biobehav. Rev. 28 (8), 811–825. https://doi.org/10.1016/j.neubiorev.2004.10.006. Liddelow, S.A., Guttenplan, K.A., Clarke, L.E., Bennett, F.C., Bohlen, C.J., Schirmer, L., Barres, B.A., 2017. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 541 (7638), 481–487. https://doi.org/10.1038/nature21029. Li, M., Sun, L., Luo, Y., Xie, C., Pang, Y., Li, Y., 2014. High-mobility group box 1 released from astrocytes promotes the proliferation of cultured neural stem/progenitor cells. Int. J. Mol. Med. 34 (3), 705–714. https://doi.org/10.3892/ijmm.2014.1820. Mazarati, A., Maroso, M., Iori, V., Vezzani, A., Carli, M., 2011. High-mobility group box-1 impairs memory in mice through both toll-like receptor 4 and Receptor for Advanced Glycation End Products. Exp. Neurol. 232 (2), 143–148. https://doi.org/10.1016/j. expneurol.2011.08.012. McCandless, E.E., Piccio, L., Woerner, B.M., Schmidt, R.E., Rubin, J.B., Cross, A.H., Klein, R.S., 2008. Pathological expression of CXCL12 at the blood-brain barrier correlates with severity of multiple sclerosis. Am. J. Pathol. 172 (3), 799–808. https://doi.org/ 10.2353/ajpath.2008.070918. Mizuno, M., Yamada, K., Olariu, A., Nawa, H., Nabeshima, T., 2000. Involvement of brain-derived neurotrophic factor in spatial memory formation and maintenance in a radial arm maze test in rats. Retrieved from. J. Neurosci.: Off. J. Soc. Neurosci. 20 (18), 7116–7121. http://www.ncbi.nlm.nih.gov/pubmed/10995859. Ren, C., Li, X.-H., Wu, Y., Dong, N., Tong, Y.-L., Yao, Y.-M., 2019. Inhibition of cerebral high-mobility group box 1 protein attenuates multiple organ damage and improves T cell-mediated immunity in septic rats. Mediators Inflamm. 2019, 6197084. https:// doi.org/10.1155/2019/6197084. Schiraldi, M., Raucci, A., Muñoz, L.M., Livoti, E., Celona, B., Venereau, E., Uguccioni, M., 2012. HMGB1 promotes recruitment of inflammatory cells to damaged tissues by forming a complex with CXCL12 and signaling via CXCR4. J. Exp. Med. 209 (3), 551–563. https://doi.org/10.1084/jem.20111739. Shi, Y., Zhang, L., Teng, J., Miao, W., 2018. HMGB1 mediates microglia activation via the TLR4/NF-κB pathway in coriaria lactone induced epilepsy. Mol. Med. Rep. 17 (4), 5125–5131. https://doi.org/10.3892/mmr.2018.8485. Uto-Konomi, A., McKibben, B., Wirtz, J., Sato, Y., Takano, A., Nanki, T., Suzuki, S., 2013. CXCR7 agonists inhibit the function of CXCL12 by down-regulation of CXCR4. Biochem. Biophys. Res. Commun. 431 (4), 772–776. https://doi.org/10.1016/j.bbrc. 2013.01.032. Werner, L., Guzner-Gur, H., Dotan, I., 2013. Involvement of CXCR4/CXCR7/CXCL12 interactions in inflammatory bowel disease. Theranostics 3 (1), 40–46. https://doi.org/ 10.7150/thno.5135. Yun, J., Jiang, G., Wang, Y., Xiao, T., Zhao, Y., Sun, D., Shao, H., 2017. The HMGB1CXCL12 complex promotes inflammatory cell infiltration in uveitogenic T cell-induced chronic experimental autoimmune uveitis. Front. Immunol. 8, 142. https:// doi.org/10.3389/fimmu.2017.00142.

Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgments The study was supported by Defence Research and Development Organization, Ministry of Defence, Government of India. SD thanks DRDO for providing financial support in the form of Junior Research Fellowship and Senior Research Fellowship. SD also thanks Dr. Divya Singh, Anilendu Pramanik, koustav Roy, Subhajit Ghosh and Jigni Mishra for their significant contributions to the current study. Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.bbi.2019.09.003. References Andersson, U., Tracey, K.J., 2011. HMGB1 is a therapeutic target for sterile inflammation and infection. Annu. Rev. Immunol. 29, 139–162. https://doi.org/10.1146/annurevimmunol-030409-101323. Beaudoin, G.M.J., Lee, S.-H., Singh, D., Yuan, Y., Ng, Y.-G., Reichardt, L.F., Arikkath, J., 2012. Culturing pyramidal neurons from the early postnatal mouse hippocampus and cortex. Nat. Protoc. 7 (9), 1741–1754. https://doi.org/10.1038/nprot.2012.099. Ben Haim, L., Ceyzériat, K., Carrillo-de Sauvage, M.A., Aubry, F., Auregan, G., Guillermier, M., Escartin, C., 2015. The JAK/STAT3 pathway is a common inducer of astrocyte reactivity in Alzheimer’s and Huntington’s diseases. J. Neurosci.: Off. J. Soc. Neurosci. 35 (6), 2817–2829. https://doi.org/10.1523/JNEUROSCI.3516-14.2015. Boldajipour, B., Mahabaleshwar, H., Kardash, E., Reichman-Fried, M., Blaser, H., Minina, S., Raz, E., 2008. Control of chemokine-guided cell migration by ligand sequestration. Cell 132 (3), 463–473. https://doi.org/10.1016/j.cell.2007.12.034. Chavan, S.S., Huerta, P.T., Robbiati, S., Valdes-Ferrer, S.I., Ochani, M., Dancho, M., Diamond, B., 2012. HMGB1 mediates cognitive impairment in sepsis survivors. Mol. Med. (Cambridge, Mass.) 18, 930–937. https://doi.org/10.2119/molmed.2012. 00195. Das, S., Mishra, K.P., Ganju, L., Singh, S.B., 2017. Andrographolide - A promising therapeutic agent, negatively regulates glial cell derived neurodegeneration of prefrontal cortex, hippocampus and working memory impairment. J. Neuroimmunol. 313, 161–175. https://doi.org/10.1016/j.jneuroim.2017.11.003. Das, S., Mishra, K.P., Ganju, L., Singh, S.B., 2018. Intranasally delivered small interfering RNA-mediated suppression of scavenger receptor Mac-1 attenuates microglial phenotype switching and working memory impairment following hypoxia. Neuropharmacology 137, 240–255. https://doi.org/10.1016/j.neuropharm.2018.05. 002. Fang, P., Schachner, M., Shen, Y.-Q., 2012. HMGB1 in development and diseases of the central nervous system. Mol. Neurobiol. 45 (3), 499–506. https://doi.org/10.1007/

337